Backward compatibility of whole genome sequencing data with MLVA typing using a new MLVAtype shiny application for Vibrio cholerae
Authors:
Jérôme Ambroise aff001; Léonid M. Irenge aff001; Jean-François Durant aff001; Bertrand Bearzatto aff001; Godfrey Bwire aff002; O. Colin Stine aff003; Jean-Luc Gala aff001
Authors place of work:
Center for Applied Molecular Technologies, Institute of Clinical and Experimental Research, Université catholique de Louvain, Brussels, Belgium
aff001; Ministry of Health Uganda, Department of Community Health, Kampala, Uganda
aff002; University of Maryland School of Medicine, Department of Epidemiology and Public Health, Baltimore, Maryland, United States of America
aff003
Published in the journal:
PLoS ONE 14(12)
Category:
Research Article
doi:
https://doi.org/10.1371/journal.pone.0225848
Summary
Background
Multiple-Locus Variable Number of Tandem Repeats (VNTR) Analysis (MLVA) is widely used by laboratory-based surveillance networks for subtyping pathogens causing foodborne and water-borne disease outbreaks. However, Whole Genome Sequencing (WGS) has recently emerged as the new more powerful reference for pathogen subtyping, making a data conversion method necessary which enables the users to compare the MLVA identified by either method. The MLVAType shiny application was designed to extract MLVA profiles of Vibrio cholerae isolates from WGS data while ensuring backward compatibility with traditional MLVA typing methods.
Methods
To test and validate the MLVAType algorithm, WGS-derived MLVA profiles of nineteen Vibrio cholerae isolates from Democratic Republic of the Congo (n = 9) and Uganda (n = 10) were compared to MLVA profiles generated by an in silico PCR approach and Sanger sequencing, the latter being used as the reference method.
Results
Results obtained by Sanger sequencing and MLVAType were totally concordant. However, the latter were affected by censored estimations whose percentage was inversely proportional to the k-mer parameter used during genome assembly. With a k-mer of 127, less than 15% estimation of V. cholerae VNTR was censored. Preventing censored estimation was only achievable when using a longer k-mer size (i.e. 175), which is not proposed in the SPAdes v.3.13.0 software.
Conclusion
As NGS read lengths and qualities tend to increase with time, one may expect the increase of k-mer size in a near future. Using MLVAType application with a longer k-mer size will then efficiently retrieve MLVA profiles from WGS data while avoiding censored estimation.
Keywords:
Sequence assembly tools – Vibrio cholerae – Sequence motif analysis – Genomic libraries – Polymerase chain reaction – Uganda – Dideoxy DNA sequencing – Tandem repeats
Introduction
Rapid molecular typing of pathogens associated with human and animal diseases has proven instrumental in the surveillance and control of infectious diseases [1, 2]. Pulsed field gel-electrophoresis (PFGE), which was long considered as the gold standard for molecular typing of pathogens associated with outbreaks, has been superseded by Multi-Locus Sequence Typing (MLST) or Multi-Locus Variable Number of Tandem Repeats (VNTR) Analysis (MLVA), and more recently by Whole Genome Sequencing (WGS) [3].
However, unlike MLVA, WGS analysis requires a specific expertise in bioinformatics and is not yet affordable in all developing countries where highly pathogenic diseases would make it the most useful and such a method would be the most needed. One can therefore be sure that MLVA and WGS subtyping will coexist in years to come, making necessary a methodology enabling end-users (i.e. researchers, clinicians, microbiologist and epidemiologists) to compare respective results.
Accordingly, in silico methods which extract low-throughput typing results (e.g., MLST or MLVA) from WGS data should be developed to enable users to compare subtyping results irrespective of the methodology and time of data acquisition. Both parameters are important when WGS data need to be compared with data generated before the WGS era.
Whereas the number of tandem repeats at different VNTR loci may theoretically be retrieved from WGS data, like currently done when extracting MLST from WGS, this was practically not considered feasible with MLVA because of a lack of accuracy of genomes assembly derived from Next Generation Sequencing (NGS) short reads [4]. Limited backward compatibility of WGS with MLVA is indeed notoriously due to failure to correctly assemble repetitive regions assessed by MLVA [5]. However, it is worth noting that an in silico PCR approach to type MLVA from WGS data was recently developed and evaluated for Brucella [6] (https://github.com/dpchris/MLVA) and Salmonella species (https://github.com/Papos92/MISTReSS).
