#PAGE_PARAMS# #ADS_HEAD_SCRIPTS# #MICRODATA#

Comparison of an in-house ‘home-brew’ and commercial ViroSeq integrase genotyping assays on HIV-1 subtype C samples


Authors: Kaelo K. Seatla aff001;  Wonderful T. Choga aff003;  Mompati Mogwele aff001;  Thabo Diphoko aff001;  Dorcas Maruapula aff001;  Lucy Mupfumi aff001;  Rosemary M. Musonda aff001;  Christopher F. Rowley aff004;  Ava Avalos aff001;  Ishmael Kasvosve aff002;  Sikhulile Moyo aff001;  Simani Gaseitsiwe aff001
Authors place of work: Botswana Harvard AIDS Institute Partnership Gaborone, Botswana aff001;  Department of Medical Laboratory Sciences, School of Allied Health Professionals, University of Botswana, Gaborone, Botswana aff002;  Division of Human Genetics, Department of Pathology, Faculty of Health Sciences, University of Cape Town, Cape Town, South Africa aff003;  Department of Immunology & Infectious Diseases, Harvard T.H. Chan School of Public Health, Boston, Massachusetts, United States of America aff004;  Careena Centre for Health, Gaborone, Botswana aff005;  Ministry of Health and Wellness, Gaborone, Botswana aff006
Published in the journal: PLoS ONE 14(11)
Category: Research Article
doi: https://doi.org/10.1371/journal.pone.0224292

Summary

Background

Roll-out of Integrase Strand Transfer Inhibitors (INSTIs) such as dolutegravir for HIV combination antiretroviral therapy (cART) in sub-Saharan Africa necessitates the development of affordable HIV drug resistance (HIVDR) assays targeting the Integrase gene. We optimised and evaluated an in-house integrase HIV-1 drug resistance assay (IH-Int) and compared it to a commercially available assay, ViroSeq™ Integrase Genotyping kit (VS-Int) amongst HIV-1 clade C infected individuals.

Methods

We used 54 plasma samples from treatment naïve participants and one plasma sample from a patient failing INSTI based cART. Specimens were genotyped using both the VS-Int and IH-Int assays. Stanford HIV drug resistance database were used for integrase resistance interpretation. We compared the major and minor resistance mutations, pairwise nucleotide and amino-acid identity, costs and assay time.

Results

Among 55 specimens tested with IH-Int, 53 (96.4%) successfully amplified compared to 45/55 (81.8%) for the VS-Int assay. The mean nucleotide and amino acid similarity from 33 paired sequences was 99.8% (SD ± 0.30) and 99.8% (SD ± 0.39) for the IH-Int and VS-Int assay respectively. The reagent cost/sample were 32 USD and 147 USD for IH-Int and VS-Int assay, respectively. All sequenced samples were confirmed as HIV-1 subtype C.

Conclusions

The IH-Int assay had a high amplification success rate and high concordance with the commercial assay. It is significantly cheaper compared to the commercial assay. Our assay has the needed specifications for routine monitoring of participants on Dolutegravir based regimens in Botswana.

Keywords:

Viral load – HIV-1 – Reverse transcriptase-polymerase chain reaction – Antimicrobial resistance – Drug screening – Nucleotide sequencing – Genotyping

Introduction

The global number of people living with HIV (PLWH) has substantially increased over the past two decades; from 16.9 million by the end of 1994 to 36.9 million PLWH by the end of 2017 [1, 2]. Global access to combination antiretroviral therapy (cART) has also increased resulting in a pronounced decline in morbidity and mortality amongst PLWH compared to those who are not on cART [2–4]. This trend is being seen and replicated globally especially with the global scale-up of universal access to cART [2, 5].

Over 20 antiretrovirals drugs (ARVs) spanning 7 drug classes are available in the armament of anti-HIV medicines available to PLWH [6]. They are available either as single tablet or a combination of two or more ARVs in single tablet regimens (STR) [6].

Dolutegravir (DTG) is a newer, potent, second generation integrase strand transfer inhibitor (INSTI) that is available as a STR combination with tenofovir disoproxil fumarate (TDF) and lamivudine (3TC) [TLD] at an affordable cost to low and middle income countries (LMICs) such as Botswana [7–10]. A majority of countries in sub-Saharan Africa (SSA), a region that is highly burdened by the HIV epidemic will soon have access to TLD [8].

However, there is a rise in pre-treatment and acquired HIV drug resistance (HIVDR) mutations to ‘backbone’ ARVs such TDF, 3TC and non-nucleoside reverse transcriptase inhibitors (NNRTIs) and this is more pronounced in SSA [11, 12]. This could increase the possibility of placing patients on a ‘functional’ DTG monotherapy, which can contribute to development of resistance to DTG. A recent modelling study projects that the impact of HIVDR on AIDS deaths, new infections and ART costs will increase in SSA between year 2016–2030 if pre-treatment HIVDR rates are over 10% [13]. The scale-up of TLD will increase the demand for INSTI drug resistance testing. This will be pronounced amongst PLWH previously exposed to first generation INSTIs such as raltegravir (RAL) as is the case in Botswana and other SSA countries.

