-
Články
- Vzdělávání
- Časopisy
Top články
- Témata
- Kongresy
- Videa
- Podcasty
Nové podcasty
Reklama- Volná místa
Doporučené pozice
Reklama- Praxe
Genome-wide histone modification profiling of inner cell mass and trophectoderm of bovine blastocysts by RAT-ChIP
Authors: Tõnis Org aff001; Kati Hensen aff001; Rita Kreevan aff001; Elina Mark aff002; Olav Sarv aff003; Reidar Andreson aff004; Ülle Jaakma aff002; Andres Salumets aff003; Ants Kurg aff001
Authors place of work: Department of Biotechnology, Institute of Molecular and Cell Biology, University of Tartu, Tartu, Estonia aff001; Chair of Animal Breeding and Biotechnology, Estonian University of Life Sciences, Tartu, Estonia aff002; Competence Centre on Health Technologies, Tartu, Estonia aff003; Department of Bioinformatics, Institute of Molecular and Cell Biology, University of Tartu, Tartu, Estonia aff004; Institute of Genomics, University of Tartu, Tartu, Estonia aff005; Department of Obstetrics and Gynaecology, Institute of Clinical Medicine, University of Tartu, Tartu, Estonia aff006; Institute of Biomedicine and Translational Medicine, University of Tartu, Tartu, Estonia aff007; Department of Obstetrics and Gynaecology, University of Helsinki and Helsinki University Hospital, Helsinki, Finland aff008
Published in the journal: PLoS ONE 14(11)
Category: Research Article
doi: https://doi.org/10.1371/journal.pone.0225801Summary
Chromatin immunoprecipitation coupled with next-generation sequencing (ChIP-seq) has revolutionized our understanding of chromatin-related biological processes. The method, however, requires thousands of cells and has therefore limited applications in situations where cell numbers are limited. Here we describe a novel method called Restriction Assisted Tagmentation Chromatin Immunoprecipitation (RAT-ChIP) that enables global histone modification profiling from as few as 100 cells. The method is simple, cost-effective and takes a single day to complete. We demonstrate the sensitivity of the method by deriving the first genome-wide maps of histone H3K4me3 and H3K27me3 modifications of inner cell mass and trophectoderm of bovine blastocyst stage embryos.
Keywords:
Chromatin – Gene expression – Gene regulation – Embryos – Histones – Immunoprecipitation – Blastocysts – Histone modification
Introduction
The development and functioning of a multicellular organism are determined by how the genetic information, encoded in its genomic DNA sequence, is utilized by individual cells. In eukaryotic cells, DNA is packed into chromatin using proteins of which histones are the most abundant. Each cell type has its specific chromatin structure, which is dynamic and can be remodeled to regulate gene expression, DNA repair and cell division. Our understanding of these chromatin-related processes has improved vastly over the past years thanks to the advances in DNA sequencing technologies. Chromatin immunoprecipitation (ChIP) has been the method of choice to study the location of DNA bound proteins for years [1]. Coupling ChIP with deep sequencing (ChIP-seq) has enabled to determine the localization of chromatin-bound proteins at a genome-wide level [2]. For example, it has helped to identify that different histone post-translational modifications are associated with different genomic features and transcriptional states, helping to explain how cell type specific gene regulation is achieved [3,4].
One of the limitations of ChIP-seq method is that it usually requires a large number of cells. In a typical experiment, several million cells are used, which can be a limiting factor when working with samples where cell numbers are restricted, such as highly purified rare cell populations or early developmental stages. Recent advances in technologies have made it possible to develop more sensitive ChIP-seq methods (S1 Table) [5–19], however, many of these methods are complex, laborious, require specific apparatus or reagents, or are not sensitive enough. With these limitations in mind, we aimed to develop a novel ChIP-method for a limited number of cells that would be sensitive but also robust so it could be used without the need for special equipment and readily available reagents.
A typical ChIP-seq experiment consists of several experimental steps to produce a library that can be sequenced using massively parallel sequencing. These steps include fixing, cell lysis, chromatin fragmentation, immunoprecipitation, decrosslinking, DNA purification, and sequencing library preparation followed by sequencing. There are many issues that arise when working with a low number of cells of which the loss of material is the most prominent. In the published protocols the reduction of material loss has been achieved through the use of different carriers that mimic more material [7,12][19] or with indexing first and then pool the samples technique to obtain more material for subsequent steps [9,14,15]. Another option is to minimize the number of experimental steps, such as centrifugations and material transfer from one tube to another, where a material loss is expected. In addition, it is desirable to downscale the sample volumes to account for the reduction in the amount of input material. This can be relatively easily achieved when the sonication step is replaced with enzymatic DNA digestion, as using standard equipment, sonication cannot be done effectively in a small volume.
There are many instances where more sensitive ChIP-seq methods could be useful but the most obvious is studying early development, like mammalian embryo preimplantation development, as the number of available cells in these study samples is especially low. The cellular changes that take place during development are remarkable both at the molecular and phenotypic level. Understanding the molecular basis for differentiation it is not only fascinating but it also holds great promise to advance reproductive medicine and the generation of desired cell types for regenerative medicine. Recently, the first histone modification landscapes of early mouse development were reported [16,17,20]. In addition to using more sensitive ChIP assays, a pool from large number of embryos was still needed in order to obtain a sufficient amount of cells. Therefore, although substantial advancements have been made both in sensitivity and simplicity of the ChIP-seq methods, there is still room for improvement. This is in particular important in the context of studying human embryonic development as many legal, ethical and technical issues come to play. To overcome some of these issues, bovine can be used as a model as its embryogenesis is more similar to the human compared to other common model organisms. Previously, we have used bovine to study chromosomal instability in early embryos and shown it to be a good model [21]. Here, by using a novel RAT-ChIP method we derive the first genome-wide histone H3K4me3 and H3K27me3 profiles of inner cell mass (ICM) and trophectoderm (TE) of blastocyst stage bovine embryos, being the two major cell lineages that develop into embryonic and extraembryonic tissues, respectively. Combining this epigenetics data with published expression profiling data serves as a resource to provide insights into the gene expression regulation of early bovine development and paves a way to new studies, for example with a somatic cell nuclear transfer (SCNT), e.g. cloned embryos where epigenetics has thought to act as a major roadblock of nuclear reprogramming.
Materials and methods
Cell lines
Human K562 and H1299 cells were grown in IMDM and DMEM (both from Naxo) respectively, supplemented with 10% of FBS and penicillin/streptomycin (Naxo) in the presence of 5% CO2 at 37°C.
Oocyte collection and in vitro maturation
All chemicals used for in vitro embryo production were purchased from IVF Limited T/A IVF Bioscience. Slaughterhouse derived ovaries were transported to the laboratory in a 0.9% sterile NaCl solution within 4 h after slaughter at approximately 32–37°C and washed twice in a 0.9% NaCl solution. Using a vacuum pump (Minitüb GmbH), cumulus oocyte complexes (COC) from follicles with a diameter of 2-8mm were aspirated. Grade 1 COCs were washed and matured in groups of 50 in 500μl of in vitro maturation medium in four-well plates (Nunc). Oocytes were incubated at 38.5°C with humidified 5% CO2 in air for 22–24 h.
In vitro fertilization
Frozen-thawed semen from a Holstein bull ZIARD (id EE 13993023) was used to fertilize the matured oocytes. Oocytes and sperm were co-incubated in groups of 50 in 500μl of BO-IVM media in four-well plates (Nunc) at 38.5°C with humidified 5% CO2 in air for 22–24 h.
In vitro cultivation
Zygotes were individually cultured in 60μl droplets BO-IVC media for 8 days at 38.5°C, 5% CO2, 5% O2 and 90% N2 with maximum humidity. Embryos having reached blastocyst stage by day 8 were collected and used for laser-assisted microdissection.
Laser-assisted microdissection to obtain ICM and TE fractions
Integra 3 micromanipulator (Research Instruments Limited) equipped with Saturn 5 Active™ laser system was used to manually separate bovine blastocysts into ICM and TE fractions (of note–while manual dissection achieves to get pure populations of TE, small fraction of TE cells remain associated with the separated ICM mass). Separated fractions from three blastocysts were pooled and used for subsequent RAT-ChIP-seq experiments.
RAT-ChIP-(seq)
For a single immunoprecipitation 1μl ProtG Dynabeads (Thermo Fisher Scientific) were bound with 0.25μg of corresponding antibody (H3K4me3 (07–473, Millipore), H3K27me3 (07–449, Millipore)) or H3 (C15200011, Diagenode) in 5μl of complete immunoprecipitation (IP) buffer (20mM Tris HCl pH 7.4, 2mM EDTA, 150mM NaCl, 0.1% Triton X-100) at RT using standard 0.2ml Eppendorf tubes with end-over end mixing (30 rpm) for 2 h followed by two washes using 50μl of IP buffer. All washes were performed by gently pipetting the beads 10 times up and down. Magnetic beads were captured by 1-minute incubation on a magnetic stand (Diagenode). Finally, beads were suspended in the original amount of IP buffer (1μl per IP).
The density of cultured K562 or H1299 cells was determined using haemocytometer. Cells were spun down and resuspended in PBS at a density 100 or 1,000 cells per 0.5μl. Subsequently 0.5μl of lysis-restriction mix (1μl FD (FastDigest) buffer combined with 3.75μl of 2x nuclear lysis buffer (20mM Tris HCl, pH 7.4, 20mM NaCl, 6mM MgCl2, 0.2% NP-40)) and 0.25μl 4x restriction enzyme mix (AluI #FD0014, SaqAI#FD2174, HinfI#FD0804, MvaI#FD0554, all FastDigest enzymes from Thermo Scientific in equal amounts) was added to the cells and incubated 15 min on ice and thereafter 5 min at 37°C. Next, 1μl of 0.2% NaDOC, 0.2% TritonX-100 with protease inhibitors was added to the samples and incubated 15 min on ice, vortexed for 30 sec, after which 8μl of IP buffer (20mM Tris HCl, pH 7.4, 150mM NaCl, 2mM EDTA and 1% TritonX-100) and 1μl of ProtG Dynabeads (Thermo Fisher Scientific) prebound with corresponding antibody was added to the samples. Chromatin immunoprecipitation was performed at 4°C for four hours with end-over end mixing (30 rpm). After IP, beads were washed twice with 100μl of following buffers: low salt washing buffer (0.1% SDS, 1% Triton X-100, 2mM EDTA, 20mM Tris HCl (pH 8.0), 150mM NaCl), high salt washing buffer (0.1% SDS, 1% Triton X-100, 2mM EDTA, 20mM Tris HCl (pH 8.0), 500mM NaCl), IP buffer and 20mM Tris HCl, pH 7.4, as described above. To reduce background the beads were carried over to a new tube during the last wash. Multichannel pipet was used for processing multiple samples simultaneously.