When analyzing NGS data, the first step generally consists in assembling reads into longer contiguous sequences (contigs), which can then be interrogated using BLAST or other search algorithms. The production of high quality assemblies using bacterial genome assembler such as SPAdes [7] requires quality filtering and optimization of different parameters including k-mer size.
In the current paper, we describe a new tool (named MLVAtype) which enables users to extract MLVA profiles of Vibrio cholerae isolates from WGS data. We tuned the k-mer parameter used during genome assembly in order to assess its impact on the performance and limitations of MLVAtype. As a proof of concept, this new tool was applied on draft genomes of isolates associated with cholera outbreaks in two bordering countries, i.e. the Democratic Republic of the Congo (DRC) and Uganda. Results were compared to MLVA profiles generated by an in silico PCR approach and Sanger sequencing, the latter being used as the reference method.
Materials and methods
Sample description
Nine V. cholerae isolates were selected from a collection of isolates characterized in a recent study conducted between 2014 and 2017 in the DRC [8]. In addition, ten V. cholerae isolates collected between 2014 and 2016 in Uganda by G. Bwire and colleagues were selected based on their published data [9].
Sanger-derived versus GeneScan-derived MLVA typing
Sanger-derived MLVA typing was performed by sequencing amplicons on both strands on the ABI 3130 GA, using the BigDye Terminator v1.1 cycle sequencing kit (Applied Biosystems, USA). Motif repeats were counted manually and translated into MLVA profiles. For Ugandan isolates, the fluorescently labeled amplified products were separated using a 3730xl Automatic Sequencer with the size determined from internal lane standards (LIZ600) by the GeneScan program (Applied Biosystems, Foster City, CA).
When MLVA profiles were generated according to the method proposed by Kendall et al. [10], the formula had to be modified to better fit the sequence length of the motif and the position of the primers (Table 1). It is of note that, the original calculation formula was used for the VCA0283 locus but with a modified reverse primer (AGCCTCCTCAGAAGTTGAG instead of the original reverse primer [GTACATTCACAATTTGCTCACC]). It is worth nothing that using the original reverse primer would require to adapt the formula.
WGS-derived MLVA typing
WGS and short reads assembly
Whole genome assemblies of selected V. cholerae isolates, 9 from DRC and 10 from Uganda, were generated from paired-end 300 and 150 nt long reads, respectively. In brief, genomic DNA from DRC isolates was simultaneously fragmented and tagged with sequencing adapters in a single step using Nextera transposome (Nextera XT DNA Library Preparation Kit, Illumina, San Diego, CA, USA). Tagged DNA was then amplified with a 12-cycle polymerase chain reaction (PCR), cleaned up with AMPure beads, and subsequently loaded on a MiSeq paired-end 2 x 300 nt (MiSeq reagent kit V3 (600 cycles) sequence run. Raw genomic data were submitted to the European Nucleotide Archive (ENA, http://www.ebi.ac.uk/ena), and are available under study accession number ERP114722. For Ugandan V. cholerae isolates, data which were retrieved from the previous publication [7], were obtained as follows: libraries for Illumina sequencing were prepared from DNA fragmented with Covaris E210 (Covaris, Wolburn, MA) using the KAPA High Throughput Library Preparation Kit (Millipore-Sigma, St. Louis MO). The libraries were enriched and barcoded in ten cycles of PCR amplification with primers containing an index sequence. Subsequently, the libraries were sequenced using a 150 nt paired-end run on an Illumina HiSeq2500 (Illumina, San Diego, CA). Raw genomic data were submitted to Sequence Read Archive (SRA, https://www.ncbi.nlm.nih.gov/sra) under study accession number PRJNA439310.
WGS data were assembled into contigs using SPAdes v.3.13.0 [7] and a range of k-mer sizes of 55, 77, 99, 127, and 175-mers. Testing a k-mer value of 175, which has a longer size than what is proposed in the SPAdes v.3.13.0 software, required editing the software source code. It has to be kept in mind that using this longer k-mer size is only possible with reads of sufficient length. Accordingly, a k-mer size of 175 was only used with 300 nt reads from DRC isolates, but not with 150 nt reads from Ugandan isolates. Alternatively, WGS data were also assembled using SPAdes but without specifying the k-mer size. For each sample, k-mer size and locus, the number of tandem repeats was extracted from the assembled draft genome using the MLVAtype algorithm.