DTG has a better safety profile, higher genetic barrier to resistance and better clinical efficacy compared to other ARVs such as efavirenz [9, 10, 14, 15]. However, PLWH with prior exposure to RAL that developed a ‘Q148 mutant virus’ might have reduced susceptibility to DTG reducing its effectiveness [16, 17]. This has also been demonstrated in case reports from resource limited settings (RLS) in-which individuals with prior RAL exposure who were commenced on DTG combination antiretroviral therapy (cART) developed treatment failure with the selection of the Q148 resistance pathway [18, 19].

Resource rich settings recommend HIV genotypic drug resistance testing (GRT) of the reverse transcriptase (RT) and protease (PR) regions prior to ART initiation and at other time points to guide optimal ARV selections [20, 21]. Due to the low rates of INSTI transmitted drug resistance (TDR) mutations, GRT at the integrase region is not routinely recommended unless clinically indicated such as when patients are experiencing virological failure (VF) while on INSTI cART or if there is a high risk of INSTI TDR mutations [20]. In contrast, the World Health Organisation recommends a surveillance and monitoring approach to tackling HIV drug resistance [22]. INSTI TDR have been previously reported [23–25] as well as development of INSTI resistance associated mutations (RAMs) with subsequent virological failure amongst ARV treatment experienced individuals in RLS [18, 26].

There are limited options for GRT and most of these are traditionally prohibitively expensive and have been optimised for HIV-1 clade B strain which is not the predominant clade found in SSA. The ViroSeq™ HIV-1 Integrase RUO Genotyping kit (Celera Corporation, USA) (VS-Int) is a commercial assay that detects for HIVDR mutations in the integrase region of pol gene. Due to the high cost associated with HIVDR commercial assays, many laboratories have developed less expensive optimised in-house Sanger based [27] GRT assays (“home brews”) specific for their most common circulating HIV strains [28–31].

Botswana, with a predominantly HIV-1C epidemic, introduced DTG into its ART treatment programme in June 2016 and currently relies on commercial assays to test for INSTI HIVDR. Genotypic HIVDR testing typically costs between 140–380 USD/ test hindering their use in resource limited settings (RLS) such as in Botswana [32, 33,34].

Increased access to newer classes of ARVs like DTG in resource limited settings (RLS) where often access to HIVDR testing is limited raises the possibility of an increase in INSTI RAM rates. There is an urgent need for more frequent VL monitoring and cost effective in-house INSTI HIVDR testing to ensure effectiveness of DTG based ART.

We therefore sought to optimise and evaluate an in-house “home-brew” integrase drug resistance assay (IH-Int) against a commercial assay, VS-Int, for routine use in Botswana and other countries with a background of HIV-1C infection.

Materials and methods

Study population, specimen panel and preparations

A total of fifty-five (55) stored plasma samples were used in our assessment. We randomly selected fifty four (54) -80°C stored plasma samples from a previously completed study (BHP063) [35]. This study enrolled ART naïve HIV-1 recently infected individuals between January 2012 and December 2015 and it’s described elsewhere [35]. The median plasma HIV-1 RNA load (viral loads [VL]) was 4.3 [Q1, Q3 (3.7, 4.9)] log10 copies/mL quantified by Abbott m2000sp/Abbott m2000rt (Wiesbaden, Germany).

One (1) well characterized plasma sample collected in 2017 from a highly treatment experienced patient who was enrolled in the Botswana Epidemiological ART Treatment Cohort Study (BEAT) and described elsewhere was included in the analysis as it had many INSTI RAMs determined before by the VS-Int assay [18]; The VL was 2.7 log10 copies/ml quantified by Cobas TaqMan/Cobas Ampliprep 48 and 96 systems (Roche Diagnostics, Branchburg, USA).

The Abbott and Cobas TaqMan/Cobas Ampliprep assays for VL quantification and HIV drug resistance testing were all performed at the Botswana Harvard HIV Reference Laboratory (BHHRL) in Gaborone, Botswana. BHHRL is a SADCAS ISO 15189 accredited laboratory and maintains certification of the virology assays through Rush University’s virology quality assurance programme.

Ethical considerations

Ethical clearance for BHP063 and BEAT studies was obtained from the Human Resource Development Committee in Gaborone, Botswana; protocol # HRDC 0638 and HPDME-13/18/1 XI (150) respectively. In addition, BHP063 protocol was approved by the human subjects committee of Harvard T.H Chan School of Public Health (protocol # 20770).

RNA extractions, PCR amplifications and sequencing

VS-Int assay

Genotyping using the VS-Int commercial assay was performed as per the manufacturer’s instructions. Briefly, HIV-1 viral RNA was manually isolated from 500μL of participant’s plasma by cold pelleting under high-speed centrifugation followed by cell lysis, isopropranolol precipitation and cold ethanol-based re-suspension with elution of 30 μL of HIV RNA. A subsequent one step RT-PCR reaction was performed utilising 10μL of the re-suspended viral RNA. The VS-Int sample preparation and genotyping kits contained all the reagents needed for extraction, reverse transcription polymerase chain reaction (RT-PCR) and sequencing steps that utilise four sequencing primers.