Tagging was performed by resuspending the beads in 2.5μl of transposase mix (prepared by mixing 5μl of 2x DNA tagment buffer with 4μl mQ and 1μl Transposase) (Illumina Nextera kit) and incubation of 1 min at 37°C. Beads were washed once with 100μl of low salt washing buffer, once with 20mM Tris HCl pH 7.4, as described above, and resuspended in 5μl of 20mM Tris HCl, pH 7.4. 16 cycles of PCR were performed using bead bound DNA as a template by mixing 5μl of beads with 2,5μl of 5μM forward and reverse primers from the ATAC-seq protocol [22] and 10μl of 2x NEBNext PCR master mix (New England Biolabs). The following PCR program was used: (72°C 5 min, 98°C 2 min, 98°C 10 sec, 63°C 10 sec, 72°C 1 min, repeat steps 3–5 15 times, hold at 4°C). PCR products were purified with Agencourt RNA XP magnetic beads (Beckman Coulter), eluted in 10μl of Tris HCl pH 7.4 followed by quality control and DNA quantification using NanoDrop, Qubit (Thermo Fisher Scientific) and TapeStation (Agilent). The resulting library was subjected to 50 or 75bp paired-end Illumina sequencing using either HiSeq2500 or NextSeq platforms. Alternatively, the library was analyzed with q-RT-PCR using Applied Biosystems 7900HT real-time qPCR machine, HOT FIREPol® EvaGreen® qPCR Mix Plus (Solis BioDyne) and following primers: GAPDH_F CCCGTCCTTGACTCCCTAG, GAPDH_R CTGGTTCAACTGGGCACG; VPS29_F TCGCTACTTCCTGTTCTGCA, VPS29_R GATAGGGGCACGGTCCTC; ZNF7_F TACTGTTTCCTCGCCAGCTC, ZNF7_R GAGGCAAAGGAGACAAAGCA; Neg_cntrl_F CAAATGTGGTCACTAAGGCAAC, Neg_cntrl_R GTGACTCTCCTGGACCAACA.
RAT-ChIP-seq with bovine blastocysts was performed as described above except that after dissection the cells were collected in 3μl of embryo medium. Lysis/restriction buffer was prepared by combining 4.75μl of 10x NL (100mM Tris HCl, pH 7.4, 100mM NaCl, 30mM MgCl2) buffer, 4.75μl of 10x FastDigest buffer and 0.5μl of mix of 4x restriction endonucleases. 0.75μl of lysis/restriction buffer was added to 3μl of cells and incubated 15 min on ice and 5 min at 37°C. Next, 1μl of mix of 0.5% NaDOC, 0.5% TritonX100 with protease inhibitor cocktail was added to the samples and incubated 15 min on after which 15μl of IP buffer (20mM Tris HCl pH 7.4, 2mM EDTA, 150mM NaCl, 0.1% Triton X-100) was added and sample was divided into 2 tubes, 10μl each for subsequent IP with Dynabeads bound with corresponding antibodies.
Two types of input samples were prepared. First, the samples were treated according to the RAT-ChIP protocol, but instead of immunoprecipitation, DNA was extracted using DNA Clean & Concentrator kit from Zymo Research, followed by tagging with Tn5 transposase according to manufacturer’s protocol (Illumina) and sequencing library construction using PCR. Second, samples were initially treated according to the RAT-ChIP protocol and tagging of chromatin was performed in cell nuclei right after treatment with restriction enzymes followed by DNA extraction and library generation using PCR as described above. Detailed RAT-ChIP protocol is available in S1 File and at protocols.io website (dx.doi.org/10.17504/protocols.io.69qhh5w).
In silico analysis of restriction enzyme cutting sites
Human genome hg19 version GRCh37.p13 from EnsEMBL website (http://grch37.ensembl.org/) was used for the in silico analysis. The consensus sequence (‘AGCT’, ‘TTAA’, ‘CCWGG’—where ‘W* can be either ‘A’ or ‘T’, and ‘GANTC’—where ‘N’ can be any nucleotide) for each restriction enzyme (AluI, SaqAI, HinfI, MvaI) respectively, was mapped onto each chromosome sequence. The final list contained over 50 million restriction site positions. The recorded coordinates were used to determine the average number of restriction enzyme recognition sites per 1kb in chromHMM K562 chromatin state regions [23] (repeat containing states 14 and 15 were excluded from the analysis) using custom written Perl scripts followed by average fragment length calculation. Custom Perl scripts are available from https://github.com/reidar-andreson/nucleosomes. Coordinates for gap, repeat and chromHMM K562 chromatin state regions were downloaded from UCSC Table browser [24]. Qualimap [25] was used to get the quality metrics of different ChIP-seq datasets in S4 Table and for the calculation of median read length in K562 cell input sample in different chromatin state regions.
Used publicly available data
Raw data from following K562 ChIP-seq datasets from GEO database were downloaded and reprocessed as described below: GSM945165, GSM945228, GSM733680, GSM733658, GSM1782695, GSM1782755, GSM1782693, GSM1782739, GSM1918612-GSM1918616, GSM1918602-GSM1918606, GSM1918592-GSM1918596, GSM1918582-GSM1918586, GSM1141671 and GSM1141672. bESC ChIP-seq data is form GSE110039 and K562 RNA-seq data from GSM1940168. For S13C Fig, bigwig files were downloaded from the following datasets—GSM2082690, GSM2082693, GSM2082696, GSM2082698, GSM2082701, GSM2082703. For ICM and TE gene expression comparisons gene lists from the following publications were used [26–30].
RAT-ChIP-seq and expression data analysis
Sequencing reads were mapped to hg19 or bosTau8 genome using Bowtie2 (version 2.3.3.1) [31] using following parameters -k 2 -N 1. Next, bam files were sorted and indexed using SAMtools (version 1.6) [32] and bigwig files were created using deepTools 2.0 [33]. We used blacklist regions for hg19 genome annotation created during ENCODE project to exclude them from further analysis [34]. Bigwig files were visualized in UCSC genome browser as custom tracks [24]. Peak calling was done using SICER-rb.sh script (version 1.1) [35] with following parameters: (100 200 200 0.74 600 50). For the final list of peaks regions that overlapped with hg19 blacklisted regions were discarded. Differential peak calling was done using SICER-df-rb.sh script (version 1.1) [35] with following parameters: (100 200 200 0.74 600 50). In addition to the FDR threshold, arbitrary 4-fold cut-off was used for H3K27me3 signal to restrict the number regions for further analysis. Manipulation with genomic regions such as intersection or subtraction was done using bedtools (version 2.26.0) [36] or various operate on genomic intervals tools in the Cistrome Galaxy server [37,38]. Global pairwise Pearson correlation analysis, clustering and heatmap generation was performed in 5kb windows using multiple wiggle files correlation tool in Cistrome Galaxy server [37,38]. Global H3K4me3 heatmaps in 10kb regions around TSS (in 100bp windows) were generated using heatmap tool in Cistrome Galaxy server [37,38]. Average H3K4me3 enrichment profiles in 10kb regions around TSS (in 10bp windows) were generated using Sitepro tool in Cistrome Galaxy server [37,38]. Locus specific average metagene (3kb up and downstream of the gene and 6kb metagene body) enrichments of H3K27me3 were calculated and visualized using bwtool [39]. GO enrichment analysis of cell-type enriched histone modification regions (identified using SICER and sorted based on fold change) was performed using GREAT (version 3.0.0) [40] with proximal: 5 kb upstream, 1 kb downstream, plus distal: up to 100 kb, parameters. Venn diagrams were created using InteractiVenn [41]. For data visualization and statistical analysis MS Excel and GraphPad were used. Paired T-Test was used to calculate if average signals between pairs of corresponding gene regions (TE or ICM upregulated genes) in TE and ICM were significantly (p<0.05) different.
The datasets supporting the conclusions of this article are included within the article, its supplementary materials and in the Gene Expression Omnibus (GEO) repository, [GSE103734].
Results
Development of the RAT-ChIP method
The outline of the RAT-ChIP method is depicted in Fig 1A. The whole protocol is designed to work as a single tube–one-day assay, reducing the number of necessary experimental steps, thus minimizing the loss of material. When designing the assay we aimed to use Tn5 transposase for sequencing library preparation as is used in ATAC-seq [42] and ChIPmentation method [43]. We therefore needed a method for chromatin fragmentation that would be compatible with both tagmentation and low cell numbers. Sonication is the most commonly used method chromatin fragmentation but it was not a good option in our case, as it cannot be done in small volumes using the standard equipment available in most labs. Larger volumes, in turn, lead to dilution of the material, which is undesirable when working with a small number of cells. Moreover, we wanted to avoid crosslinking, which due to harsh treatment needs to be done when using sonication, as it adds several additional steps to the protocol resulting in loss of material. We therefore turned to enzymatic digestion methods, which can be performed in considerably smaller volumes without the need for crosslinking (at least when working with histones). Micrococcal nuclease (MNase) digestion that is used in native ChIP protocols for chromatin fragmentation was in our case not optimal, as MNase digests the entire free DNA between nucleosomes resulting in inefficient adapter insertion when these nucleosomes will be used for tagging. Thus, we looked for alternative enzymatic means for chromatin digestion.
