#PAGE_PARAMS# #ADS_HEAD_SCRIPTS# #MICRODATA#

UM171 induces a homeostatic inflammatory-detoxification response supporting human HSC self-renewal


Authors: Jalila Chagraoui aff001;  Bernhard Lehnertz aff001;  Simon Girard aff001;  Jean Francois Spinella aff001;  Iman Fares aff002;  Elisa Tomellini aff001;  Nadine Mayotte aff001;  Sophie Corneau aff001;  Tara MacRae aff001;  Laura Simon aff001;  Guy Sauvageau aff001
Authors place of work: Molecular Genetics of Stem Cells Laboratory, Institute for Research in Immunology and Cancer (IRIC), University of Montreal, Montreal, QC, Canada aff001;  Department of Molecular, Cell and Developmental Biology, UCLA, LA, United States of America aff002;  Division of Hematology, Maisonneuve-Rosemont Hospital, Montreal, QC, Canada aff003;  Department of Medicine, Faculty of Medicine, University de Montreal, Montreal, QC, Canada aff004
Published in the journal: PLoS ONE 14(11)
Category: Research Article
doi: https://doi.org/10.1371/journal.pone.0224900

Summary

Elucidation of the molecular cues required to balance adult stem cell self-renewal and differentiation is critical for advancing cellular therapies. Herein, we report that the hematopoietic stem cell (HSC) self-renewal agonist UM171 triggers a balanced pro -⁠ and anti-inflammatory/detoxification network that relies on NFKB activation and protein C receptor-dependent ROS detoxification, respectively. We demonstrate that within this network, EPCR serves as a critical protective component as its deletion hypersensitizes primitive hematopoietic cells to pro-inflammatory signals and ROS accumulation resulting in compromised stem cell function. Conversely, abrogation of the pro-inflammatory activity of UM171 through treatment with dexamethasone, cAMP elevating agents or NFkB inhibitors abolishes EPCR upregulation and HSC expansion. Together, these results show that UM171 stimulates ex vivo HSC expansion by establishing a critical balance between key pro -⁠ and anti-inflammatory mediators of self-renewal.

Keywords:

Gene expression – Cytokines – inflammation – Blood cells – Flow cytometry – Nitric oxide – Hematopoietic stem cells – Detoxification

Introduction

Inflammation is a well recognized mediator of hematopoietic stem and progenitor cell (HSPC) activity. Examples include Toll-Like Receptors (TLR), Tumor Necrosis Factor alpha (TNFa, prostaglandins, IL6, interferons, GM-CSF and eicosanoids [1, 2]. Most of these inflammation mediators promote the activation of NFkB and subsequent transcriptional induction of pro-inflammatory genes [3, 4]. Depending on the context, inflammation can either promote HSC expansion or differentiation [518]. Defining the proper settings in which inflammation mediates HSC self-renewal remains a challenging question.

In previous studies, we showed that the small molecule UM171 promotes the ex vivo expansion of HSCs with long-term multi-lineage reconstitution potential [19] and identified Endothelial Protein C Receptor (EPCR), a previously suggested NFkB inhibitor [2022], as a reliable marker of expanded HSCs [23]. Interestingly, Cohen et al., have demonstrated that EPCR/PAR1 signaling promotes mouse bone marrow retention, survival and stress resistance by limiting inflammation associated nitric oxide production [24]. Here, we show that UM171 induces a strong NFkB-dependent pro-inflammatory signalling together with an EPCR mediated anti-inflammatory response leading to HSC self-renewal. The essential coordination by UM171 of these 2 distinct and necessary networks in primitive HSPC is described.

Results

UM171 triggers a specific inflammatory response in HSPC

In preliminary experiments using hematopoietic cell lines, we found that UM171 triggers simultaneous activation of pro-inflammatory (including IKK/NFkB) and anti-inflammatory (including detoxification responses) programs (Fig 1A–1C and S1 Fig). These programs are activated as early as 6 hours post-treatment, with the most significant changes reached at 48-72h.

Fig. 1. UM171 exposure induces inflammatory gene signature.
UM171 exposure induces inflammatory gene signature.

To characterize these signals more precisely within the hematopoietic hierarchy, we deployed a single-cell sequencing strategy (outlined in S2A Fig) which allowed us to map key subpopulation markers (S2B Fig) and used a “stem cell score” (see materials and methods and S2C Fig) to accurately define the response of primitive and committed cells to different concentrations of UM171 (Fig 1D). We next performed integrated gene expression analysis of primitive and committed cell subsets subjected to both low and high UM171 concentrations. As proof of principle, we observed that upregulation of HSC specific genes, most notably PROCR or JAML [23] was highest in the primitive compartment and followed a dose dependency to UM171 (Fig 1E). In addition, we noticed a marked increase in genes encoding MHC-associated proteins, most notably HLA-A and B, as well as beta 2-microglobulin (B2M) in all conditions compared to DMSO in all conditions compared to DMSO (S2D Fig). Since HLA upregulation is a hallmark response to pro-inflammatory signals, this suggested that UM171 induces an inflammatory stimulus in CB cells across several cell-types. Supporting this hypothesis, gene set enrichment analysis revealed pathways related to MHC protein complex binding, inflammation and NFkB signaling as dominant features of UM171 treatment (Fig 1F, S2E Fig and S1 Table).