IH-Int assay

Briefly, HIV-1 RNA was automatically extracted from 400μL of plasma by using EZ1 Virus Mini Kit v2.0 (Qiagen, Valencia, CA, USA) cartridges that were loaded on an automated EZ1 Advanced XL (Qiagen) machine. A one step RT-PCR reaction mix was prepared comprising; 0.5μL of Transcriptase Enzyme Roche One Step (Roche, Indianapolis, IN, USA), 7 μL of deionised water (dH20), 5 μL of Buffer 5X, 2.5 μL primer mix of 2 μM INFORI (5' GGA ATC ATT CAA GCA CAA CCA GA 3' nucleotide positions relative to HXB2 4059–4081) and INREV-1 (5’-TCT CCT GTA TGC AGA CCC CAA TAT-3’ 3' nucleotide positions relative to HXB2 5244–5267) and 10 μL of the extracted viral RNA template for one reaction mix volume totalling 25 μL.

RT-PCR thermal cycling conditions were; one cycle of 50°C for 30 mins, one cycle of 94 °C for 7 minutes, 10 cycles of 94 °C for 10 seconds, 52.5 °C for 30 seconds, 68 °C for 2 minutes, 35 cycles of 94 °C for 10 seconds, 53 °C for 30 seconds, 68 °C for 2 minutes that increased by 10 seconds with each additional cycle with a final extension step of 68 °C for 5 minutes and a hold at 4 °C. A PCR product of about 1300bp was generated that covered the complete HIV-1 integrase region of pol. For both assays, only one attempt to obtain PCR or sequencing result was used, no repeat testing of samples using both assays was allowed.

The primers and reaction mixes components were adapted and modified from experiments conducted on a population largely infected with a clade C virus [28]. The PCR thermal cycling conditions were adapted and modified from experiments described elsewhere [35, 36]. The RT-PCR products where run on 1% Agarose gel immersed in 1X TBE buffer stained with 3 μL of Ethidium bromide for about 30 mins at 100 volts to verify amplification and correct size of amplicons.

Sequencing

VS-Int assay

Four sequence mixes (forward primers A and B, reverse primers C and D) that came with the VS-Int genotyping kits were each combined with 8μL of the purified, diluted (where necessary) RT-PCR product. Cycle sequencing parameters (25 cycles) were 96 °C for 10 seconds, 50 °C for 5 seconds, 60 °C for 4 minutes and a hold at 4 °C.

Sanger sequencing for VS-Int and IH-Int was performed using an Applied Biosystems 3130xL Genetic Analyser (Applied Biosystems, California, CA, USA).

IH-Int

Column purification of amplicons was performed with QIAquick PCR purification kits (Qiagen, Hilden, Germany). BigDye terminator cycle sequencing ready reaction kit version 3.1 (Applied Biosystems, Carlsbad CA, USA) was used for Sanger sequencing utilising four primers; HIV+4141 (5' TCT ACC TGG CAT GGG TAC CA 3' nucleotide positions relative to HXB2 4141–4160), INFORI (5' GGA ATC ATT CAA GCA CAA CCA GA 3' nucleotide positions relative to HXB2 4059–4081), INREVII (5' CCT AGT GGG ATG TGT ACT TCT GA 3' nucleotide positions relative to HXB2 5197–5219 and IN4764AS (5' CCATTTGTACTGCTGTCTTAA 3’ nucleotide positions relative to HXB2 4764–4744).

The cycle sequencing reaction mix contained 3.8 μL of dH20, 3 μL of Big Dye 5X sequencing buffer, 1 μL Big Dye terminator, 0.2 μL of 10 μM of each sequencing primer and 2 μL of the purified DNA template to make a total reaction volume of 10 μL. Cycle sequencing parameters were the same as for those used for the VS-Int assay.

Purification of cycle sequencing products was done using ZR-96 DNA sequencing clean-up kit (Zymo research, Irvine, CA, USA) according to manufactures instructions.

Sequence, phylogenetic and mutational analysis

Electropherograms obtained were manually assembled and edited using Sequencher® version 5.0 DNA sequence analysis software (Gene Codes Corporation, Ann Arbor, MI, USA) [37] for both the IH-Int and VS-Int assays respectively. The assembly parameters used were a minimum match percentage of 85% and a minimum overlap of 20 base-pairs for sequences derived by both the IH-Int and VS-Int assays. The generated FASTA files were exported to BioEdit version 7.2.0 software for further analysis [38]. Multiple sequences were aligned using ClustalW Multiple alignment programme [39] embedded in BioEdit [38] using the HXB2 (accession number K03455.1) as reference. The 88 integrase sequences generated by the VS-Int and IH-Int methods were then compared for quality assurance and clustering using molecular phylogenetic analysis by maximum likelihood method in MEGA 7 software [40]. A Phylogenetic tree was constructed using Tamura-Nei substitution model with gamma distribution rates among sites and inferred from 1000 bootstrap replicates [41].

Mutational analysis of sequences was performed using the Stanford HIV drug resistance database algorithm version 8.7 (https://hivdb.stanford.edu/hivdb/by-sequences/) [42]. HIV-1 subtype was determined using REGA HIV-1 subtyping tool version 3.0 (http://dbpartners.stanford.edu:8080/RegaSubtyping/stanford-hiv/typingtool/) [43].