Fig. 1. RAT-ChIP enables genome wide histone modification profiling from 100 cells. A Overview of RAT-ChIP method. B Agarose gel electrophoresis of DNA after chromatin treatment with a combination of restriction enzymes (middle lane) and after tagmentation (left lane). C UCSC genome browser custom histone H3K4me3 and H3K27me3 tracks of RAT-ChIP-seq with 100 and 1,000 K562 cells in comparison with ENCODE data in a genomic region centred around IL17C gene. D Clustered global Pearson correlation heatmap (enrichments in 5kb windows) of RAT-ChIP-seq and different published histone H3K4me3 and H3K27me3 datasets in K562 cells. Restriction endonucleases have long been used for DNA footprinting to identify the locations of DNA bound proteins. They only cut at specific recognition sequences, preferably in between nucleosomes, and do not have exonuclease activity. Theoretically, even a single 4bp recognizing restriction enzyme should cut on average every 256bp but the actual cutting frequency depends on the DNA sequence and position of the nucleosomes. Nevertheless, a combination of frequently cutting restriction enzymes should allow achieving relatively even fragmentation coverage across the genome and fine enough resolution needed for histone modification profiling. We therefore tested an array of frequently cutting restriction endonucleases (S2 Table) for their ability to cut DNA in the chromatin context. All used enzymes were from Thermo Scientific FastDigest lineup, which allows for rapid 5-minute digestions. We used buffer conditions containing a low amount of non-ionic detergents that can disrupt cell and nuclear membranes but do not interfere with the enzymatic activity. Out of the 10 tested restriction endonucleases, 5 were able to cut chromatin with various efficiencies, as evidenced by the appearance of nucleosomal ladders on an agarose gel (S1A Fig). AluI and SaqAI were the most efficient cutters followed by MvaI, HinfI and BsuRI. Surprisingly, the other enzymes were not able to visibly cut the chromatin even if they were able to cut naked DNA under the same conditions (data not shown). Although the best cutting single enzymes relatively efficiently fragmented chromatin, a majority of the DNA was still too large for ChIP. We therefore cut chromatin using combinations of restriction enzymes and observed a decrease in average DNA size when more restriction endonucleases were used simultaneously (S1B Fig). Next, we tested if incubation time has an effect on fragmentation efficiency but did not see a substantial variation in DNA size between 5-, 10 - and 15-minute incubation times (S1C Fig), indicating that 5 minutes is enough to digest majority of the DNA.
Since restriction enzymes recognize specific DNA sequences we used in silico analysis to identify the genome-wide cutting sites of the used restriction endonucleases based on hg19 genome build. Using a combination of 4 restriction endonucleases (AluI, SaqAI, MvaI and HinfI), 87% of the genome was predicted to be cut into smaller pieces than 1,000bp (S2A Fig). In total there were 2,465 regions that based on the in silico analysis remained larger than 1,000 bp. Out of these 273 overlapped with gap regions (regions with no annotated sequence in the hg19 genome build), 290 overlapped with blacklisted regions (regions that have abnormally high read counts in next-generation sequencing based studies) identified by ENCODE project and 2,065 overlapped with repeat regions downloaded from UCSC table browser RepeatMasker track (S3A Table). This left with only 299 regions that did not overlap with any of the three lists (S2B Fig and S3B Table), showing that at least in silico there are only a handful of unique genomic regions that cannot be effectively fragmented using a combination of restriction endonucleases.
We also compared in silico DNA fragment sizes that would be created by cutting with the 4 restriction enzymes with experimentally determined fragment sizes after cutting with the 4 restriction enzymes followed by tagmentation and sequencing. The analysis showed that regardless of the studied genomic regions with different chromatin states defined by chromHMM, the average/median size of DNA fragments was always smaller than 176bp–indicative of even and sufficient fragmentation for ChIP (S2C Fig).
Having identified that restriction enzymes could be used for chromatin digestion we proceeded with testing the RAT-ChIP protocol. The use of enzymatic digestion enabled us to considerably downscale the sample volume so that the digestion was performed in 1μl and immunoprecipitation (IP) was performed in 11μl final volume using 1μl of magnetic beads pre-bound with an antibody against the histone modification of interest. After IP, beads were washed and tagging was performed directly on the beads. After another round of washes, the beads were used directly in PCR reaction. Skipping the decrosslinking, proteinase K treatment and DNA purification steps minimizes the loss of DNA and allows working with very low amounts of material. Even when starting with only 100 cells, we easily obtained enough material for sequencing after 16 rounds of PCR (S3A Fig). Moreover, tagging on beads further decreases the fragment size, so that the bulk RAT-ChIP library was between 200 and 500bp in size (Fig 1B, S3B Fig), which is ideal for sequencing. Initial RAT-ChIP tests using 100 and 1,000 erythroleukemic K562 cells and H3K4me3 antibody followed by qPCR showed enrichment at the promoters of housekeeping genes GAPDH and VSP29 compared to negative control regions (4th exon of ZNF7 gene and an intergenic region on chr17 (neg ctrl)) (S3C Fig) showing that using qPCR the method is capable of detecting histone modification enrichments from only 100 cells.
RAT-ChIP enables high quality genome-wide histone modification profiling from 100 cells
We next coupled our RAT-ChIP protocol with Illumina sequencing for genome-wide histone modification profiling. We used human K562 cells derived from a chronic myelogenous leukemia for which many publicly available datasets exist allowing us to compare our method with others. We used 100 and 1,000 cells and antibodies that recognize H3K4me3 or H3K27me3 to see if RAT-ChIP can be used to study both active and inactive histone marks. After paired-end sequencing the reads were mapped to hg19 genome assembly, enrichment profiles were created and visualized as custom tracks in the UCSC genome browser. Visual inspection and comparison to the corresponding ENCODE data suggested that RAT-ChIP can produce high quality profiles that look similar to ENCODE data for both histone H3K4me3 and H3K7me3 modifications (Fig 1C).
To further assess the quality of the RAT-ChIP data we compared it to several other published ChIP-seq experiments that had data available with K562 cells. These included two datasets from ENCODE, a native ChIP-seq dataset (NCHIP), as well as three datasets from low input methods (see S4 Table) [15,34,43–46]. We downloaded raw sequencing data and processed all the datasets in the same way. Comparing various parameters such as % of mapped reads, GC% and fragment size for paired-end data showed that although there is variability between the compared datasets, RAT-ChIP performed comparably to other methods (S4 Table). One parameter that, as expected, is clearly dependent on the number of cells used is the percentage of duplicated reads. In here, the low input methods had more duplicated reads ranging from 30–64% (S4 Table).
Visualization in the UCSC genome browser showed that RAT-ChIP produces similar enrichment profiles with all the studied datasets (S4 Fig). To further assess how does RAT-ChIP compare to other methods we conducted clustering based on global correlations in 5kb windows between all the datasets. Two main clusters formed according to the studied histone H3 modification (Fig 1D). Overall, the following correlations were found between H3K4me3 (r2 = 0.71–1.00) and H3K27me3 datasets (r2 = 0.43–0.93). Within the modifications, unsurprisingly, datasets from the same lab showed higher correlations and usually clustered together. Global heatmaps of H3K4me3 signals around + - 5kb region of TSSs also showed similar profiles between RAT-ChIP and published datasets (S5A Fig).
To identify how RAT-ChIP signal intensities correlate with gene expression we divided genes into 3 groups based on RPKM values of published K562 cell-line RNA-seq data [47]. Average signal intensities around + - 5kb region of TSS correlated with gene expression status in all profiled datasets, expectedly, genes with higher expression had more H3K4me3 around their TSS. One striking difference that appeared with the average signal intensity profiles around TSS was that while majority datasets displayed a lower signal around TSS, known to harbour a nucleosome free-region, RAT-ChIP data, recently published CUT&Tag datasets [46] and to a lower extent MINT-ChIP [15] showed a clear signal in this region. This difference might be caused by both biological and technical reasons. The signal at the TSS in RAT-ChIP data could be reduced if fragments in between 120–420 bp were analyzed or if input sample signal was subtracted from the IP signal but not when subtracting H3 RAT-ChIP signal (S5B Fig).
Average H3K27me3 levels in metagene plots, opposite to H3K4me3 data, negatively correlated with gene expression—in all datasets, the promoter and whole gene body had higher levels of H3K27me3 signal in genes with lower expression (S6 Fig). However, the shape of the average profiles varied from dataset to dataset. With RAT-ChIP data, the average signal was very little influenced by exclusion of small (<120) and large (>420) fragments but was markedly influenced by subtracting H3 signal and clearly over compensated when subtracting input signal (S6 Fig). These data collectively show that RAT-ChIP produces comparable H3K4me3 and H3K27me3 profiles to published data, and manages to capture the known properties of these two histone marks.
To assess the reproducibility of the method we created additional 3 replicates using 100 and 1000 K562 cells and H3K4me3 and H3K27me3 antibodies (S7 Fig). Pairwise comparison of the replicates ChIP signal in 5kb windows showed that, expectedly, there is more variation between samples with 100 cells (Pearson correlation coefficients 0.69–0.81 for H3K4me3 samples and 0.67–0.76 for H3K27me3 samples) compared to 1000 cells (Pearson correlation coefficients between 0.93–0.97 for H3K4me3 samples and 0.84–0.95 for H3K27me3 samples) (S8 Fig).
We next determined regions enriched for histone H3K4me3 using SICER and overlapped the regions between different samples (S5 Table). When one of the ENCODE datasets (UW1) was used as a reference RAT-ChIP H3K4me3 peaks overlapped with 72–73% of the reference peaks which was in the same range with Mint-ChIP (68–73%), CUT&Tag (66–74%) and NChIP (71%) but lower than with other methods with more cells (82–90%) and a replicate from the same lab (93%) (S9A Fig). This analysis shows that despite of lower overlap, low input methods are still capable of identifying majority of the enriched regions. Moreover, the regions not identified, have on average much lower signal in the original ENCODE data, suggesting that RAT-ChIP misses regions with low H3K4me3 enrichment (S9B Fig).
RAT-ChIP can identify differences in histone modification profiles between cell-lines
Having identified that RAT-ChIP-seq data from K562 cells are comparable to other published datasets we next studied if it is capable of identifying cell type specific differences in histone modification profiles. To this end we performed RAT-ChIP-seq with 100 and 1,000 cells in human non-small cell lung carcinoma cell line H1299, for which no published ChIP-seq data exist, using histone H3K4me3 and H3K27me3 antibodies. After alignment and filtering, bigwig files were created and visualized in UCSC genome browser. Visual inspection and comparison of the RAT-ChIP tracks from H1299 and K562 cells showed similar enrichment profiles at the transcriptional start sites (TSS) of genes for H3K4me3 and broad H3K27me3 domains (S10A Fig). Inspecting the loci of known hematopoietic transcription factors such as GFI1b (Fig 2A), GATA1 (S10B Fig), LMO2 (S10C Fig), ETO2 (data not shown) and entire globin locus (S11A Fig), revealed clear differences between the two cell lines. For example, in GFI1b locus there was enrichment of H3K4me3 around the TSS in K562 cells but the modification was completely absent in H1299 cells (Fig 2A). The opposite was seen with H3K27me3, where a region around GFI1b gene had clearly higher signal of H3K27me3 in H1299 cells compared to K562 cells (Fig 2A). Similar examples could be found for H1299 cell-line—several genes involved in epithelial to mesenchymal transition (EMT) such as TWIST2 and SIX1, showed elevated histone modification profile of active genes in H1299 cells (S11B and S11C Fig). Pairwise correlation and clustering analysis showed that samples clustered first according to the profiled histone modifications and within the modifications according to cell-lines (Fig 2B). To gain a more global view of the differences we identified differential H3K4me3 peaks between the two cell lines. Fig 2C shows heatmap of the signal intensities around TSS of 300 genes, which were differentially modified in one of the cell lines in contrast with 300 random genes that were not differentially modified. To see if the differentially modified regions are near functionally relevant genes we performed a GO enrichment analysis using GREAT [40]. Analysis of 500 top H3K4me3 peaks that were more enriched in one of the cell lines compared to the other revealed enrichment of hematopoiesis related terms for K562 cells and signalling related terms for H1299 cells in biological processes category (Fig 2D). Similar analysis was performed with H3K27me3 mark (S12A and S12B Fig). Regions with higher signal (2840 regions) in K562 cell line were enriched in genes associated with cellular movement associated GO terms and regions with higher signal in H1299 cells (2350 regions) were enriched in hematopoiesis related GO terms. This analysis shows that RAT-ChIP-seq can identify hundreds of tissue specific genes with different histone modification profiles between K562 and H1299 cells.