Subpopulation analyses (primitive versus committed) showed common (e.g. HLA) and selective inflammatory responses. As shown in Fig 1G, inflammation genes such as BST2 and TNFSF10 appeared to be more induced in committed subpopulations upon UM171 exposure. In contrast, several members of the TNF/NFkB/cAMP signaling network were mostly induced by UM171 in the primitive subpopulation: These genes, known to be involved in fine-tuning the inflammatory response, included BIRC2-3, DUSP4, PDE4B, TIPARP (Fig 1H and S1 Table).

We previously reported the optimal UM171 dose-response for HSC expansion at around 35nM [19, 23]. Higher levels eventually lead to reduced cell proliferation and to elevated inflammation which is accompanied by a preferential reduction in cell proliferation in the primitive subset (see MKI67, GO cell cycle and CFSE labeling in S3A and S3B Fig). These “inflammation high / proliferation low” primitive cells failed to expand ex vivo (S3C and S3D Fig), potentially linking inflammation to reconstitution.

Given the observed specific inflammatory signature upon UM171 stimulation, we next assessed the possibility that this signature is secondary to induction (global profiling: S4A Fig and S1 Table) or secretion (secretion assay: S4B Fig) of pro-inflammatory factors such as TNFa or IFNResults shown in S4A and S4B Fig do not support this possibility.

Moreover, exposure of CD34+ CB cells to low (10ng/ml) or high (50ng/ml) doses of TNFa or IFNg did neither cause upregulation of EPCR nor CD86 (S4C Fig), demonstrating the complexity of the UM171 inflammatory response which cannot be recapitulated by these 2 canonical pro-inflammatory agonists

Proinflammatory signaling is essential for UM171 induced HSPC expansion

Dexamethasone (Dex) treatment was able to completely suppress the UM171 mediated expansion of HSPC-enriched cell subsets (CD34+EPCR+CD90+CD45RA-: see shNT panels in Fig 2A). This effect was specific to the glucocorticoid receptor as it was markedly attenuated in the absence of this receptor (see shGR panels in Fig 2A). Of interest, reduced HSPC expansion in response to Dex was also observed in the absence of UM171, indicating a general involvement of inflammation in HSCs (Fig 2B and 2C). Most importantly, Dex treatment also reduced the long-term repopulating ability of human HSCs and significantly abolished UM171-driven expansion of these cells (Fig 2D).

Fig. 2. Immunosuppressors abolish UM171 activity in HSPC.
Immunosuppressors abolish UM171 activity in HSPC.
A: CD34+ cord blood cells engineered to express shNT (GFP) or shNR3C1 (shGR) were cultured for 7 days with UM171 (35nM) in presence or absence of Dex (100nM). UM171-mediated expansion of HSC (CD34+CD45RA-EPCR+) subset from transduced (GFP+) cells were evaluated by flow cytometry. B: CD34+ cord blood cells were cultured for 7 days in presence of vehicle or Dex only (100nM). Representative FACS profiles show a reduction of HSCs (CD34+EPCR+) and progenitors (CD34+ and CD34+CD45RA+) in presence of Dex. C: CD34+ cord blood cells were exposed to DMSO, UM171 (35nM), Dex (100nM) or UM171 and Dex for 7 days and co-stained with CD34, EPCR and CD90 antibodies. Total cell counts and counts of HSC enriched subsets are presented. Data show mean ±SEM of 2 independent experiments performed in triplicate. D: Day 7 cultures were transplanted in immunocompromised NSG mice (outcome of 2000 day 0 cells). Human CD45 and CD34 engraftment were assessed at 26 weeks post-transplantation. E: CD34+ cord blood cells were cultures for 5 days in presence of DMSO, UM171 (35nM), NFKB inhibitor (EVP4593, 100nM) and UM171 + EVP4593. FACS profile (left panel) and absolute counts (right panel) of CD34+EPCR+, CD34+EPCR+CD90+ and CD34+CD86+ cells are shown. Data show mean ±SEM of 2 independent experiments performed in triplicate.

We also tested the combination of UM171 with the NFB inhibitor EVP4593 on CD34+ cells. We observed a marked decrease in frequencies and numbers of CD34+CD90+EPCR+ and CD34+CD86+ cells (Fig 2E and 2F), both in the presence or absence of UM171, suggesting that the expansion of these subsets depend on NFB signaling activation. Interestingly, NFkB inhibition significantly reduced EPCR gene expression in HSC enriched population (S5A Fig).

Consistent with these results, Dex as well as other anti-inflammatory inhibitors (JNK, NFkB and NFAT antagonists) suppressed UM171 mediated EPCR and CD86 induction in the OCI-AML5 cell line model (S5B–S5D Fig).

Since cyclic AMP acts as an important anti-inflammatory messenger by inhibiting NFkB signaling through PKA activation [25, 26], we also tested the impact of several cAMP elevating agents on UM171-mediated cord blood expansion. In line with above results, we found that cAMP elevation, whether using a phosphodiesterase inhibitor (IBMX), an adenylate cyclase activator (Forskolin) or cell permeable cAMP (db-AMP), dramatically reduced the proportion CD34+EPCR+ and CD34+CD86+ in UM171-supplemented cultures (S6 Fig).