Accession numbers

The 33 pairs of nucleotide sequences obtained in our study were submitted to national center for biotechnology information (NCBI) GenBank and their accession numbers are MN037428 to MN037493. Additional nucleotide sequences from our study are available in Genbank under accession numbers MN462669 to MN462690.

Cost comparison

We calculated the reagents costs by analysing a batch of 12 samples used for the IH-Int and VS-Int assay. Estimated costs involved in the IH-Int and VS-Int assay included all stages from extraction, RT-PCR and sequencing.

Statistical analysis

Statistical analysis was performed using STATA version 14 (Stata Corp, College Station, TX, USA. Major and minor HIVDR mutations obtained from both assays were compared as obtained from the Stanford HIV drug resistance database.

Results

Comparison of PCR and sequencing success rates between the VS-Int and IH-Int assay

From the 55 samples, 44 (80%) and 11 (20%) were from female and male participants respectively. Other baseline characteristics are shown in Table 1. 45 (81.8%) of the samples amplified with the VS-Int assay and 53 (96.4%) amplified with the IH-Int assay, Table 2. Of the 10/55 (18.2%) samples that failed amplification with the VS-Int assay, 9/10 (90%) were able to be amplified by the IH-Int assay, Table 3.

Tab. 1. Baseline demographics and viral load characteristics of 55 HIV-1C infected individuals.
Baseline demographics and viral load characteristics of 55 HIV-1C infected individuals.
Tab. 2. RT-PCR amplification and sequencing success rates of IH-Int and VS-Int assays with further stratification according to viral loads.
RT-PCR amplification and sequencing success rates of IH-Int and VS-Int assays with further stratification according to viral loads.
Tab. 3. Samples that failed amplification with each assay, VS-Int (table A) and IH-Int (table B) and how they faired when run with a different assay, IH-Int (table A) and VS-Int (table B) and associated viral loads.
Samples that failed amplification with each assay, VS-Int (table A) and IH-Int (table B) and how they faired when run with a different assay, IH-Int (table A) and VS-Int (table B) and associated viral loads.

The VS-Int and IH-Int were both a one-step RT-PCR and utilised 4 sequencing primers that covered all of integrase region. Both assays had a similar hands-on and protocol required times, (Fig 1). The VS-Int and IH-Int assays had a sequencing success rate of 38/45 (84.4%) and 50/53 (94.3%), respectively, (Fig 2).

Fig. 1. HIV drug resistance testing workflow using an IH-Int and VS-Int assay (panel B).
HIV drug resistance testing workflow using an IH-Int and VS-Int assay (panel B).
*estimated hands-on time, ** fixed machinery times, #Thermocycler times, + using Zymogen purification kit;*** on 8 capillary ABI PRISM 3130 xl Genetic Analyser for 12 samples, ±ViroSeq HIV-1 Integrase Sample Prep Kit 4J94-72, ‡ purification (Exonuclease 1). RT-PCR, reverse transcriptase-polymerase chain reaction; IH-Int, in-house “home-brew” integrase drug resistance assay; VS-Int, ViroSeq™ HIV-1 Integrase sample preparation and Genotyping kit (Celera Corporation, USA).
Fig. 2. Differences between amplification and sequencing success rates and cost per test run of two assays.
Differences between amplification and sequencing success rates and cost per test run of two assays.
Viral loads for samples successfully amplified by IH-Int, mean (Q1, Q3); 4.4 (3.7, 4.8), 2.2 copies/ml. Viral loads for samples successfully amplified by VS-Int, mean (Q1,Q3),minimum; 4.4 (3.9, 4.8), 2.6 copies/ml. *S.D = ± 0.30; **S.D = ± 0.39. IH-Int, in-house integrase drug resistance assay; VS-Int, ViroSeq™ HIV-1 Integrase sample preparation and Genotyping kit (Celera Corporation, USA).

Further analysis of both assays on samples with VL greater than 1,000 copies/ml revealed an amplification success rate of 41/48 (85.4%) for the VS-Int and 48/48 (100%) for the IH-Int assay, Table 2. A total of three INSTI mutations were identified by the IH-Int assay and two INSTI mutations were identified by the VS-Int assay, Table 4.

Tab. 4. Comparison of HIV-1 Integrase drug resistance mutations from three patients detected by sanger sequencing using the IH-Int and VS-Int assay and associated viral loads.
Comparison of HIV-1 Integrase drug resistance mutations from three patients detected by sanger sequencing using the IH-Int and VS-Int assay and associated viral loads.

From the 50 sequences obtained by the IH-Int assay and 38 sequences obtained by the VS-Int assay, 33 paired sequences were identified. The low number of paired sequences was due to failures in amplification and sequencing by the VS-Int assay. A total of 33 paired sequences revealed a mean amino acid and nucleotide similarity of 99.8% (SD = 0.39) and 99.8% (SD = 0.30) amongst the two assays. All sequenced samples were shown to be of a clade C virus by REGA HIV-1 and 2 subtyping tool [43].

The cost of IH-Int were estimated at 32 USD per sample and the VS-Int estimated at 147 USD to run one sample (reagent costs only) and both have similar run times Table 5, Figs 1–3.