Fig. 2. RAT-ChIP can identify differences in histone modifications between cell-lines. A UCSC genome browser custom histone H3K4me3 and H3K27me3 tracks of RAT-ChIP-seq with 100 and 1,000 cells in K562 and H1299 cells. B Clustered global Pearson correlation heatmap of histone H3K4me3 and H3K27me3 datasets of K562 and H1299 cells. C Heatmap of histone H3K4me3 signal in K562 and H1299 cells in 4kb region centered around the TSS of 300 genes with either cell type specific or common signal. D Enriched terms of GREAT GO analysis of top 500 peaks differentially enriched between K562 and H1299 cells. RAT-ChIP enables histone profiling of blastocyst stage bovine embryos
Recently, our group has used bovine as a model to study the molecular events that take place during of early embryogenesis of large mammals–chromosomal instability in particular [21]. We therefore aimed to put RAT-ChIP-seq to test and profile histone H3K4me3 and H3K27me3 modifications in blastocyst stage embryos. Thus far, mouse is the only mammal, which embryos have been used for genome-wide histone profiling at such an early stage of development [16,17,20]. Using in vitro fertilized embryos, we used micromanipulator in combination with laser microdissection to separate blastocysts into inner cell mass (ICM) and trophectoderm (TE) fractions. Pooled material of three embryos was subsequently used for RAT-ChIP-seq experiments. After alignment to bosTau8 genome, bigwig tracks with enrichment profiles were created and visualized in UCSC genome browser next to recently published histone modification data from bovine embryonic stem cells (bESCs) [48]. As expected, histone H3K4me3 was enriched mostly around promoter regions while histone H3K27me3 had broad domains of enrichment as exemplified by looking at the locus centred around housekeeping gene GAPDH (S13A Fig), showing that RAT-ChIP can be used to obtain genome-wide histone modification profiles from early developmental stage embryos.
To gain more global view of how these two histone marks act in regulation of gene expression we intersected our histone modification data with published gene expression data from ICM and TE of bovine blastocysts. We found five studies where gene expression profiles of ICM and TE were compared [26–30]. Two of them used RNA–seq and two others Affymetrix microarrays. In addition, one of the studies compared in vivo and in vitro derived blastocysts, making it in total six datasets. We obtained the published lists of differentially expressed genes between ICM and TE for all the studies and intersected them. Overall, the overlap was relatively modest–there were only 6 and 0 gene(s) that were consistently upregulated in ICM and TE, respectively, in all 6 datasets. The same numbers for at least 5 overlapping datasets were 28 and 5 and for at least 3 overlapping datasets 210 and 221 for ICM and TE, respectively (S13B Fig, S6 Table). This analysis shows that there is a lot of variability and that the changes between TE and ICM at the transcriptome level are not huge at this early stage. In order to link gene expression to histone modification profiles we took the genes that were differentially expressed between ICM and TE at least in 3 datasets and profiled the average histone H3K4me3 profiles around 5kb regions around TSS and created metagene plots for H3K27me3 encompassing gene body and 3kb up and downstream of TSS and TES, respectively (Fig 3A). In ICM, both groups of genes had similar levels of H3K4me3 and H3K27me3. In trophectoderm, TE upregulated genes had higher average levels of H3K4me3 around their promoters and lower levels of H3K27me3 levels around the whole gene region compared to genes upregulated in ICM (Fig 3A), suggesting for a more pronounced epigenetic regulation. The differences seen between ICM and TE are not due to major differences in immunoprecipitation quality as both H3K4me3 and H3K27me3 average signal was clearly associated with gene expression levels in both datasets (S14A Fig).
Fig. 3. Histone H3K4me3 and H3K27me3 modification profiles of ICM and TE of blastocyst stage bovine embryos. A Average histone H3K4me3 (upper panels) and H3K27me3 (lower panels) profiles around TSS of genes that are upregulated in ICM (red line) or TE (black line) in ICM (panels on the left) and TE (panels on the right). B UCSC genome browser custom histone H3K4me3 and H3K27me3 tracks of bovine blastocyst ICM and TE in NANOG (upper) and CDX2 (lower) gene regions. The involvement of epigenetic regulation in ICM and TE specific gene expression is further supported by the analysis of average signals between pairs of corresponding gene regions (TE or ICM upregulated genes) in TE and ICM. In all cases there were statistically significant differences—ICM upregulated genes had more H3K4me3 and less H3K27me3 signal in ICM compared to TE and, vice versa, TE upregulated genes had more H3K4me3 and less H3K27me3 signal in TE compared to ICM (S14B Fig).
Although between samples the changes in histone modifications are in the expected direction, the changes are relatively modest–on a single gene level SICER managed to identify higher H3K4me3 on the TSS of 77 genes out of 210 (37%) ICM upregulated genes in ICM and on the TSS of 82 genes out of 221 (37%) for TE upregulated genes in TE. The same numbers for TSS where H3K4me3 levels were upregulated at least 2x were 17 (8%) and 12 (5.4%) for ICM and TE upregulated genes respectively (S6C and S6D Table). To identify genes, which are potentially polycomb regulated, we calculated average H3K27me3 levels for ICM and TE upregulated genes for regions spanning the whole gene plus 2kb upstream and for a region +-2kb of TSS. We identified 6 (gene+2kb upstream) and 17 (+-2kb of TSS) genes where the changes in H3K27me 3 levels were at least 4 times higher in TE compared to ICM for ICM upregulated genes and 23 (gene +2kb upstream) and 24 (+-2kb of TSS) genes where the changes in H3K27me 3 levels were at least 4 times higher in ICM compared to TE for TE upregulated genes (S6C and S6D Table).
To understand how the data can be used to learn about the epigenetic regulation of individual genes, we focused on genes known to be important in either ICM or TE specification and function. The promoter region of NANOG, a well-known pluripotency gene in embryonic stem (ES) cells was in our combined list of ICM upregulated genes and had a H3K4me3 peak in ICM but not in TE (Fig 3B). This is different from a recently published data from mouse where Nanog promoter region is enriched for H3K4me3 in both ICM and TE (S15A Fig) [20]. Another good example where we detected difference in H3K4me3 levels around the promoter region is DPPA3, although it was differentially expressed between TE and ICM in only one of the five published transcriptome studies (S15B Fig, S6B Table). In contrast, enrichment of H3K4me3 seen in ICM sample was absent from the promoter of DPPA3 gene in a recently published data with bovine embryonic stem cells (S15B Fig) [48] and was present in both ICM and TE of mouse blastocysts (S15C Fig).
Similar to DPPA3, the master regulator of TE development, CDX2 [49], was in the list of TE upregulated genes in only one of the expression datasets (S6B Table) and was enriched for H3K4me3 in both cell types. Interestingly, there was an enrichment of H3K27me3 upstream of CDX2 gene specifically in ICM. The same region came up as the first hit when BLAT alignment was performed using a sequence of the recently characterized mouse trophectoderm specific enhancer upstream of CDX2 gene [50], suggesting that CDX2 might be down regulated in ICM through Polycomb-mediated enhancer repression. These examples show that RAT-ChIP-seq data can be used for hypotheses generation to identify molecular mechanisms driving gene regulation in early embryonic development.
Discussion
We have developed a novel low input ChIP method called RAT-ChIP that can be used to create genome-wide histone modification profiles from only 100 cells. There are several important modifications to the standard protocol that enabled us to achieve successful results with such a low number of cells.
First, the use of restriction enzymes for chromatin fragmentation enabled us to keep the sample volumes small, which is essential when working with low amount of starting material. The volumes used in other published protocols, except for these that use dedicated equipment [13] not readily available, use much higher volumes. In addition, due to small volumes the reagent costs are reduced significantly. For example, in a typical ChIP experiment 30μl of magnetic beads are used compared to 1μl in RAT-ChIP. Similar to MNase, restriction enzymes only cut in between nucleosomes but in contrast to MNase they leave DNA overhangs that can be used for sequencing library generation by tagmentation using chromatin as a template. Restriction endonucleases have been used in DNA fingerprinting studies for years. More recently they have been successfully used in different chromosome conformation capture (3C) based methods to assess the 3D chromatin architecture [51]. The drawback of using restriction enzymes is that the cutting is not random. However, combining several frequently cutting enzymes enables to optimize the coverage and desired fragment size. As restriction endonucleases are sequence-specific and only cut in between nucleosomes there is no problem of over digestion. Moreover, due to the sequence specificity it is possible to predict genome-wide cutting sites. In combination of the four restriction endonucleases used in this study based on in silico analysis most of the genome is fragmented to the size suitable for ChIP. The larger fragments that remain often overlap with gaps, ENCODE project identified black regions (regions that have abnormally high number of reads in next generation sequencing data) or repeats that are difficult to analyze. Moreover, the larger regions that can cause false positive signals can be identified in silico and removed from further analysis. A recently published method called RELACS also used a similar approach to us showing that restriction endonucleases can be used for chromatin fragmentation in ChIP assays [52].
Second–minimization of steps where material could be lost, such as centrifugations and DNA extractions. This was achieved by omitting several steps in regular ChIP protocols such as crosslinking and proteinase K treatment. All steps in a protocol are carried out in a single tube so that the first DNA purification occurs only after PCR, when loss of material is not anymore an issue.
Third—simple, one step library preparation. We adapted the first step of library generation step from the ChIPmentation method. In addition, being extremely simple and cost effective, due to the random nature of tagmentation it allows to further decrease DNA size, so that majority of the fragments in the final library come from single nucleosomes. In contrast to ChIPmentation, we performed PCR directly on magnetic beads using the bound chromatin as a template, similar to recently published high-throughput ChIPmentation [53] and lobChIP [54]. Skipping DNA purification avoids loss of material. The method is also very fast taking less than a day to complete. Recently, several methods–CUT&RUN, CUT&Tag, ChIL–seq, scChIC-seq and CoBATCH have been published that look really promising, as they have been shown to be able to obtain data from single cells [46,55–59].