Taken together, these results demonstrate that activation of pro-inflammatory programs, most notably of NFkB, represents a core requirement for UM171-driven ex vivo HSC expansion.

EPCR attenuates UM171-mediated pro-inflammatory signals

We previously showed that EPCR expression is rapidly induced by UM171 in primitive CD34+ CB cells and that this EPCR-positive subpopulation includes most short -⁠ and long-term HSCs. Moreover, we showed that EPCR is essential for the in vivo activity of human HSCs [23]. Since anti-inflammatory functions connected to NFkB activation have been reported for EPCR [2729], we hypothesized that it might partially antagonize the inflammatory response in cells expanded under UM171 treatment. To test this hypothesis, we targeted the EPCR gene in the OCI-AML5 cell line using CRISPR (Fig 3A–3C). Strikingly, we observed a strong and proinflammatory/NFkB signature specifically in UM171 treated cells that was further exacerbated in three independent sgEPCR OCI-AML5 clones (Fig 3A–3C and S1 Table).

Fig. 3. EPCR attenuates UM171-mediated pro-inflammatory signals.
EPCR attenuates UM171-mediated pro-inflammatory signals.

Of interest, EPCR knockout OCI-AML5 cells were hypersensitive to the combination of TNFa and UM171 (Fig 3D, left panel) which induced a hyper inflammatory response as detected by nitric oxide (NO) production (Fig 3D, right panel). In the context of primitive CD34+CD45RA- cord blood cells, UM171 and TNFa treatment also resulted in NO hyperproduction and cell loss when EPCR was experimentally reduced (Fig 3E). Together, these observations demonstrate that, in addition to causing a pro-inflammatory response, UM171 also triggers a critical negative feedback loop mediated by EPCR that protects HSPCs from inflammation borne cytotoxicity.

UM171 activates a ROS detoxification program through EPCR

We noted that UM171 rapidly induced an EPCR-dependent ROS detoxification response in OCI-AML5 cells (blue rectangle in Figs 3A and 1A). Within 30 minutes of UM171 exposure (Fig 4A, top left panel), at a time where EPCR levels remain unaffected (Fig 4A, top right panel), ROS are rapidly induced and eventually regressed as EPCR levels rise (Fig 4A, bottom panels). At 24 hours, when detoxification genes become upregulated in an EPCR-dependent manner (Fig 4B and blue rectangle in Fig 3A), ROS levels fall below basal values in a UM171 dose dependent manner reaching their lowest at 125-250nM (bottom left panel, Fig 4A and S7A Fig).

Fig. 4. UM171 activates a ROS detoxification program through EPCR.
UM171 activates a ROS detoxification program through EPCR.
A: Assessment of total ROS generation (left panels) in OCI-AML5 cells (as measured by DCFDA relative mean fluorescence intensity) and EPCR levels (right panels) at 30 minutes (upper panels) and 24h (lower panels) after addition of increasing UM171 concentration. B: Fold-change in expression of ROS detoxifying enzymes after exposure to UM171 in EPCR wild-type (sgAAVS1, black histograms) or EPCR null (sgEPCR, red histograms) context. C: CD34+ cord blood cells were exposed to DMSO or UM171 (35nM) for 24hrs and treated with different ROS-generating agents for 3 additional hours. ROS generation was then assessed by flow cytometry. D: CD34+ cord blood cells were exposed for 7 days to DMSO or UM171 (35nM) ± oligomycin. Mitochondrial ROS were then assessed in HSC enriched CD34+CD45RA- subset by flow cytometry using mitosox staining. Total and CD34+CD45RA- absolute cell counts are presented in E. F: CD34+ cord blood cells were cultured for 4 days in presence of DMSO or increasing dose of UM171, or pro-inflammatory cytokine TNFa (10ng/ml) or anti-inflammatory drug dexamethasone (100nM). ROS generation generated in each condition was evaluated using DCFDA staining. Representative FACS profile show ROS production in CD34+EPCR+ (HSC-enriched (blue)) vs CD34+CD45RA+ (progenitors (red)) subsets. G: Graphs showing relative ROS (left panel) and EPCR levels (middle) in HSC-enriched subset and ROS levels in committed cells (right panel). H: Summary of inflammatory status and effects on self-renewal (SR) and proliferation observed after exposure of different immunomodulatory drugs. I: Model depicting UM171-mediated activation of inflammation and subsequent induction of EPCR which in turn restricts excessive inflammation/ROS production.

Most importantly, UM171 also reduced ROS levels in primary CD34+ CB cells treated for 24h with various ROS inducing agents such as etomoxir, rotenone, oligomycine, CCCP (Fig 4C). At day 7, when expansion of functionally defined HSCs reaches its maximum [19, 23], steady-state levels of intracellular ROS were significantly blunted by UM171 in CD34+CD45RA- cells in the presence of oligomycin (Fig 4D and 4E and S7B Fig) and under mild hyperthermia (S7C Fig). Moreover, a robust protective effect of UM171 treatment on ROS generation was observed most strikingly within the CD34+EPCR+ population (Fig 4F in blue, and Fig 4G left panel) versus the more mature CD34+CD45RA- subset (Fig 4D in red, and Fig 4E right panel). In summary, theses observations strongly indicate that UM171 protects against oxidative stress through EPCR induction.