MLVAtype algorithm
The MLVAtype algorithm processes each locus separately. It requires several inputs including a draft genome, the size of the k-mer (i.e. k-mer parameter) used during genome assembly, and the nucleotide sequence of the motif. The algorithm returns the number of tandem repeats using the following steps: first, small contigs (< 1000 nt) are removed from the draft genome. Second, the vcountPattern function from the Biostring R package is used to count the number of occurrences that a single (j = 1) motif is detected within the draft genome. Then the same computation is iteratively performed with an increasing number (j = 2, 3 .., k) of tandem repeats. This iterative process is performed until there is only one occurrence of the k tandem repeats. Finally, the maximum value of j (i.e. k) is compared to the maximum number of tandem repeats (MNTR) that can be included in a specified k-mer (Fig 1 and Table 2). If k ≥ MNTR, the estimation of the number of tandem repeats is set to MNTR and considered as right-censored (i.e. ≥MNTR). If k < MNTR, the estimation of the number of tandem repeats is set to k. The same process is applied on each locus in order to extract the complete MLVA profile from the genome assembly.
MLVAtype shiny application
The MLVAtype algorithm was implemented in an R shiny application which is freely available at https://ucl-irec-ctma.shinyapps.io/NGS-MLVA-TYPING/. This application enables the user to upload a list of draft genomes, the nucleotide sequences of the motifs, and the value of the k-mer which was used to build the assembly, including a k-mer size selectable after modification of the SPAdes v.3.13.0 source code (Fig 2). The application provides a table with the number of tandem repeats that was found for each locus in the corresponding genomes.
In silico PCR MLVA typing
Additionally to MLVAtype and Sanger sequencing methods, an in silico PCR method was also assessed. The amplicon sizes were determined from the draft genomes using the vmatchPattern function of the Biostrings R package and subsequently used to derive the number of tandem repeats.
Results
GeneScan-derived and Sanger-derived MLVA typing
GeneScan- and Sanger-derived MLVA profiles from DRC and Uganda are reported in Table 3. Considering the high quality of the Sanger sequences, the number of tandem repeats extracted from these sequences were considered as a gold-standard in the current study. Only one mismatch was observed between GeneScan-derived and Sanger-derived MLVA typing.
WGS-derived MLVA typing
WGS-derived MLVA profiles obtained using the MLVAtype algorithm from draft genomes assembled using SPAdes and each value of the k-mer parameter are reported for DRC and Ugandan isolates (Table 4). All estimates of number of tandem repeats appeared to be perfectly concordant with Sanger-derived typing values. However, the k-mer parameter directly impacts the number of right-censored (i.e., ≥) estimations. When a k-mer of 127 was used to assemble reads from DRC and Ugandan isolates, only 5 and 9 right-censored estimations of tandem repeat numbers were produced, respectively. Interestingly, WGS-derived MLVA profiles extracted from 175-mers DRC assemblies were perfectly concordant with Sanger-derived typing results with no censored estimation (Fig 3).
Moreover, the last step of the MLVAtype algorithm (i.e., the comparison of the number of tandem repetitions [k] to the MNTR value) was essential. When this step was omitted, several discordances occurred between Sanger- and WGS-derived typing values, especially when using a small k-mer for read assembly (Table 5). When the k-mer size was not specified during genome assembly with SPAdes, resulting MLVA profiles were similar to those obtained with a k-mer of 127 for DRC isolates (300 nt long reads) and a k-mer of 77 for Ugandan isolates (150 nt long reads) (Table 5). When MLVA profiles were derived from draft genomes using the in silico PCR approach (Table 6), discordances were observed with Sanger-derived typing results. When using a small k-mer size during genome assembly, forward and reverse primer sequences were often located in different contigs, resulting in an undetermined (U) number of tandem repeats.
It is worth noting that a longer k-mer size also improved the quality of genome assemblies as illustrated by QUAST [11] with lower numbers of contigs and larger N50 values (Fig 4).
Comparison of analytical reagent costs
Reagents costs for MLVA typing (5 loci) of V. cholerae isolates were compared using three different methods (Table 7). The lowest cost was associated with the GeneScan-based method. It is worth nothing that Sanger sequencing, which cost is provided in Table 7, was only used here as a reference method but not intended for routine MLVA typing.