Using K562 cells, we showed that the histone H3K4me3 and H3K27me3 profiles created using RAT-ChIP compare well to other published datasets, demonstrating that it can be used to profile chromatin marks associated with both active and inactive genes. One difference we observed in RAT-ChIP H3K4me3 data compared to regular ChIP datasets was a prominent signal exactly at TSS. Even higher signal in this region was also seen in CUT&Tag H3K4me3 data, but not in ChIPmentation data both of which use Tn5 transposase. To a lesser extent, the signal was also present in H3K4me3 Mint-ChIP data. All the three methods that display the peak do not use crosslinking and use mild conditions for chromatin fragmentation. In case of expressed genes, the region surrounding TSS is more accessible and usually considered to be depleted of nucleosomes [60]. Therefore, part of the signal definitely comes from higher accessibility. We do see a signal in this region if we prepare input samples by tagging restriction enzyme digested chromatin within cell nuclei. However, the input prepared this way resembles ATAC-seq and is not ideal control as in case of RAT-ChIP the tagging takes place on beads after chromatin precipitation. The fact that the signal is still present after exclusion of small fragments (<120bp) suggests that this region might contain histone proteins that are not detectable with regular ChIP assays. Indeed, several papers have reported for the presence of MNase sensitive -1 nucleosome [61–64]. Our data agree with these reports and suggests that this nucleosome is H3K4me3 methylated.
One issue that arises with ChIP methods that use on-bead tagmentation is what kind of control samples to use, as input cannot be treated the same manner as immunoprecipitation samples. In our case, tagging input samples in intact nuclei right after restriction enzyme treatment creates a profile that resembles ATAC-seq data and tagging after DNA extraction misses the accessibility created bias. Tagmentation method, has opted for the use of IgG controls, however, IgG samples are not considered the best controls for sequencing based approaches [65]. Because of the low amount of starting material we failed to obtain good quality libraries with IgG samples. Another option is to use immunoprecipitation with H3 antibody as a control since these samples are treated identical to the samples of interest and give more even coverage compared to IgG. It has been shown that using INPUT or H3 pull-down as a reference has small differences with a negligible impact on the quality of a standard analysis [66]. Moreover, several reports have shown that using an input has a little if any advantage over not using an input [67–70]. Some studies imply that they do even worse and should be used only for peak prioritization [71]. The benefits or caveats of using input are probably case specific. For example, for pairwise comparison of samples to find regions with differential enrichments, input is not crucial, as biases present in both samples should cancel each other out. More care should be taken when quantitative statements are being made about the amounts of modifications. In this case even proper input might not be sufficient and using spike-ins should be considered if global changes in histone modification patterns are excepted [72,73]. Considering the above, we recommend using immunoprecipitation with H3 as the first choice for a control sample. Moreover, analysis should be done with and without using a control and attention should be paid when the regions of interest show differences depending on the analysis. In this case, an alternative method should be used to verify the results.
Replication experiments showed that RAT-ChIP can constantly obtain data from as few as 100 cells, however there is more experimental variation with such a low number of cells and thus replicates are especially important to make biologically valid conclusions.
By profiling histone H3K4me3 and H3K27me3 modifications in H1299 cells and comparing it to the data from K562 cells we showed that RAT-ChIP can identify epigenetic differences between cell lines.
We also showed that RAT-ChIP works on small numbers of primary cells by applying it to blastocyst stage bovine embryos. In addition to the vast potential bovine has in farming and biomedicine, it also serves as a good model system to study the molecular events that take place during early embryogenesis as its development is more similar to human compared to other common model organisms such as mouse [74]. Majority of the epigenetics experiments, genome-wide studies in particular, have been performed in mouse. Using RAT-ChIP we have created the first genome wide histone H3K4me3 and H3K27me3 modification profiles of ICM and TE of blastocyst stage bovine embryos. Considering that day 7–8 embryos consist on average about 125 cells (80 in TE and 45 in ICM) [45,46] and we used material from 3 pooled embryos for 2 ChIPs, only 70–120 cells were used per one immunoprecipitation.
Combined analysis of our histone modification data with lists of ICM and TE upregulated genes from published papers showed that gene expression changes are on average reflected by expected changes in histone modifications. The average differences in H3K4me3 levels are more pronounced in regions adjacent to TSS, especially downstream. This is in agreement with several recent reports that have associated breadth of H3K4me3 domains with cell identity and transcriptional activity [20,75]. Due to several reasons, however, such as low levels of enrichment in some regions, not completely pure cell populations, cellular heterogeneity and biological similarity, the changes at epigenetic level are not huge between ICM and TE. Nevertheless, looking at the histone modification profiles of factors with known importance either in ICM or TE function we could see evidence for the involvement of epigenetics in gene regulation. For example, a well-known pluripotency factor NANOG TSS had H3K4me3 only in ICM but not in TE. Similarly, it was shown recently that there is loss of H3K4me3 on NANOG gene upon human embryonal carcinoma NT2/D1 cell differentiation towards neural progenitors [76]. This is different from mouse blastocysts where the whole Nanog gene is covered with H3K4me3 both in ICM and TE (S15A Fig) [20]. Similarly, there were no differences in H3K4me3 signal at the promoter of DPP3A gene between ICM and TE in the mouse data, while our bovine data showed a signal only in ICM. This is again different from a recently published bES cell data where the promoter region of DPP3A was devoid of H3K4me3. DPP3A has a known conserved function of protecting the female genome from TET3 activity, it has role in pluripotency maintenance and reprogramming [77] and has been shown to be essential for bovine embryonic development [78]. The observed differences might be explained by locus specificity, timing, cell-type, cell purity used in ChIP experiments, or interspecies differences. Indeed, it was shown recently that there are interspecies differences upon ablation of OCT4 gene between mouse and human, including the regulation of NANOG gene expression [79]. There are also several examples of differentially regulated genes between ICM and ES cells [80]. These examples show that there are important cell type and interspecies differences that need to be taken into account when drawing conclusions about the regulation of specific genes.
At the moment we have tested RAT-ChIP only with histone modifications. It remains to be studied if it could be also used to profile other chromatin bound proteins, including transcription factors. As the interaction of transcription factors is in general more labile, crosslinking step is usually used in ChIP. However, there is a recent protocol called ORGANIC ChIP, which demonstrated that transcription factors can be also immunoprecipitated without the need for crosslinking [81]. Moreover, recent CUT&RUN and CUT&Tag methods do not use crosslinking and work with transcription factors [46,55,56].
With the publication of several novel ultra-low input ChIP methods it is important to note that each method has its own characteristics, using small amount of material inevitably creates more variability and thus direct comparison of results obtained with different methods can be complicated. For example, Tn5 transposase based methods can be influenced by chromatin accessibility and correction for this bias with input is not always straightforward. Therefore, to confirm biological significance, replicate experiments are crucial and results obtained with one method should be repeatable by a different method.
In summary, we have developed a novel simple yet sensitive RAT-ChIP method that it can be used to study genome-wide histone modifications from less than 100 cells. Using the new method we have created the first genome wide histone H3K4me3 and H3K27me3 profiles in blastocyst stage bovine embryos that serve as a resource for further studies.
Supporting information
S1 Fig [pdf]
Restriction enzymes can be used for chromatin fragmentation.S2 Fig [pdf]
analysis of fragment sizes produced by 4 restriction enzymes in hg19 genome assembly.S3 Fig [pdf]
RAT-ChIP can identify histone H3K4me3 modification enrichments from 100 cells.S4 Fig [pdf]
RAT-ChIP enrichment profiles compared to other publicly available datasets.S5 Fig [pdf]
RAT-ChIP enrichment profiles compared to other publicly available datasets.S6 Fig [pdf]
RAT-ChIP enrichment profiles compared to other publicly available datasets.S7 Fig [pdf]
RAT-ChIP enrichment profiles of 4 replicate experiments.S8 Fig [a]
Correlation analysis of replicate RAT-ChIP experiments.S9 Fig [pdf]
RAT-ChIP H3K4me3 peak comparison with published datasets.S10 Fig [a]
RAT-ChIP can identify cell type specific histone profile differences.S11 Fig [a]
RAT-ChIP can identify cell type specific histone profile differences.S12 Fig [pdf]
RAT-ChIP can identify differences in histone modifications between cell-lines.S13 Fig [left]
RAT-ChIP can identify histone H3K4me3 and H3K27me3 modification profiles from bovine blastocysts.S14 Fig [pdf]
RAT-ChIP H3K4me3 and H3K27me3 enrichment profiles in bovine ICM and TE correlate with gene expression.S15 Fig [pdf]
RAT-ChIP data from bovine ICM and TE enables identification of cell type and species-specific differences in histone modifications.S1 File [pdf]
RAT-ChIP-seq protocol.S1 Table [xlsx]
List of selected low input ChIP-seq methods.S2 Table [xlsx]
List of tested Thermo Scientific FastDigest restriction endonucleases.S3 Table [xlsx]
List of regions larger than 1kb after restriction.S4 Table [xlsx]
Statistics and quality parameters of RAT-ChIP-seq and reanalyzed ChIP-seq datasets in K562 cells.S5 Table [xlsx]
Number and overlap of H3K4me3 peaks of RAT-ChIP-seq and reanalyzed ChIP-seq datasets in K562 cells.S6 Table [xlsx]
Integration of RAT-ChIP and published expression data of bovine ICM and TE.