Discussion

In this study, we provide insights into how UM171 promotes the expansion of HSCs by coordinating pro -⁠ and anti-inflammatory responses. Interestingly, whereas pro-inflammatory cytokines like interferons or TNFa and anti-inflammatory drugs like dexamethasone are unable to establish permissive conditions for HSC expansion in culture, a low dose of UM171 (35nM) has the unique capacity to induce a rheostatic regulation of inflammatory and anti-inflammation/detoxification programs, hence enabling an effective context to promote HSC self-renewal (Fig 4H). This inflammatory response is observed within 6 hours of UM171 treatment and does not appear secondary to pro-inflammatory cytokines such as TNFa. Our results thus suggest that UM171 establishes a dosage-dependent and tightly regulated inflammatory tonus that equally relies on positive regulators such as NFkB and their integration in a negative feedback loop which prevents toxic accumulation of ROS/inflammation that is executed through upregulation of EPCR (Fig 4I). We also show that several of these components are active in cells not exposed to UM171, further extending these observations to HSC self-renewal networks. Future work will determine the mediator(s) of this specific inflammatory response.

Supporting a role for pro-inflammatory signaling in HSC self-renewal, exposure of cord blood cells to immunosuppressors such as glucocorticoids led to a marked reduction of HSC repopulating ability and abolished UM171-driven HSC expansion in a glucocorticoid receptor dependent manner. These observations contradict recent findings showing a beneficial effect of glucocorticoids on HSC engraftment [30]. It is important to note that duration of glucocorticoid exposure was different in the 2 studies. While a 16 hour exposure led to an enhanced HSC engraftment [30], longer treatment as performed in the present study had detrimental effects on HSC function. In line with this, while chronic low doses of the pro-inflammatory TLR ligand LPS dramatically impaired HSC function [31], short-term treatment with higher doses of LPS led to increased HSC multi-lineage repopulation ability [32]. It appears therefore that the effects of inflammation on HSCs activity are dose and time-dependent. Consistent with this, while transient NFkB blockade (6 to 24 hours) enhances ex vivo HSC propagation [33], a minimal and critical threshold of NFkB activation is required to maintain HSC homeostasis [34].

Interestingly, HSPCs and committed cells seemed to adapt a distinct inflammatory response upon UM171 treatment. Of interest, many of the differentially modulated genes in primitive cells (such as DUSP4 and BIRC2/3) are known to act as molecular brake in inflammation. It is thus tempting to speculate that HSPCs have established a fine-tuning inflammatory program to mount a robust protective response and avoid self-destructive inflammation. It will be critical in future works to dissect more precisely these inflammatory programs.

In summary, and supporting the work of several ongoing investigations, our current work supports a central role for inflammation in adult stem cell self-renewal, with UM171 providing a favorable state for blood stem cells renewal in which appropriate pro -⁠ and anti-inflammatory/detoxifying conditions are achieved.

Materials and methods

Human CD34+ cord blood cell collection

Umbilical cord blood units were collected from consenting mothers according to ethically approved protocol at Charles-Lemoyne Hospital, Montreal, QC, Canada. Human CD34+cord blood (CB) cells were isolated using The EasySep positive selection kit (StemCell Technologies Cat # 18056). Sorting for more primitive phenotypes was done in additional step using BD Aria II sorter.

CD34+ cell culture

Human CD34+ cells were cultured in HSC expansion media consisting of StemSpan SFEM (StemCell Technologies) supplemented with human 100 ng/ml stem cell factor (SCF, R&D Systems), 100 ng/ml FMS-like trysine kinase 3 ligand (FLT3, R&D Systems), 50 ng/ml thrombopoietin (TPO, R&D Systems), and 10 microg/ml low-density lipoproteins (StemCell Technologies).

Cell Lines

AML cell lines were purchased from the DSMZ German collection of Microorganisms and cell culture (Leibniz Institute) and the ATCC. OCI-AML3 and OCI-AML5 cells were cultured in MEM alpha media with 10% FBS and supplemented with 10 ng/mL of GM-CSF (PeproTech). NB4 and THP-1 cell lines were cultured in RPMI 1640 medium with 10% fetal bovine serum.

Single cell RNA sequencing, population mapping and data analysis

CD34+ cord blood (CB) cells were cultured for 48h, a timepoint before most cells undergo division. Experimental conditions included either DMSO or two different UM171 concentrations; 35nM, a dose previously established as optimal for HSC expansion [19] as well as 1000 nM. Single-cell RNAseq from each of these cultures was performed on a Chromium Single-Cell Controller (10X Genomics) using the Single Cell 3’ Reagent Kit version 2 according to manufacturer’s instructions. Target cell numbers were 6,000 per condition. Sequencing of the scRNAseq libraries were performed on a NovaSeq device using a S2 (PE 28x91) setup. A standard Cellranger v3.0.1 pipeline was used for read mapping (GRCh38 annotation) and demultiplexing. Subsequent analyses were done in Seurat (v2.3) [35] and included (i) exclusion of cells with less than 1,000 genes or unique molecular identifiers (UMI), (ii) exclusion of cells with more genes or UMIs than the respective means plus 2 standard deviations (likely representing multiplets), (iii) exclusion of cells with more than 6% mitochondrial gene expression (representing apoptotic cells). Expression counts were log-normalized (scale factor 10,000) and scaled including regression on number of UMI’s, cell cycle scores and mitochondrial gene content. Multi-set Canonical Correlation Clustering and tSNE embedding was performed using variable genes (defined by mean.function = ExpMean, dispersion.function = LogVMR, x.low.cutoff = 0.02, x.high.cutoff = 5, y.cutoff = 2) excluding sex-specific genes. Average fold-change and p-values were obtained using the FindMarkers function in Seurat with logFC threshold and min.pct set to zero. Log2 fold-change ranked gene lists were used for subsequent GSEA analyses. Significantly regulated genes were defined by p-values smaller than 0.01 and 1.5-fold down or upregulation, respectively. For visualization purposes (S2B–S2D Fig and Fig 1E and 1G), data imputation was done using MAGIC (https://github.com/KrishnaswamyLab/MAGIC) with t = 1 [36].