Tab. 5. Comparison between IH-Int assay and commercial VS-Int resistance assays.
Comparison between IH-Int assay and commercial VS-Int resistance assays.
Fig. 3. Molecular phylogenetic analysis by maximum likelihood method of 88 integrase sequences derived by the ViroSeq™ HIV-1 integrase RUO genotyping kit (VS-Int) and in-house “home-brew” integrase drug resistance assay (IH-Int).
Molecular phylogenetic analysis by maximum likelihood method of 88 integrase sequences derived by the ViroSeq<sup>™</sup> HIV-1 integrase RUO genotyping kit (VS-Int) and in-house “home-brew” integrase drug resistance assay (IH-Int).
The numbers next to the nodes represent Bootstrap values (1000 replicates) >90.

Discussion

Scale-up of dolutegravir based regimens (DBR) in resource limited settings where HIV-1 clade C is prevalent warrants an urgent need for affordable genotyping HIVDR testing technologies for monitoring INSTI RAMs for patient care and drug resistance surveillance [8, 44]. In this study, we optimised an in-house HIV integrase drug resistance assay and compared it against a commercial ViroSeq™ HIV-1 Integrase sample preparation and genotyping assay for routine monitoring of drug resistance in Botswana.

Our in-house integrase drug resistance assay was able to amplify 100% (n = 48) of patient plasma samples with viral loads greater than 1,000 copies/ml compared to 85.4% (n = 48) amplification success rate with the ViroSeq™ HIV-1 Integrase sample preparation and genotyping assay. Similar VS-Int amplification success rates have also been reported by others [15, 30].

In addition, our IH-Int assay was able to amplify 9/10 (90%) of samples that failed amplification with the ViroSeq™ HIV-1 integrase genotyping assay. The IH-Int assay was able to perform this at approximately a quarter of the cost of the commercial assay.

The higher success rate of the IH-Int could be due to the IH-Int assay having primers that are specific for HIV-1C, while the VS-Int assay primers were designed to cover various HIV-1 subtypes. There is limited published data on the performance of the ViroSeq™ HIV-1 Integrase sample preparation and genotyping assay in HIV-1 non subtype B strains.

Previous studies have shown that the ViroSeq™ Protease-RT assay is less successful with non B HIV-1 subtypes [45, 46]. It is most likely that the VS-Int assay has the same limitations as the ViroSeq™ Protease-RT assay.

At 99.8% and 99.8% nucleotide and amino acid identity respectively between the IH-Int and the VS-Int assays, this demonstrates that the sequences generated by the two assays are similar. The results of the sequences of the patient with multiple INSTI resistance mutations attest to this good concordance with all the INSTI resistance mutations identified by the VS-Int assay being identified with the IH-Int assay.

The profound cost differences associated with our IH-Int assay in the era of DBR scale-up are encouraging. This high level of RT-PCR success rates and cost savings is similar to what has been traditionally observed with other in-house HIV drug resistance assays [30, 31, 47, 48].

We did not evaluate our assay amongst non-clade C panel of HIV viruses, as most countries in sub-Saharan Africa have a predominantly clade-C epidemic which may makes our assay applicable to these settings. Our sample size and volumes did not permit an evaluation of reproducibility and specificity hence they were not assessed but are in the future directions. A better in-house HIVDR assay for patient care would be one that quantifies viral loads, measures ARV drug levels and detects for drug resistance mutations in the integrase, reverse transcriptase and protease region of HIV-1 pol gene in one step which could ideally be packaged into a point of care test.

In conclusion, our in-house assay had a high amplification success rate and high concordance with the commercial assay and it is significantly less expensive than the commercial assay.

Our In-house integrase assay has the required specifications to be used in HIV-1 clade C infected individuals for routine monitoring of integrase RAMs in Botswana.


Zdroje

1. Burton AH, Mertens TE. Provisional country estimates of prevalent adult human immunodeficiency virus infections as of end 1994: a description of the methods. International journal of epidemiology. 1998;27(1):101–7. Epub 1998/05/01. doi: 10.1093/ije/27.1.101 9563702.

2. UNAIDS. Fact sheet—Latest global and regional statistics on the status of the AIDS epidemic. 18 JULY 2018 [9 November 2018]. http://www.unaids.org/sites/default/files/media_asset/UNAIDS_FactSheet_en.pdf.

3. Collaborators GH. Estimates of global, regional, and national incidence, prevalence, and mortality of HIV, 1980–2015: the Global Burden of Disease Study 2015. The lancet HIV. 2016;3(8):e361–e87. Epub 2016/07/30. doi: 10.1016/S2352-3018(16)30087-X 27470028.

4. Palella FJ Jr., Delaney KM, Moorman AC, Loveless MO, Fuhrer J, Satten GA, et al. Declining morbidity and mortality among patients with advanced human immunodeficiency virus infection. HIV Outpatient Study Investigators. The New England journal of medicine. 1998;338(13):853–60. Epub 1998/03/27. doi: 10.1056/NEJM199803263381301 9516219.

5. Farahani M, Price N, El-Halabi S, Mlaudzi N, Keapoletswe K, Lebelonyane R, et al. Trends and determinants of survival for over 200 000 patients on antiretroviral treatment in the Botswana National Program: 2002–2013. Aids. 2016;30(3):477–85. Epub 2015/12/05. doi: 10.1097/QAD.0000000000000921 26636931.