Zdroje
1. Park PJ. ChIP-seq: advantages and challenges of a maturing technology. Nat. Rev. Genet. 2009;10 : 669–80. doi: 10.1038/nrg2641 19736561
2. Schmidt D, Wilson MD, Spyrou C, Brown GD, Hadfield J, Odom DT. ChIP-seq: Using high-throughput sequencing to discover protein?DNA interactions. Methods. 2009;48 : 240–8. doi: 10.1016/j.ymeth.2009.03.001 19275939
3. Mikkelsen TS, Ku M, Jaffe DB, Issac B, Lieberman E, Giannoukos G, et al. Genome-wide maps of chromatin state in pluripotent and lineage-committed cells. Nature. 2007;448 : 553–60. doi: 10.1038/nature06008 17603471
4. Heintzman ND, Hon GC, Hawkins RD, Kheradpour P, Stark A, Harp LF, et al. Histone modifications at human enhancers reflect global cell-type-specific gene expression. Nature. 2009;459 : 108–12. doi: 10.1038/nature07829 19295514
5. Adli M, Zhu J, Bernstein BE. Genome-wide chromatin maps derived from limited numbers of hematopoietic progenitors. Nat. Methods. 2010;7 : 615–8. doi: 10.1038/nmeth.1478 20622861
6. Shankaranarayanan P, Mendoza-Parra M-A, Walia M, Wang L, Li N, Trindade LM, et al. Single-tube linear DNA amplification (LinDA) for robust ChIP-seq. Nat. Methods. 2011;8 : 565–7. doi: 10.1038/nmeth.1626 21642965
7. Zwart W, Koornstra R, Wesseling J, Rutgers E, Linn S, Carroll JS. A carrier-assisted ChIP-seq method for estrogen receptor-chromatin interactions from breast cancer core needle biopsy samples. BMC Genomics. 2013;14 : 232. doi: 10.1186/1471-2164-14-232 23565824
8. Ng J-H, Kumar V, Muratani M, Kraus P, Yeo J-C, Yaw L-P, et al. In Vivo Epigenomic Profiling of Germ Cells Reveals Germ Cell Molecular Signatures. Dev. Cell. 2013;24 : 324–33. doi: 10.1016/j.devcel.2012.12.011 23352811
9. Lara-Astiaso D, Weiner A, Lorenzo-Vivas E, Zaretsky I, Jaitin DA, David E, et al. Chromatin state dynamics during blood formation. Science (80-). 2014;345 : 943–9.
10. Brind’Amour J, Liu S, Hudson M, Chen C, Karimi MM, Lorincz MC. An ultra-low-input native ChIP-seq protocol for genome-wide profiling of rare cell populations. Nat. Commun. 2015;6 : 6033. doi: 10.1038/ncomms7033 25607992
11. Schmidl C, Rendeiro AF, Sheffield NC, Bock C. ChIPmentation: fast, robust, low-input ChIP-seq for histones and transcription factors. Nat. Methods. 2015;12 : 963–5. doi: 10.1038/nmeth.3542 26280331
12. Zheng X, Yue S, Chen H, Weber B, Jia J, Zheng Y. Low-Cell-Number Epigenome Profiling Aids the Study of Lens Aging and Hematopoiesis. Cell Rep. 2015;13 : 1505–18. doi: 10.1016/j.celrep.2015.10.004 26549448
13. Cao Z, Chen C, He B, Tan K, Lu C. A microfluidic device for epigenomic profiling using 100 cells. Nat. Methods. 2015;12 : 959–62. doi: 10.1038/nmeth.3488 26214128
14. Rotem A, Ram O, Shoresh N, Sperling RA, Goren A, Weitz DA, et al. Single-cell ChIP-seq reveals cell subpopulations defined by chromatin state. Nat. Biotechnol. 2015;33 : 1165–72. doi: 10.1038/nbt.3383 26458175
15. van Galen P, Viny AD, Ram O, Ryan RJH, Cotton MJ, Donohue L, et al. A Multiplexed System for Quantitative Comparisons of Chromatin Landscapes. Mol. Cell. 2016;61 : 170–80. doi: 10.1016/j.molcel.2015.11.003 26687680
16. Zhang B, Zheng H, Huang B, Li W, Xiang Y, Peng X, et al. Allelic reprogramming of the histone modification H3K4me3 in early mammalian development. Nature. 2016;537 : 553–7. doi: 10.1038/nature19361 27626382
17. Dahl JA, Jung I, Aanes H, Greggains GD, Manaf A, Lerdrup M, et al. Broad histone H3K4me3 domains in mouse oocytes modulate maternal-to-zygotic transition. Nature. 2016;537 : 548–52. doi: 10.1038/nature19360 27626377
18. Skene PJ, Henikoff JG, Henikoff S. Targeted in situ genome-wide profiling with high efficiency for low cell numbers. Nat. Protoc. Nature Publishing Group; 2018;13 : 1006–19. doi: 10.1038/nprot.2018.015 29651053
19. Valensisi C, Liao JL, Andrus C, Battle SL, Hawkins RD. cChIP-seq: a robust small-scale method for investigation of histone modifications. BMC Genomics. BioMed Central; 2015;16 : 1083. doi: 10.1186/s12864-015-2285-7 26692029
20. Liu X, Wang C, Liu W, Li J, Li C, Kou X, et al. Distinct features of H3K4me3 and H3K27me3 chromatin domains in pre-implantation embryos. Nature. 2016;537 : 558–62. doi: 10.1038/nature19362 27626379
21. Destouni A, Zamani Esteki M, Catteeuw M, Tšuiko O, Dimitriadou E, Smits K, et al. Zygotes segregate entire parental genomes in distinct blastomere lineages causing cleavage-stage chimerism and mixoploidy. Genome Res. 2016;26 : 567–78. doi: 10.1101/gr.200527.115 27197242
22. Buenrostro JD, Giresi PG, Zaba LC, Chang HY, Greenleaf WJ. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat. Methods. 2013;10 : 1213–8. doi: 10.1038/nmeth.2688 24097267
23. Ernst J, Kheradpour P, Mikkelsen TS, Shoresh N, Ward LD, Epstein CB, et al. Mapping and analysis of chromatin state dynamics in nine human cell types. Nature. 2011;473 : 43–9. doi: 10.1038/nature09906 21441907
24. Kent WJ, Sugnet CW, Furey TS, Roskin KM, Pringle TH, Zahler AM, et al. The human genome browser at UCSC. Genome Res. 2002;12 : 996–1006. doi: 10.1101/gr.229102 12045153
25. García-Alcalde F, Okonechnikov K, Carbonell J, Cruz LM, Götz S, Tarazona S, et al. Qualimap: evaluating next-generation sequencing alignment data. Bioinformatics. 2012;28 : 2678–9. doi: 10.1093/bioinformatics/bts503 22914218
26. Ozawa M, Sakatani M, Yao J, Shanker S, Yu F, Yamashita R, et al. Global gene expression of the inner cell mass and trophectoderm of the bovine blastocyst. BMC Dev. Biol. 2012;12 : 33. doi: 10.1186/1471-213X-12-33 23126590
27. Brinkhof B, van Tol HT, Groot Koerkamp MJ, Riemers FM, IJzer SG, Mashayekhi K, et al. A mRNA landscape of bovine embryos after standard and MAPK-inhibited culture conditions: a comparative analysis. BMC Genomics. 2015;16 : 277. doi: 10.1186/s12864-015-1448-x 25888366
28. Nagatomo H, Akizawa H, Sada A, Kishi Y, Yamanaka K, Takuma T, et al. Comparing spatial expression dynamics of bovine blastocyst under three different procedures: in-vivo, in-vitro derived, and somatic cell nuclear transfer embryos. Jpn. J. Vet. Res. 2015;63 : 159–71. 26753242
29. Zhao X-M, Cui L-S, Hao H-S, Wang H-Y, Zhao S-J, Du W-H, et al. Transcriptome analyses of inner cell mass and trophectoderm cells isolated by magnetic-activated cell sorting from bovine blastocysts using single cell RNA-seq. Reprod. Domest. Anim. 2016;51 : 726–35. doi: 10.1111/rda.12737 27440443
30. Hosseini SM, Dufort I, Caballero J, Moulavi F, Ghanaei HR, Sirard MA. Transcriptome profiling of bovine inner cell mass and trophectoderm derived from in vivo generated blastocysts. BMC Dev. Biol. 2015;15 : 49. doi: 10.1186/s12861-015-0096-3 26681441
31. Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat. Methods. 2012;9 : 357–9. doi: 10.1038/nmeth.1923 22388286
32. Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, et al. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 2009;25 : 2078–9. doi: 10.1093/bioinformatics/btp352 19505943
33. Ramírez F, Ryan DP, Grüning B, Bhardwaj V, Kilpert F, Richter AS, et al. deepTools2: a next generation web server for deep-sequencing data analysis. Nucleic Acids Res. 2016;44:W160–5. doi: 10.1093/nar/gkw257 27079975
34. Dunham I, Kundaje A, Aldred SF, Collins PJ, Davis CA, Doyle F, et al. An integrated encyclopedia of DNA elements in the human genome. Nature. 2012;489 : 57–74. doi: 10.1038/nature11247 22955616
35. Xu S, Grullon S, Ge K, Peng W. Spatial clustering for identification of ChIP-enriched regions (SICER) to map regions of histone methylation patterns in embryonic stem cells. Methods Mol. Biol. 2014;1150 : 97–111. doi: 10.1007/978-1-4939-0512-6_5 24743992
36. Quinlan AR, Hall IM. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics. Narnia; 2010;26 : 841–2. doi: 10.1093/bioinformatics/btq033 20110278
37. Liu T, Ortiz JA, Taing L, Meyer CA, Lee B, Zhang Y, et al. Cistrome: an integrative platform for transcriptional regulation studies. Genome Biol. 2011;12:R83. doi: 10.1186/gb-2011-12-8-r83 21859476
38. Blankenberg D, Von Kuster G, Coraor N, Ananda G, Lazarus R, Mangan M, et al. Galaxy: a web-based genome analysis tool for experimentalists. Curr. Protoc. Mol. Biol. 2010;Chapter 19:Unit 19.10.1–21.