Initial population mapping was performed based on expression of the stem and progenitor associated genes AVP and HLF [23] (see S2B Fig, HSPC panel), of genes indicative of early lymphoid fate (SPINK2 and SELL; LMPP panel) and selective expression of myeloid, erythroid and megakaryocytic markers which were located to the periphery of the t-SNE projection (S2B Fig).

We next ranked cells using a stem-score (S2C Fig, top heatmap) that was calculated by averaging the normalized expression vectors of twelve commonly accepted stem cell specific genes [23, 3739] (S2C Fig, middle heatmap). As expected, expression of differentiation associated genes anticorrelated with this ranking metric (S2C Fig, lower heatmap). Next, we categorized the top 5% stem-score ranking cells as ‘primitive’ and the lowest 20% as ‘committed’ subsets (Fig 1D, bottom). Notably, t-SNE representation of these designated populations recapitulated a clear spatial distinction between HSPCs in the top central (Fig 1D, in red) and committed/differentiated populations in the lower periphery of the projection space (Fig 1D, in blue). Albeit with small changes in frequency compared to the combined dataset, primitive and committed populations distributed well into all three experimental conditions (Fig 1D, middle panel).

Flow cytometry analysis

Mouse anti-human antibodies were used to detect CD34 (APC or BV421 -⁠ BD Biosciences), CD45RA (PE -⁠ BD Biosciences), CD86 (PerCP-eFluor710 -⁠ eBioscience), CD90 (PECY7 -⁠ BioLegend), and EPCR (APC-BioLegend). Flow cytometry acquisitions were performed on a Canto II cytometer (BD Biosciences) and data analysis was performed using FowJo software (Tree Star, Ashland, OR, USA) and GraphPad Prism software. Dead cells were excluded using 7AAD staining.

Transplantation assays

All experiments with animals were conducted under protocols approved by the University of Montreal Animal Care Committee. EPCR cell subsets purified from uncultured or expanded CD34+CD45RA- CB cells were transplanted by tail vein injection into sub-lethally irradiated (250 cGy, <24 hr before transplantation) 8 to 16-week-old female NSG (NOD-Scid IL2Rgnull, Jackson Laboratory) mice. Human cells NSG-BM cells were collected by femoral aspiration or by flushing the two femurs, tibias and hips when animals were sacrificed at week 26.

Nitric oxide production

Intracellular NO was measured after staining for cell surface markers, by incubation of cells for 15 min at 37°C with 10 microM DAF-FM diacetate followed by extensive washes, according to the manufacturer's instructions (Molecular Probes).

Cytokine assays

Cytokine levels in day 4 DMSO or UM171-exposed CD34+ cord blood cultures were measured using the LEGENDplex Human Inflammation Panel (13-plex) according to manufacturer’s instructions. Data was analyzed using the LEGENDplexTM Data Analysis Software. In some conditions, cytokines secretion was also assessed after 4 hours PMA/ionomycin (20 ng/ml, 500 ng/ml) stimulation.

Drugs

Dexamethasone (Dex), EVP (NFKB inhibitor), Forskolin, IBMX, db-cAMP, etomoxir, oligomycin, rotenone and CCCP were purchased from Sigma. SP600125 (JNK inhibitor) were purchased from selleckchem and cyclosporine A (CsA) were purchased from Cayman.

shRNA and sgRNA vectors

shRNA vectors against EPCR and NR3C1 were reported previously [23, 40] respectively). 3 different sgRNA against EPCR were designed (sg1: ACAGCCCAGGAAGCAGCGGA; sg2:GGTGAAGGTGACCACTCCGG; sg3: GGGACACCTAACGCACGTGC).

Bulk RNA sequencing and data analysis

3–5 x 105 cells were FACS sorted from day 7 cultured cord blood derived CD34+ HSPCs and preserved at -80 C in TRIzol Reagent (Thermo Fisher Scientific Cat # 15596026). cDNA libraries were constructed according to TruSeq Protocols (Illumina) and sequencing was performed using an Illumina HiSeq 2000 instrument. Gene expression statistics were obtained using the kallisto/sleuth analysis pipeline (https://pachterlab.github.io/sleuth/about) and the GRCh38 version 84 annotation. Differential gene expression was determined using sleuth p-values and fold-change in transcripts per million (TPM) values as designated. GSEA analysis was done using the fgsea R package and the full Molecular Signatures Database (MSigDB, Broad Institute).