6. AIDSinfo. U.S. Department of Health and Human Services, FDA-Approved HIV Medicines [May 21, 2019]. https://aidsinfo.nih.gov/understanding-hiv-aids/fact-sheets/21/58/fda-approved-hiv-medicines.

7. UNAIDS C, the Bill & Melinda Gates Foundation, Unitaid, DFID, PEPFAR, USAID, the Global Fund to Fight AIDS, Tuberculosis and, Malaria MLLaAP. New high-quality antiretroviral therapy to be launched in South Africa, Kenya and over 90 low -⁠ and middle-income countries at reduced price 2017 [May 21, 2019]. https://www.unaids.org/en/resources/presscentre/pressreleaseandstatementarchive/2017/september/20170921_TLD.

8. WHO. Dolutegravir (DTG) and the fixed dose combination (FDC) of tenofovir/lamivudine/dolutegravir (TLD) 2018 [4 November 2018]. http://www.who.int/hiv/pub/arv/DTG-TLD-arv_briefing_2018.pdf.

9. Cahn P, Pozniak AL, Mingrone H, Shuldyakov A, Brites C, Andrade-Villanueva JF, et al. Dolutegravir versus raltegravir in antiretroviral-experienced, integrase-inhibitor-naive adults with HIV: week 48 results from the randomised, double-blind, non-inferiority SAILING study. Lancet (London, England). 2013;382(9893):700–8. Epub 2013/07/09. doi: 10.1016/S0140-6736(13)61221-0 23830355.

10. Raffi F, Rachlis A, Stellbrink HJ, Hardy WD, Torti C, Orkin C, et al. Once-daily dolutegravir versus raltegravir in antiretroviral-naive adults with HIV-1 infection: 48 week results from the randomised, double-blind, non-inferiority SPRING-2 study. Lancet (London, England). 2013;381(9868):735–43. Epub 2013/01/12. doi: 10.1016/S0140-6736(12)61853-4 23306000.

11. Gupta RK, Gregson J, Parkin N, Haile-Selassie H, Tanuri A, Andrade Forero L, et al. HIV-1 drug resistance before initiation or re-initiation of first-line antiretroviral therapy in low-income and middle-income countries: a systematic review and meta-regression analysis. The Lancet Infectious Diseases. 2018;18(3):346–55. doi: 10.1016/S1473-3099(17)30702-8 29198909

12. TenoRes Study G. Global epidemiology of drug resistance after failure of WHO recommended first-line regimens for adult HIV-1 infection: a multicentre retrospective cohort study. Lancet Infect Dis. 2016;16(5):565–75. Epub 2016/02/03. doi: 10.1016/S1473-3099(15)00536-8 26831472.

13. Phillips AN, Stover J, Cambiano V, Nakagawa F, Jordan MR, Pillay D, et al. Impact of HIV Drug Resistance on HIV/AIDS-Associated Mortality, New Infections, and Antiretroviral Therapy Program Costs in Sub-Saharan Africa. The Journal of infectious diseases. 2017;215(9):1362–5. Epub 2017/02/17. doi: 10.1093/infdis/jix089 28329236.

14. Meireles MV, Pascom ARP, Duarte EC, McFarland W. Comparative effectiveness of first-line antiretroviral therapy: results from a large real-world cohort after the implementation of Dolutegravir. Aids. 2019. Epub 2019/05/15. doi: 10.1097/qad.0000000000002254 31082860.

15. Walmsley S, Baumgarten A, Berenguer J, Felizarta F, Florence E, Khuong-Josses MA, et al. Brief Report: Dolutegravir Plus Abacavir/Lamivudine for the Treatment of HIV-1 Infection in Antiretroviral Therapy-Naive Patients: Week 96 and Week 144 Results From the SINGLE Randomized Clinical Trial. J Acquir Immune Defic Syndr. 2015;70(5):515–9. Epub 2015/08/12. doi: 10.1097/QAI.0000000000000790 26262777.

16. Underwood MR, Johns BA, Sato A, Martin JN, Deeks SG, Fujiwara T. The activity of the integrase inhibitor dolutegravir against HIV-1 variants isolated from raltegravir-treated adults. Journal of acquired immune deficiency syndromes (1999). 2012;61(3):297–301. doi: 10.1097/QAI.0b013e31826bfd02 22878423.

17. Garrido C, Soriano V, Geretti AM, Zahonero N, Garcia S, Booth C, et al. Resistance associated mutations to dolutegravir (S/GSK1349572) in HIV-infected patients—impact of HIV subtypes and prior raltegravir experience. Antiviral research. 2011;90(3):164–7. Epub 2011/03/29. doi: 10.1016/j.antiviral.2011.03.178 21439330.

18. Seatla KK, Avalos A, Moyo S, Mine M, Diphoko T, Mosepele M, et al. Four-class drug-resistant HIV-1 subtype C in a treatment experienced individual on dolutegravir-based antiretroviral therapy in Botswana. Aids. 2018;32(13):1899–902. Epub 2018/06/13. doi: 10.1097/QAD.0000000000001920 29894383.