39. Pohl A, Beato M. bwtool: a tool for bigWig files. Bioinformatics. Oxford University Press; 2014;30 : 1618–9. doi: 10.1093/bioinformatics/btu056 24489365
40. McLean CY, Bristor D, Hiller M, Clarke SL, Schaar BT, Lowe CB, et al. GREAT improves functional interpretation of cis-regulatory regions. Nat. Biotechnol. 2010;28 : 495–501. doi: 10.1038/nbt.1630 20436461
41. Heberle H, Meirelles GV, da Silva FR, Telles GP, Minghim R. InteractiVenn: a web-based tool for the analysis of sets through Venn diagrams. BMC Bioinformatics. BioMed Central; 2015;16 : 169. doi: 10.1186/s12859-015-0611-3 25994840
42. Buenrostro JD, Giresi PG, Zaba LC, Chang HY, Greenleaf WJ. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat. Methods. 2013;10 : 1213–8. doi: 10.1038/nmeth.2688 24097267
43. Schmidl C, Rendeiro AF, Sheffield NC, Bock C. ChIPmentation: fast, robust, low-input ChIP-seq for histones and transcription factors. Nat. Methods. 2015;
44. Thurman RE, Rynes E, Humbert R, Vierstra J, Maurano MT, Haugen E, et al. The accessible chromatin landscape of the human genome. Nature. 2012;489 : 75–82. doi: 10.1038/nature11232 22955617
45. Mercer TR, Edwards SL, Clark MB, Neph SJ, Wang H, Stergachis AB, et al. DNase I-hypersensitive exons colocalize with promoters and distal regulatory elements. Nat. Genet. 2013;45 : 852–9. doi: 10.1038/ng.2677 23793028
46. Kaya-Okur HS, Wu SJ, Codomo CA, Pledger ES, Bryson TD, Henikoff JG, et al. CUT&Tag for efficient epigenomic profiling of small samples and single cells. Nat. Commun. Nature Publishing Group; 2019;10 : 1930. doi: 10.1038/s41467-019-09982-5 31036827
47. Frank CL, Manandhar D, Gordân R, Crawford GE. HDAC inhibitors cause site-specific chromatin remodeling at PU.1-bound enhancers in K562 cells. Epigenetics Chromatin. 2016;9 : 15. doi: 10.1186/s13072-016-0065-5 27087856
48. Bogliotti YS, Wu J, Vilarino M, Okamura D, Soto DA, Zhong C, et al. Efficient derivation of stable primed pluripotent embryonic stem cells from bovine blastocysts. Proc. Natl. Acad. Sci. 2018;115 : 2090–5. doi: 10.1073/pnas.1716161115 29440377
49. Strumpf D, Mao C-A, Yamanaka Y, Ralston A, Chawengsaksophak K, Beck F, et al. Cdx2 is required for correct cell fate specification and differentiation of trophectoderm in the mouse blastocyst. Development. 2005;132 : 2093–102. doi: 10.1242/dev.01801 15788452
50. Rayon T, Menchero S, Nieto A, Xenopoulos P, Crespo M, Cockburn K, et al. Notch and hippo converge on Cdx2 to specify the trophectoderm lineage in the mouse blastocyst. Dev. Cell. NIH Public Access; 2014;30 : 410–22.
51. Davies JOJ, Oudelaar AM, Higgs DR, Hughes JR. How best to identify chromosomal interactions: a comparison of approaches. Nat. Methods. 2017;14 : 125–34. doi: 10.1038/nmeth.4146 28139673
52. Arrigoni L, Al-Hasani H, Ramírez F, Panzeri I, Ryan DP, Santacruz D, et al. RELACS nuclei barcoding enables high-throughput ChIP-seq. Commun. Biol. Nature Publishing Group; 2018;1 : 214. doi: 10.1038/s42003-018-0219-z 30534606
53. Gustafsson C, De Paepe A, Schmidl C, Månsson R. High-throughput ChIPmentation: freely scalable, single day ChIPseq data generation from very low cell-numbers. BMC Genomics. 2019;20 : 59. doi: 10.1186/s12864-018-5299-0 30658577
54. Wallerman O, Nord H, Bysani M, Borghini L, Wadelius C. lobChIP: from cells to sequencing ready ChIP libraries in a single day. Epigenetics Chromatin. BioMed Central; 2015;8 : 25. doi: 10.1186/s13072-015-0017-5 26195988
55. Hainer SJ, Fazzio TG. High-Resolution Chromatin Profiling Using CUT&RUN. Curr. Protoc. Mol. Biol. 2019;e85. doi: 10.1002/cpmb.85 30688406
56. Hainer SJ, Bošković A, McCannell KN, Rando OJ, Fazzio TG. Profiling of Pluripotency Factors in Single Cells and Early Embryos. Cell. Cell Press; 2019;177 : 1319–1329.e11.
57. Ku WL, Nakamura K, Gao W, Cui K, Hu G, Tang Q, et al. Single-cell chromatin immunocleavage sequencing (scChIC-seq) to profile histone modification. Nat. Methods. 2019;16 : 323–5. doi: 10.1038/s41592-019-0361-7 30923384
58. Wang Q, Xiong H, Ai S, Yu X, Liu Y, Zhang J, et al. CoBATCH for High-Throughput Single-Cell Epigenomic Profiling. Mol. Cell. Cell Press; 2019;
59. Harada A, Maehara K, Handa T, Arimura Y, Nogami J, Hayashi-Takanaka Y, et al. A chromatin integration labelling method enables epigenomic profiling with lower input. Nat. Cell Biol. 2019;21 : 287–96. doi: 10.1038/s41556-018-0248-3 30532068
60. Hughes AL, Rando OJ. Mechanisms Underlying Nucleosome Positioning In Vivo. Annu. Rev. Biophys. 2014;43 : 41–63. doi: 10.1146/annurev-biophys-051013-023114 24702039
61. Kubik S, Bruzzone MJ, Jacquet P, Falcone J-L, Rougemont J, Shore D. Nucleosome Stability Distinguishes Two Different Promoter Types at All Protein-Coding Genes in Yeast. Mol. Cell. 2015;60 : 422–34. doi: 10.1016/j.molcel.2015.10.002 26545077
62. Voong LN, Xi L, Sebeson AC, Xiong B, Wang J-P, Wang X. Insights into Nucleosome Organization in Mouse Embryonic Stem Cells through Chemical Mapping. Cell. Cell Press; 2016;167 : 1555–1570.e15.
63. Ramani V, Qiu R, Shendure J. High Sensitivity Profiling of Chromatin Structure by MNase-SSP. Cell Rep. Cell Press; 2019;26 : 2465–2476.e4. doi: 10.1016/j.celrep.2019.02.007 30811994
64. Brahma S, Henikoff S. RSC-Associated Subnucleosomes Define MNase-Sensitive Promoters in Yeast. Mol. Cell. Elsevier; 2019;73 : 238–249.e3. doi: 10.1016/j.molcel.2018.10.046 30554944
65. Kidder BL, Hu G, Zhao K. ChIP-Seq: technical considerations for obtaining high-quality data. Nat. Immunol. 2011;12 : 918–22. doi: 10.1038/ni.2117 21934668
66. Flensburg C, Kinkel SA, Keniry A, Blewitt ME, Oshlack A. A comparison of control samples for ChIP-seq of histone modifications. Front. Genet. 2014;5.
67. Zhang Y-F, Su B. Peak identification for ChIP-seq data with no controls. Dong wu xue yan jiu = Zool. Res. 2012;33:E121–8. doi: 10.3724/SP.J.1141.2012.E120-06E121 23266983
68. Cheung M-S, Down TA, Latorre I, Ahringer J. Systematic bias in high-throughput sequencing data and its correction by BEADS. Nucleic Acids Res. Oxford University Press; 2011;39:e103–e103. doi: 10.1093/nar/gkr425 21646344
69. de Boer BA, van Duijvenboden K, van den Boogaard M, Christoffels VM, Barnett P, Ruijter JM. OccuPeak: ChIP-Seq Peak Calling Based on Internal Background Modelling. Langmann T, editor. PLoS One. Public Library of Science; 2014;9:e99844. doi: 10.1371/journal.pone.0099844 24936875
70. Szalkowski AM, Schmid CD. Rapid innovation in ChIP-seq peak-calling algorithms is outdistancing benchmarking efforts. Brief. Bioinform. Oxford University Press; 2011;12 : 626–33. doi: 10.1093/bib/bbq068 21059603
71. Thomas R, Thomas S, Holloway AK, Pollard KS. Features that define the best ChIP-seq peak calling algorithms. Brief. Bioinform. 2016;18:bbw035.
72. Chen K, Hu Z, Xia Z, Zhao D, Li W, Tyler JK. The Overlooked Fact: Fundamental Need for Spike-In Control for Virtually All Genome-Wide Analyses. Mol. Cell. Biol. American Society for Microbiology (ASM); 2016;36 : 662.
73. Egan B, Yuan C-C, Craske ML, Labhart P, Guler GD, Arnott D, et al. An Alternative Approach to ChIP-Seq Normalization Enables Detection of Genome-Wide Changes in Histone H3 Lysine 27 Trimethylation upon EZH2 Inhibition. PLoS One. Public Library of Science; 2016;11:e0166438. doi: 10.1371/journal.pone.0166438 27875550
74. Santos RR, Schoevers EJ, Roelen BAJ. Usefulness of bovine and porcine IVM/IVF models for reproductive toxicology. Reprod. Biol. Endocrinol. BioMed Central; 2014;12 : 117. doi: 10.1186/1477-7827-12-117 25427762
75. Benayoun BA, Pollina EA, Ucar D, Mahmoudi S, Karra K, Wong ED, et al. H3K4me3 breadth is linked to cell identity and transcriptional consistency. Cell. NIH Public Access; 2014;158 : 673–88. doi: 10.1016/j.cell.2014.06.027 25083876
76. Topalovic V, Schwirtlich M, Stevanovic M, Mojsin M. Histone modifications on the promoters of human OCT4 and NANOG genes at the onset of neural differentiation of NT2/D1 cells. Biochem. 2017;82 : 715–22.