Accession codes

Gene Expression Omnibus: GSE57561, GSE138487 and GSE138680

Supporting information

S1 Fig [500nm]
UM171 induces upregulation of EPCR and CD86 in leukemic cell lines.

S2 Fig [magic]
UM171 exposure correlates with inflammation signature in CD34+ cells.

S3 Fig [tif]
Impact of high dose UM171 exposure on HSPC.

S4 Fig [35nm]
UM171 inflammatory response is not recapitulated by pro-inflammatory agonists TNF and IFN.

S5 Fig [35nm]
Immunosuppressors abolish UM171 inflammatory response in leukemic cell lines.

S6 Fig [35nm]
cAMP elevating agents abolish UM171 inflammatory response in CD34+ cells.

S7 Fig [35nm]
UM171 prevents oligomycin and hyperthermia-induced ROS elevation in CD34+ cells.

S1 Table [xlsx]
AML5 and CD34+ Transcriptome and single cell RNAseq data.


Zdroje

1. Goessling W, North TE, Loewer S, Lord AM, Lee S, Stoick-Cooper CL, et al. Genetic interaction of PGE2 and Wnt signaling regulates developmental specification of stem cells and regeneration. Cell. 2009;136(6):1136–47. Epub 2009/03/24. doi: 10.1016/j.cell.2009.01.015 19303855; PubMed Central PMCID: PMC2692708.

2. North TE, Goessling W, Walkley CR, Lengerke C, Kopani KR, Lord AM, et al. Prostaglandin E2 regulates vertebrate haematopoietic stem cell homeostasis. Nature. 2007;447(7147):1007–11. Epub 2007/06/22. doi: 10.1038/nature05883 17581586; PubMed Central PMCID: PMC2775137.

3. Dennis EA, Norris PC. Eicosanoid storm in infection and inflammation. Nat Rev Immunol. 2015;15(8):511–23. Epub 2015/07/04. doi: 10.1038/nri3859 26139350; PubMed Central PMCID: PMC4606863.

4. Turner MD, Nedjai B, Hurst T, Pennington DJ. Cytokines and chemokines: At the crossroads of cell signalling and inflammatory disease. Biochim Biophys Acta. 2014;1843(11):2563–82. Epub 2014/06/04. doi: 10.1016/j.bbamcr.2014.05.014 24892271.

5. Clapes T, Lefkopoulos S, Trompouki E. Stress and Non-Stress Roles of Inflammatory Signals during HSC Emergence and Maintenance. Front Immunol. 2016;7 : 487. Epub 2016/11/23. doi: 10.3389/fimmu.2016.00487 27872627; PubMed Central PMCID: PMC5098161.

6. Espin-Palazon R, Stachura DL, Campbell CA, Garcia-Moreno D, Del Cid N, Kim AD, et al. Proinflammatory signaling regulates hematopoietic stem cell emergence. Cell. 2014;159(5):1070–85. Epub 2014/11/25. doi: 10.1016/j.cell.2014.10.031 25416946; PubMed Central PMCID: PMC4243083.

7. Espin-Palazon R, Weijts B, Mulero V, Traver D. Proinflammatory Signals as Fuel for the Fire of Hematopoietic Stem Cell Emergence. Trends Cell Biol. 2018;28(1):58–66. Epub 2017/09/09. doi: 10.1016/j.tcb.2017.08.003 28882414.

8. He Q, Liu F. Unexpected role of inflammatory signaling in hematopoietic stem cell development: its role beyond inflammation. Curr Opin Hematol. 2016;23(1):18–22. Epub 2015/11/12. doi: 10.1097/MOH.0000000000000197 26554888.

9. He Q, Zhang C, Wang L, Zhang P, Ma D, Lv J, et al. Inflammatory signaling regulates hematopoietic stem and progenitor cell emergence in vertebrates. Blood. 2015;125(7):1098–106. Epub 2014/12/30. doi: 10.1182/blood-2014-09-601542 25540193.

10. Herman AC, Monlish DA, Romine MP, Bhatt ST, Zippel S, Schuettpelz LG. Systemic TLR2 agonist exposure regulates hematopoietic stem cells via cell-autonomous and cell-non-autonomous mechanisms. Blood Cancer J. 2016;6:e437. Epub 2016/06/18. doi: 10.1038/bcj.2016.45 27315114; PubMed Central PMCID: PMC5141360.

11. Kim PG, Canver MC, Rhee C, Ross SJ, Harriss JV, Tu HC, et al. Interferon-alpha signaling promotes embryonic HSC maturation. Blood. 2016;128(2):204–16. Epub 2016/04/21. doi: 10.1182/blood-2016-01-689281 27095787; PubMed Central PMCID: PMC4946201.

12. Li Y, Esain V, Teng L, Xu J, Kwan W, Frost IM, et al. Inflammatory signaling regulates embryonic hematopoietic stem and progenitor cell production. Genes Dev. 2014;28(23):2597–612. Epub 2014/11/15. doi: 10.1101/gad.253302.114 25395663; PubMed Central PMCID: PMC4248291.