Discussion
The rationale behind this study is the dramatic increase in the rate and amount of sequencing and a continuous decrease in sequencing costs. The efficiency in microbial identification and subtyping allowed by WGS characterization makes it now a reference method with a clear potential to replace traditional typing methods. Anyhow, this type of analysis introduces new challenges, i.e. data storage, computing power, bioinformatics expertise and results returned in real-time, all potentially related to high costs. Undoubtedly, the WGS analysis is not yet affordable in all institutions or networks in charge of pathogen surveillance.
Accordingly, we present here a new application enabling users to extract V. cholerae MLVA profiles from WGS data while preserving their backward compatibility with conventional MLVA typing. To validate this application, MLVA profiles generated by MLVAType were compared to Sanger-derived MLVA profiles on nineteen V. cholerae isolates among which 9 from DRC and 10 from Uganda, and the respective costs were assessed. In addition, Sanger-derived MLVA profiles of the 9 isolates from Uganda were compared to GeneScan-derived MLVA profiles.
There was only one mismatch found between the GeneScan-derived and Sanger reference method which could not be explained but does not seem unusual [13]. However, it should be noted that a modification of either the primer or the formula proposed by Kendall et al. [10], which determines V. cholerae VNTR repeat numbers, was applied in order to decrease the number of mismatches (Table 1), especially those observed with VC0437 and VCA0283.
Interestingly, there was no mismatch between WGS- and Sanger-derived MLVA profiles. However, WGS-derived profiles were affected by censored estimations whose proportion varied according to the k-mer size used during genome assembly with SPAdes: the larger, the k-mer size, the better the accuracy of WGS-derived MLVA profiles (Fig 3). Accordingly, it is recommended to use the largest possible k-mer size to assemble the reads into contigs before determining the number of tandem repeats, but considering that this maximum value is inherent to the WGS read length, as illustrated with the current application, using WGS data from V. cholerae. While using a k-mer size of 175 was inapplicable with read length shorter than 175, as for Ugandan isolates, it did not produce censored data with 300 nt reads from DRC isolates.
While WGS read lengths and qualities increase, one may expect to increase k-mer sizes to perform in silico MLVA typing using this MLVAType application whenever data comparison with MLVA database is needed. As previously reported, the length of repeat motifs should not exceed 174 nucleotides for V. cholerae, corresponding to 29 repetitions of a 6 nt motif [14]. Accordingly, the longer k-mer size (i.e. 175) proved to generate a correct MLVA profile with no censored data.
Importantly, the MLVAType algorithm was developed to extract MLVA profiles of V. cholerae isolates which are characterized by (i) a perfect repeat array, (ii) locus-specific VNTRs (i.e. there is no repeat unit in other loci), and (iii) the absence of indels in the flanking region. Whereas the in silico PCR approach was found inefficient for MLVA typing of V. cholerae (Table 6), MLVAType could not be used for species such as Brucella or Salmonella. This makes MLVAType a complementary tool to the existing in silico PCR approach when the MLVA profiles need to be retrieved from WGS data.
Conclusion
In conclusion, the MLVAType shiny application proved to extract reliably MLVA profiles of V. cholerae isolates from WGS data. Considering the wide in silico exploitation of WGS data, our perspective will then be to combine the extracted information related both to VNTRs and Single Nucleotide Variants (SNVs), and to calculate a single genetic relatedness index. This should further extend our understanding of the genetic relatedness of V. cholerae isolates while giving us better insight into how the VNTRs evolve over time.
Zdroje
1. Pérez-Losada M, Cabezas P, Castro-Nallar E, Crandall KA. Pathogen typing in the genomics era: MLST and the future of molecular epidemiology. Infection, Genetics and Evolution. 2013;16:38–53. doi: 10.1016/j.meegid.2013.01.009 23357583
2. Inouye M, Dashnow H, Raven LA, Schultz MB, Pope BJ, Tomita T, et al. SRST2: rapid genomic surveillance for public health and hospital microbiology labs. Genome medicine. 2014;6(11):90. doi: 10.1186/s13073-014-0090-6 25422674
3. Deng X, Shariat N, Driebe EM, Roe CC, Tolar B, Trees E, et al. Comparative analysis of subtyping methods against a whole-genome-sequencing standard for Salmonella enterica serotype Enteritidis. Journal of clinical microbiology. 2015;53(1):212–218. doi: 10.1128/JCM.02332-14 25378576