19. Achieng L, Riedel DJ. Dolutegravir Resistance and Failure in a Kenyan Patient. The Journal of infectious diseases. 2019;219(1):165–7. Epub 2018/08/31. doi: 10.1093/infdis/jiy436 30165703.

20. DHHS. Panel on Antiretroviral Guidelines for Adults and Adolescents. Guidelines for the Use of Antiretroviral Agents in Adults and Adolescents Living with HIV. Department of Health and Human Services. [5th November 2018]. http://www.aidsinfo.nih.gov/ContentFiles/AdultandAdolescentGL.pdf.

21. EACS. European AIDS Clinical Society (EACS) Guidelines version 9.1 October 2018,English [5 November 2018]. http://www.eacsociety.org/files/2018_guidelines-9.1-english.pdf.

22. WHO. Global action plan on HIV drug resistance 2017–2021. Geneva: World Health Organization; 2017.Licence: CC BY-NC-SA 3.0 IGO 2017 [May 21, 2019]. https://www.who.int/hiv/pub/drugresistance/hivdr-action-plan-2017-2021/en/.

23. Cochrane S, Daniel J, Forsyth S, Smit E. First reported case of integrase (R263K, G163R) and reverse transcriptase (M184V)-transmitted drug resistance from a drug-naive patient failing Triumeq. Aids. 2018;32(13):1905–7. Epub 2018/07/26. doi: 10.1097/QAD.0000000000001919 30045059.

24. Boyd SD, Maldarelli F, Sereti I, Ouedraogo GL, Rehm CA, Boltz V, et al. Transmitted raltegravir resistance in an HIV-1 CRF_AG-infected patient. Antiviral therapy. 2011;16(2):257–61. Epub 2011/03/31. doi: 10.3851/IMP1749 21447876.

25. Young B, Fransen S, Greenberg KS, Thomas A, Martens S, St Clair M, et al. Transmission of integrase strand-transfer inhibitor multidrug-resistant HIV-1: case report and response to raltegravir-containing antiretroviral therapy. Antiviral therapy. 2011;16(2):253–6. Epub 2011/03/31. doi: 10.3851/IMP1748 21447875.

26. Achieng L, Riedel DJ. Dolutegravir Resistance and Failure in a Kenyan Patient. The Journal of infectious diseases. 2018. Epub 2018/08/31. doi: 10.1093/infdis/jiy436 30165703.

27. Sanger F, Nicklen S, Coulson AR. DNA sequencing with chain-terminating inhibitors. Proceedings of the National Academy of Sciences of the United States of America. 1977;74(12):5463–7. doi: 10.1073/pnas.74.12.5463 271968.

28. Bessong PO, Nwobegahay J. Genetic Analysis of HIV-1 Integrase Sequences from Treatment Naive Individuals in Northeastern South Africa. Int J Mol Sci. 2013;14(3):5013–24. Epub 2013/03/05. doi: 10.3390/ijms14035013 23455469.

29. Hearps AC, Greengrass V, Hoy J, Crowe SM. An HIV-1 integrase genotype assay for the detection of drug resistance mutations. Sexual health. 2009;6(4):305–9. Epub 2009/11/18. doi: 10.1071/SH09041 19917199.

30. To SW, Chen JH, Wong KH, Chan KC, Ng HM, Wu H, et al. Performance comparison of an in-house integrase genotyping assay versus the ViroSeq Integra48, and study of HIV-1 integrase polymorphisms in Hong Kong. Journal of clinical virology: the official publication of the Pan American Society for Clinical Virology. 2013;58(1):299–302. Epub 2013/07/28. doi: 10.1016/j.jcv.2013.06.040 23886504.

31. Van Laethem K, Schrooten Y, Covens K, Dekeersmaeker N, De Munter P, Van Wijngaerden E, et al. A genotypic assay for the amplification and sequencing of integrase from diverse HIV-1 group M subtypes. Journal of virological methods. 2008;153(2):176–81. Epub 2008/08/19. doi: 10.1016/j.jviromet.2008.07.008 18706932.

32. CMS. Center for Medicare and Medicaid Services, Clinical Laboratory Fee Schedule, Code 87906 (Genotype dna/rna hiv) and Code 87901 (Genotype dna hiv reverse t) 2019 [May 21, 2019]. https://www.cms.gov/apps/ama/license.asp?file=/Medicare/Medicare-Fee-for-Service-Payment/ClinicalLabFeeSched/Downloads/19CLABQ1.zip.

33. Inzaule SC, Hamers RL, Paredes R, Yang C, Schuurman R, Rinke de Wit TF. The Evolving Landscape of HIV Drug Resistance Diagnostics for Expanding Testing in Resource-Limited Settings. AIDS reviews. 2017;19(4):219–30. Epub 2017/02/10. 28182618.

34. Inzaule S, Yang C, Kasembeli A, Nafisa L, Okonji J, Oyaro B, et al. Field evaluation of a broadly sensitive HIV-1 in-house genotyping assay for use with both plasma and dried blood spot specimens in a resource-limited country. Journal of clinical microbiology. 2013;51(2):529–39. Epub 2012/12/12. doi: 10.1128/JCM.02347-12 23224100.