13. Matatall KA, Jeong M, Chen S, Sun D, Chen F, Mo Q, et al. Chronic Infection Depletes Hematopoietic Stem Cells through Stress-Induced Terminal Differentiation. Cell Rep. 2016;17(10):2584–95. Epub 2016/12/08. doi: 10.1016/j.celrep.2016.11.031 27926863; PubMed Central PMCID: PMC5161248.

14. Matatall KA, Shen CC, Challen GA, King KY. Type II interferon promotes differentiation of myeloid-biased hematopoietic stem cells. Stem Cells. 2014;32(11):3023–30. Epub 2014/08/01. doi: 10.1002/stem.1799 25078851; PubMed Central PMCID: PMC4198460.

15. Mirantes C, Passegue E, Pietras EM. Pro-inflammatory cytokines: emerging players regulating HSC function in normal and diseased hematopoiesis. Exp Cell Res. 2014;329(2):248–54. Epub 2014/08/26. doi: 10.1016/j.yexcr.2014.08.017 25149680; PubMed Central PMCID: PMC4250307.

16. Pietras EM, Mirantes-Barbeito C, Fong S, Loeffler D, Kovtonyuk LV, Zhang S, et al. Chronic interleukin-1 exposure drives haematopoietic stem cells towards precocious myeloid differentiation at the expense of self-renewal. Nat Cell Biol. 2016;18(6):607–18. Epub 2016/04/26. doi: 10.1038/ncb3346 27111842; PubMed Central PMCID: PMC4884136.

17. Sawamiphak S, Kontarakis Z, Stainier DY. Interferon gamma signaling positively regulates hematopoietic stem cell emergence. Dev Cell. 2014;31(5):640–53. Epub 2014/12/10. doi: 10.1016/j.devcel.2014.11.007 25490269; PubMed Central PMCID: PMC4371141.

18. Schuettpelz LG, Link DC. Regulation of hematopoietic stem cell activity by inflammation. Front Immunol. 2013;4 : 204. Epub 2013/07/25. doi: 10.3389/fimmu.2013.00204 23882270; PubMed Central PMCID: PMC3715736.

19. Fares I, Chagraoui J, Gareau Y, Gingras S, Ruel R, Mayotte N, et al. Cord blood expansion. Pyrimidoindole derivatives are agonists of human hematopoietic stem cell self-renewal. Science. 2014;345(6203):1509–12. Epub 2014/09/23. doi: 10.1126/science.1256337 25237102; PubMed Central PMCID: PMC4372335.

20. Esmon CT. Crosstalk between inflammation and thrombosis. Maturitas. 2004;47(4):305–14. Epub 2004/04/06. doi: 10.1016/j.maturitas.2003.10.015 15063484.

21. Iwaki T, Cruz DT, Martin JA, Castellino FJ. A cardioprotective role for the endothelial protein C receptor in lipopolysaccharide-induced endotoxemia in the mouse. Blood. 2005;105(6):2364–71. Epub 2004/11/06. doi: 10.1182/blood-2004-06-2456 15528312.

22. Levi M, van der Poll T. Recombinant human activated protein C: current insights into its mechanism of action. Crit Care. 2007;11 Suppl 5:S3. Epub 2008/02/27. doi: 10.1186/cc6154 18269690; PubMed Central PMCID: PMC2230607.

23. Fares I, Chagraoui J, Lehnertz B, MacRae T, Mayotte N, Tomellini E, et al. EPCR expression marks UM171-expanded CD34(+) cord blood stem cells. Blood. 2017;129(25):3344–51. Epub 2017/04/15. doi: 10.1182/blood-2016-11-750729 28408459.

24. Gur-Cohen S, Kollet O, Graf C, Esmon CT, Ruf W, Lapidot T. Regulation of long-term repopulating hematopoietic stem cells by EPCR/PAR1 signaling. Ann N Y Acad Sci. 2016;1370(1):65–81. doi: 10.1111/nyas.13013 26928241; PubMed Central PMCID: PMC5193365.

25. Gerlo S, Kooijman R, Beck IM, Kolmus K, Spooren A, Haegeman G. Cyclic AMP: a selective modulator of NF-kappaB action. Cellular and molecular life sciences: CMLS. 2011;68(23):3823–41. doi: 10.1007/s00018-011-0757-8 21744067.

26. Zuo L, Shi L, Yan F. The reciprocal interaction of sympathetic nervous system and cAMP-PKA-NF-kB pathway in immune suppression after experimental stroke. Neuroscience letters. 2016;627 : 205–10. doi: 10.1016/j.neulet.2016.05.066 27250857.

27. Gorbacheva L, Pinelis V, Ishiwata S, Strukova S, Reiser G. Activated protein C prevents glutamate -⁠ and thrombin-induced activation of nuclear factor-kappaB in cultured hippocampal neurons. Neuroscience. 2010;165(4):1138–46. doi: 10.1016/j.neuroscience.2009.11.027 19931359.

28. Guitton C, Cottereau A, Gerard N, Quillard T, Chauveau A, Devalliere J, et al. Protective cross talk between activated protein C and TNF signaling in vascular endothelial cells: implication of EPCR, noncanonical NF-kappaB, and ERK1/2 MAP kinases. American journal of physiology Cell physiology. 2011;300(4):C833–42. doi: 10.1152/ajpcell.00003.2010 21228323.