4. Deng X, Den Bakker HC, Hendriksen RS. Applied Genomics of Foodborne Pathogens. Springer; 2017.
5. Nadon C, Van Walle I, Gerner-Smidt P, Campos J, Chinen I, Concepcion-Acevedo J, et al. PulseNet International: Vision for the implementation of whole genome sequencing (WGS) for global food-borne disease surveillance. Eurosurveillance. 2017;22(23). doi: 10.2807/1560-7917.ES.2017.22.23.30544 28662764
6. Vergnaud G, Hauck Y, Christiany D, Daoud B, Pourcel C, Jacques I, et al. Genotypic Expansion within the Population Structure of Classical Brucella Species Revealed by MLVA16 Typing of 1404 Brucella Isolates from Different Animal and Geographic Origins, 1974-2006. Frontiers in microbiology. 2018;9:1545. doi: 10.3389/fmicb.2018.01545 30050522
7. Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, et al. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. Journal of computational biology. 2012;19(5):455–477. doi: 10.1089/cmb.2012.0021 22506599
8. Irenge L, Ambroise J, Mitangala P, Bearzatto B, Senga R, Durant JF, et al. Genomic analysis of pathogenic strains of Vibrio cholerae from eastern Democratic Republic of Congo (2014-2017). PLOS Neglected Tropical Diseases. submitted in 2019;.
9. Bwire G, Sack DA, Almeida M, Li S, Voeglein JB, Debes AK, et al. Molecular characterization of Vibrio cholerae responsible for cholera epidemics in Uganda by PCR, MLVA and WGS. PLoS neglected tropical diseases. 2018;12(6):e0006492. doi: 10.1371/journal.pntd.0006492 29864113
10. Kendall EA, Chowdhury F, Begum Y, Khan AI, Li S, Thierer JH, et al. Relatedness of Vibrio cholerae O1/O139 isolates from patients and their household contacts, determined by multilocus variable-number tandem-repeat analysis. Journal of bacteriology. 2010;192(17):4367–4376. doi: 10.1128/JB.00698-10 20585059
11. Gurevich A, Saveliev V, Vyahhi N, Tesler G. QUAST: quality assessment tool for genome assemblies. Bioinformatics. 2013;29(8):1072–1075. doi: 10.1093/bioinformatics/btt086 23422339
12. Goldstein S, Beka L, Graf J, Klassen JL. Evaluation of strategies for the assembly of diverse bacterial genomes using MinION long-read sequencing. BMC genomics. 2019;20(1):23. doi: 10.1186/s12864-018-5381-7 30626323
13. Hyytia-Trees E, Lafon P, Vauterin P, Ribot EM. Multilaboratory validation study of standardized multiple-locus variable-number tandem repeat analysis protocol for Shiga toxin–producing Escherichia coli O157: a novel approach to normalize fragment size data between capillary electrophoresis platforms. Foodborne pathogens and disease. 2010;7(2):129–136. doi: 10.1089/fpd.2009.0371 19785535
14. Ghosh R, Nair GB, Tang L, Morris JG, Sharma NC, Ballal M, et al. Epidemiological study of Vibrio cholerae using variable number of tandem repeats. FEMS microbiology letters. 2008;288(2):196–201. doi: 10.1111/j.1574-6968.2008.01352.x 18811655
Článek vyšel v časopise
PLOS One
2019 Číslo 12
- Mikrobiom veganů, vegetariánů i všežravců pod drobnohledem − a co z toho plyne?
- Co se stane, když chemoterapii ladí umělá inteligence
- Tajemství taurinu, unikátní dýchání, implantát pro zpívání a prasátka s lidským srdcem – „jednohubky“ z výzkumu 2025/23
- Není statin jako statin aneb praktický přehled rozdílů jednotlivých molekul
- Kam posouvají medicínu chytrá nositelná zařízení?
Nejčtenější v tomto čísle
- Methylsulfonylmethane increases osteogenesis and regulates the mineralization of the matrix by transglutaminase 2 in SHED cells
- Oregano powder reduces Streptococcus and increases SCFA concentration in a mixed bacterial culture assay
- The characteristic of patulous eustachian tube patients diagnosed by the JOS diagnostic criteria
- Parametric CAD modeling for open source scientific hardware: Comparing OpenSCAD and FreeCAD Python scripts
Zvyšte si kvalifikaci online z pohodlí domova
Eozinofilní zánět a remodelace
nový kurzVšechny kurzy