35. Rowley CF, MacLeod IJ, Maruapula D, Lekoko B, Gaseitsiwe S, Mine M, et al. Sharp increase in rates of HIV transmitted drug resistance at antenatal clinics in Botswana demonstrates the need for routine surveillance. The Journal of antimicrobial chemotherapy. 2016;71(5):1361–6. Epub 2016/03/02. doi: 10.1093/jac/dkv500 26929269.

36. Wallis CL, Papathanasopoulos MA, Lakhi S, Karita E, Kamali A, Kaleebu P, et al. Affordable in-house antiretroviral drug resistance assay with good performance in non-subtype B HIV-1. J Virol Methods. 2010;163(2):505–8. Epub 2009/11/18. doi: 10.1016/j.jviromet.2009.11.011 19917318.

37. Codes G. Sequencher® version 5.4.6 DNA sequence analysis software, Gene Codes Corporation, Ann Arbor, MI USA [May 21, 2019]. http://www.genecodes.com/.

38. Hall TA, editor BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic acids symposium series; 1999: [London]: Information Retrieval Ltd., c1979-c2000.

39. Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic acids research. 1994;22(22):4673–80. Epub 1994/11/11. doi: 10.1093/nar/22.22.4673 7984417.

40. Kumar S, Stecher G, Tamura K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Molecular biology and evolution. 2016;33(7):1870–4. Epub 2016/03/24. doi: 10.1093/molbev/msw054 27004904.

41. Tamura K, Nei M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular biology and evolution. 1993;10(3):512–26. doi: 10.1093/oxfordjournals.molbev.a040023 8336541

42. Liu TF, Shafer RW(2006). Web Resources for HIV type 1 Genotypic-Resistance Test Interpretation. Clin Infect Dis 42(11):1608–18. Epub 2006 Apr 28 doi: 10.1086/503914 16652319

43. Pineda-Pena AC, Faria NR, Imbrechts S, Libin P, Abecasis AB, Deforche K, et al. Automated subtyping of HIV-1 genetic sequences for clinical and surveillance purposes: performance evaluation of the new REGA version 3 and seven other tools. Infection, genetics and evolution: journal of molecular epidemiology and evolutionary genetics in infectious diseases. 2013;19 : 337–48. Epub 2013/05/11. doi: 10.1016/j.meegid.2013.04.032 23660484.

44. MoHW. HANDBOOK OF THE BOTSWANA 2016 INTEGRATED HIV CLINICAL CARE GUIDELINES [May 22, 2019]. https://www.moh.gov.bw/guidelines.html.

45. Beddows S, Galpin S, Kazmi SH, Ashraf A, Johargy A, Frater AJ, et al. Performance of two commercially available sequence-based HIV-1 genotyping systems for the detection of drug resistance against HIV type 1 group M subtypes. Journal of medical virology. 2003;70(3):337–42. Epub 2003/05/27. doi: 10.1002/jmv.10401 12766994.

46. Aghokeng AF, Mpoudi-Ngole E, Chia JE, Edoul EM, Delaporte E, Peeters M. High failure rate of the ViroSeq HIV-1 genotyping system for drug resistance testing in Cameroon, a country with broad HIV-1 genetic diversity. Journal of clinical microbiology. 2011;49(4):1635–41. Epub 2011/01/29. doi: 10.1128/JCM.01478-10 21270223.

47. Zhou Z, Wagar N, DeVos JR, Rottinghaus E, Diallo K, Nguyen DB, et al. Optimization of a low cost and broadly sensitive genotyping assay for HIV-1 drug resistance surveillance and monitoring in resource-limited settings. PLoS One. 2011;6(11):e28184. Epub 2011/12/02. doi: 10.1371/journal.pone.0028184 22132237.

48. Ammaranond P, Sanguansittianant S, Raju PA, Cunningham P, Horthongkham N. Development of a cost-effective assay for genotyping of HIV-1 non-B subtype for drug resistance. Journal of virological methods. 2014;199 : 102–7. Epub 2014/01/28. doi: 10.1016/j.jviromet.2014.01.007 24462843.


Článek vyšel v časopise

PLOS One


2019 Číslo 11
Nejčtenější tento týden
Nejčtenější v tomto čísle
Kurzy

Zvyšte si kvalifikaci online z pohodlí domova

Mazová zátka a její řešení
nový kurz

Citikolin v neuroprotekci a neuroregeneraci – nové poznatky
Autoři: MUDr. Petr Výborný, CSc., FEBO

Revma Focus: Spondyloartritidy

Denzitometrie v praxi: od kvalitního snímku po správnou interpretaci
Autoři: prof. MUDr. Vladimír Palička, CSc., Dr.h.c., doc. MUDr. Václav Vyskočil, Ph.D., MUDr. Petr Kasalický, CSc., MUDr. Jan Rosa, Ing. Pavel Havlík, Ing. Jan Adam, Hana Hejnová, DiS., Jana Křenková

Čelistně-ortodontické kazuistiky od A do Z
Autoři: MDDr. Eleonóra Ivančová, PhD., MHA

Všechny kurzy
Přihlášení
Zapomenuté heslo

Zadejte e-mailovou adresu, se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.

Přihlášení

Nemáte účet?  Registrujte se

#ADS_BOTTOM_SCRIPTS#