29. Seol JW, Lee YJ, Jackson CJ, Sambrook PN, Park SY. Activated protein C inhibits bisphosphonate-induced endothelial cell death via the endothelial protein C receptor and nuclear factor-kappaB pathways. International journal of molecular medicine. 2011;27(6):835–40. doi: 10.3892/ijmm.2011.649 21424111.

30. Guo B, Huang X, Cooper S, Broxmeyer HE. Glucocorticoid hormone-induced chromatin remodeling enhances human hematopoietic stem cell homing and engraftment. Nat Med. 2017;23(4):424–8. doi: 10.1038/nm.4298 28263313; PubMed Central PMCID: PMC5408457.

31. Zhao Y, Ling F, Wang HC, Sun XH. Chronic TLR signaling impairs the long-term repopulating potential of hematopoietic stem cells of wild type but not Id1 deficient mice. PLoS One. 2013;8(2):e55552. doi: 10.1371/journal.pone.0055552 23383338; PubMed Central PMCID: PMC3562238.

32. Takizawa H, Regoes RR, Boddupalli CS, Bonhoeffer S, Manz MG. Dynamic variation in cycling of hematopoietic stem cells in steady state and inflammation. J Exp Med. 2011;208(2):273–84. doi: 10.1084/jem.20101643 21300914; PubMed Central PMCID: PMC3039863.

33. Talkhoncheh MS, Subramaniam A, Magnusson M, Kumar P, Larsson J, Baudet A. Transient inhibition of NF-kappaB signaling enhances ex vivo propagation of human hematopoietic stem cells. Haematologica. 2018;103(9):1444–50. doi: 10.3324/haematol.2018.188466 29880606; PubMed Central PMCID: PMC6119158.

34. Fang J, Muto T, Kleppe M, Bolanos LC, Hueneman KM, Walker CS, et al. TRAF6 Mediates Basal Activation of NF-kappaB Necessary for Hematopoietic Stem Cell Homeostasis. Cell Rep. 2018;22(5):1250–62. doi: 10.1016/j.celrep.2018.01.013 29386112; PubMed Central PMCID: PMC5971064.

35. Butler A, Hoffman P, Smibert P, Papalexi E, Satija R. Integrating single-cell transcriptomic data across different conditions, technologies, and species. Nature biotechnology. 2018;36(5):411–20. doi: 10.1038/nbt.4096 29608179.

36. van Dijk D, Sharma R, Nainys J, Yim K, Kathail P, Carr AJ, et al. Recovering Gene Interactions from Single-Cell Data Using Data Diffusion. Cell. 2018;174(3):716–29 e27. doi: 10.1016/j.cell.2018.05.061 29961576.

37. Chen JY, Miyanishi M, Wang SK, Yamazaki S, Sinha R, Kao KS, et al. Hoxb5 marks long-term haematopoietic stem cells and reveals a homogenous perivascular niche. Nature. 2016;530(7589):223–7. doi: 10.1038/nature16943 26863982; PubMed Central PMCID: PMC4854608.

38. Gazit R, Mandal PK, Ebina W, Ben-Zvi A, Nombela-Arrieta C, Silberstein LE, et al. Fgd5 identifies hematopoietic stem cells in the murine bone marrow. J Exp Med. 2014;211(7):1315–31. doi: 10.1084/jem.20130428 24958848; PubMed Central PMCID: PMC4076584.

39. Zheng S, Papalexi E, Butler A, Stephenson W, Satija R. Molecular transitions in early progenitors during human cord blood hematopoiesis. Molecular systems biology. 2018;14(3):e8041. doi: 10.15252/msb.20178041 29545397; PubMed Central PMCID: PMC5852373.

40. Simon L, Lavallee VP, Bordeleau ME, Krosl J, Baccelli I, Boucher G, et al. Chemogenomic Landscape of RUNX1-mutated AML Reveals Importance of RUNX1 Allele Dosage in Genetics and Glucocorticoid Sensitivity. Clin Cancer Res. 2017;23(22):6969–81. Epub 2017/09/01. doi: 10.1158/1078-0432.CCR-17-1259 28855357.


Článek vyšel v časopise

PLOS One


2019 Číslo 11
Nejčtenější tento týden
Nejčtenější v tomto čísle
Kurzy

Zvyšte si kvalifikaci online z pohodlí domova

Revma Focus: Spondyloartritidy
nový kurz

Svět praktické medicíny 1/2026 (znalostní test z časopisu)

Těžké astma a reMISE – od teorie k praxi
Autoři: doc. MUDr. Norbert Pauk, Ph.D.

Denzitometrie v praxi: od kvalitního snímku po správnou interpretaci
Autoři: prof. MUDr. Vladimír Palička, CSc., Dr.h.c., doc. MUDr. Václav Vyskočil, Ph.D., MUDr. Petr Kasalický, CSc., MUDr. Jan Rosa, Ing. Pavel Havlík, Ing. Jan Adam, Hana Hejnová, DiS., Jana Křenková

Eozinofilie – multioborová otázka?
Autoři: MUDr. Irena Krčmová, CSc.

Všechny kurzy
Přihlášení
Zapomenuté heslo

Zadejte e-mailovou adresu, se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.

Přihlášení

Nemáte účet?  Registrujte se

#ADS_BOTTOM_SCRIPTS#