77. Zhao S, Xu J, Liu S, Cui K, Li Z, Liu N. Dppa3 in pluripotency maintenance of ES cells and early embryogenesis. J. Cell. Biochem. 2019;120 : 4794–9. doi: 10.1002/jcb.28063 30417435
78. Bakhtari A, Ross PJ. DPPA3 prevents cytosine hydroxymethylation of the maternal pronucleus and is required for normal development in bovine embryos. Epigenetics. 2014;9 : 1271–9. doi: 10.4161/epi.32087 25147917
79. Fogarty NME, McCarthy A, Snijders KE, Powell BE, Kubikova N, Blakeley P, et al. Genome editing reveals a role for OCT4 in human embryogenesis. Nature. Nature Research; 2017;550 : 67–73. doi: 10.1038/nature24033 28953884
80. Tang F, Barbacioru C, Bao S, Lee C, Nordman E, Wang X, et al. Tracing the derivation of embryonic stem cells from the inner cell mass by single-cell RNA-Seq analysis. Cell Stem Cell. Elsevier; 2010;6 : 468–78. doi: 10.1016/j.stem.2010.03.015 20452321
81. Kasinathan S, Orsi GA, Zentner GE, Ahmad K, Henikoff S. High-resolution mapping of transcription factor binding sites on native chromatin. Nat. Methods. 2014;11 : 203–9. doi: 10.1038/nmeth.2766 24336359
Článek A study of psychological pain in substance use disorder and its relationship to treatment outcomeČlánek Addiction of mesenchymal phenotypes on the FGF/FGFR axis in oral squamous cell carcinoma cellsČlánek Protocol development for discovery of angiogenesis inhibitors via automated methods using zebrafishČlánek Temporal weights in loudness: Investigation of the effects of background noise and sound levelČlánek Isolation and identification of an isoflavone reducing bacterium from feces from a pregnant horseČlánek The bacterial community in potato is recruited from soil and partly inherited across generationsČlánek Infective endocarditis and diabetes mellitus: Results from a single-center study from 1994 to 2017Článek The trajectory of patterns of light and sedentary physical activity among females, ages 14-23Článek Estimation of maize evapotraspiration under drought stress - A case study of Huaibei Plain, ChinaČlánek Honey bee microbiome associated with different hive and sample types over a honey production seasonČlánek Incidence of colorectal cancer in Eritrea: Data from the National Health Laboratory, 2011-2017Článek Factors influencing bird-building collisions in the downtown area of a major North American cityČlánek Decreased retinal thickness in patients with Alzheimer’s disease is correlated with disease severityČlánek Moving system with action sport cameras: 3D kinematics of the walking and running in a large volumeČlánek High heat tolerance in plants from the Andean highlands: Implications for paramos in a warmer worldČlánek Impacts of risk and competition on the profitability of banks: Empirical evidence from PakistanČlánek Tributyltin chloride (TBT) induces RXRA down-regulation and lipid accumulation in human liver cellsČlánek Differences in clinical features of cluster headache between drinkers and nondrinkers in JapanČlánek Polo-like kinase 1 (Plk1) inhibition synergizes with taxanes in triple negative breast cancerČlánek Genome-wide SNP analyses reveal population structure of Portunus pelagicus along Vietnam coastlineČlánek Manipulating the odds: The effects of Machiavellianism and construal level on cheating behaviorČlánek Primary care in five European countries: A citizens’ perspective on the quality of care for childrenČlánek Overcoming platinum resistance in ovarian cancer by targeting pregnancy-associated plasma protein-AČlánek Capacity of the medullary cavity of tibia and femur for intra-bone marrow transplantation in miceČlánek Phylogenetic revision of Gymnotidae (Teleostei: Gymnotiformes), with descriptions of six subgeneraČlánek Hidden noise in immunologic parameters might explain rapid progression in early-onset periodontitisČlánek Identification of a novel monocytic phenotype in Classic Hodgkin Lymphoma tumor microenvironmentČlánek Binding and dynamics of melatonin at the interface of phosphatidylcholine-cholesterol membranesČlánek Retinoic acid-stimulated ERK1/2 pathway regulates meiotic initiation in cultured fetal germ cellsČlánek Gender disparities in scientific production: A nationwide assessment among physicians in PeruČlánek Study on the damage characteristics of gas-bearing shale under different unloading stress pathsČlánek Association of clinical factors with survival outcomes in laryngeal squamous cell carcinoma (LSCC)Článek Population preferences for breast cancer screening policies: Discrete choice experiment in BelarusČlánek Appropriate management of acute gastroenteritis in Australian children: A population-based studyČlánek More than just availability: Who has access and who administers take-home naloxone in Baltimore, MDČlánek Protein synthesis rates of muscle, tendon, ligament, cartilage, and bone tissue in vivo in humansČlánek Molecular characterisation of genital human papillomavirus among women in Southwestern, NigeriaČlánek Gene expression microarray public dataset reanalysis in chronic obstructive pulmonary diseaseČlánek Utility of the new cobas HCV test for viral load monitoring during direct-acting antiviral therapyČlánek Whole body periodic acceleration in normal and reduced mucociliary clearance of conscious sheepČlánek Minimal effects of oyster aquaculture on local water quality: Examples from southern Chesapeake BayČlánek Finding phrases: On the role of co-verbal facial information in learning word order in infancyČlánek Yeasts affect tolerance of Drosophila melanogaster to food substrate with high NaCl concentrationČlánek The effect of climate change on cholera disease: The road ahead using artificial neural networkČlánek Adaptive fuzzy flow rate control considering multifractal traffic modeling and 5G communicationsČlánek UM171 induces a homeostatic inflammatory-detoxification response supporting human HSC self-renewalČlánek Vaccine cold chain in general practices: A prospective study in 75 refrigerators (Keep Cool study)Článek Artificial insemination with fresh, liquid stored and frozen thawed semen in dromedary camelsČlánek Mammary microbiome of lactating organic dairy cows varies by time, tissue site, and infection statusČlánek An outbreak of tuberculosis in a middle school in Henan, China: Epidemiology and risk factorsČlánek Impact of UVC-sustained recirculating air filtration on airborne bacteria and dust in a pig facilityČlánek Pre-clinical medical student reflections on implicit bias: Implications for learning and teachingČlánek Foxtail millet (Setaria italica (L.) P. Beauv) CIPKs are responsive to ABA and abiotic stressesČlánek Calreticulin regulates vascular endothelial growth factor-A mRNA stability in gastric cancer cellsČlánek The association between haemoglobin levels in the first 20 weeks of pregnancy and pregnancy outcomesČlánek Factors associated with persistently high-cost health care utilization for musculoskeletal painČlánek Why men with a low-risk prostate cancer select and stay on active surveillance: A qualitative studyČlánek Imported severe malaria and risk factors for intensive care: A single-centre retrospective analysisČlánek Effectiveness of telerehabilitation in the management of adults with stroke: A systematic reviewČlánek Evaluation of neutral oral contrast agents for assessment of the small bowel at abdominal staging CTČlánek Determinants of mortality among patients with drug-resistant tuberculosis in northern NigeriaČlánek Effects of tetracycline on myocardial infarct size in obese rats with chemically-induced colitisČlánek Patient-level cost of home- and facility-based child pneumonia treatment in Suba Sub County, KenyaČlánek TAP: A static analysis model for PHP vulnerabilities based on token and deep learning technologyČlánek Time trends between 2002 and 2017 in correlates of self-reported sitting time in European adultsČlánek Establishment of the experimental procedure for prediction of conjugation capacity in mutant UGT1A1Článek The performance of practitioners conducting facial comparisons on images of children across ageČlánek Willingness to receive institutional and community-based eldercare among the rural elderly in ChinaČlánek Nonarteritic anterior ischemic optic neuropathy is associated with cerebral small vessel diseaseČlánek An evolution of socioeconomic related inequality in teenage pregnancy and childbearing in MalawiČlánek Migration and political polarization in the U.S.: An analysis of the county-level migration networkČlánek Retraction: Placental expression of CD100, CD72 and CD45 is dysregulated in human miscarriageČlánek Oxygen delivery, oxygen consumption and decreased kidney function after cardiopulmonary bypassČlánek Location, location, location: Close ties among older continuing care retirement community residentsČlánek Metabolic costs of spontaneous swimming in Sprattus sprattus L., at different water temperaturesČlánek First evidence of hepatitis E virus infection in a small mammal (yellow-necked mouse) from CroatiaČlánek Semantic computational analysis of anticoagulation use in atrial fibrillation from real world dataČlánek A mathematical model of honey bee colony dynamics to predict the effect of pollen on colony failureČlánek Socioeconomic determinants of cancer screening utilisation in Latin America: A systematic reviewČlánek Correction: Intensive longitudinal modelling predicts diurnal activity of salivary alpha-amylaseČlánek HHIP overexpression inhibits the proliferation, migration and invasion of non-small cell lung cancerČlánek A digital collection of rare and endangered lemurs and other primates from the Duke Lemur CenterČlánek Dispersion of Legionella bacteria in atmosphere: A practical source location estimation methodČlánek The ZJU index is a powerful surrogate marker for NAFLD in severely obese North American womenČlánek Risk of temperature, humidity and concentrations of air pollutants on the hospitalization of AECOPDČlánek Multiple innate antibacterial immune defense elements are correlated in diverse ungulate speciesČlánek Towards successful business process improvement – An extension of change acceleration process modelČlánek Influence of season and social context on male giant panda (Ailuropoda melanoleuca) vocal behaviourČlánek Development of an intravaginal ring for the topical delivery of Aurora kinase A inhibitor, MLN8237
Článek vyšel v časopisePLOS One
Nejčtenější tento týden
2019 Číslo 11- Zachyťte pacienty s akutními porfyriemi, aby nebloudili zdravotnictvím
- Auris One: Když se dokumentace v ordinaci praktika začne psát „sama“
- Prof. Jan Škrha: Metformin je bezpečný, ale je třeba jej bezpečně užívat a léčbu kontrolovat
- Oxymetazolin v léčbě akutní rýmy = rychlá dekongesce a kratší trvání onemocnění
- „Jednohubky“ z klinického výzkumu – 2026/11
-
Všechny články tohoto čísla
- Wild Steps in a semi-wild setting? Habitat selection and behavior of European bison reintroduced to an enclosure in an anthropogenic landscape
- The effect of facial expression on contrast sensitivity: A behavioural investigation and extension of Hedger, Adams & Garner (2015)
- Non-communicable diseases risk factors and their determinants: A cross-sectional state-wide STEPS survey, Haryana, North India
- Genotype-matched Newcastle disease virus vaccine confers improved protection against genotype XII challenge: The importance of cytoplasmic tails in viral replication and vaccine design
- Combined transcriptomics and proteomics forecast analysis for potential genes regulating the Columbian plumage color in chickens
- Persistence of traditional and emergence of new structural drivers and factors for the HIV epidemic in rural Uganda; A qualitative study
- Competency assessment of the medical interns and nurses and documenting prevailing practices to provide family planning services in teaching hospitals in three states of India
- Choice of birth place among antenatal clinic attendees in rural mission hospitals in Ebonyi State, South-East Nigeria
- Dual pathway for metabolic engineering of Escherichia coli to produce the highly valuable hydroxytyrosol
- Genetic and genomic analyses underpin the feasibility of concomitant genetic improvement of milk yield and mastitis resistance in dairy sheep
- Long-term exposure to daily ethanol injections in DBA/2J and Swiss mice: Lessons for the interpretation of ethanol sensitization
- Taxonomic and functional anuran beta diversity of a subtropical metacommunity respond differentially to environmental and spatial predictors
- A simple way to improve a conventional A/O-MBR for high simultaneous carbon and nutrient removal from synthetic municipal wastewater
- Knowledge and awareness of cervical cancer in Southwestern Ethiopia is lacking: A descriptive analysis
- Flat electrode contacts for vagus nerve stimulation
- Circulating Th17.1 cells as candidate for the prediction of therapeutic response to abatacept in patients with rheumatoid arthritis: An exploratory research
- Prevalence and socioeconomic determinants of development delay among children in Ceará, Brazil: A population-based study
- Characterizing macroinvertebrate community composition and abundance in freshwater tidal wetlands of the Sacramento-San Joaquin Delta
- A randomized controlled trial comparing isosorbide dinitrate-oxytocin versus misoprostol-oxytocin at management of foetal intrauterine death
- Hello, is that me you are looking for? A re-examination of the role of the DMN in social and self relevant aspects of off-task thought
- Lactobacillus rhamnosus Lcr35 as an effective treatment for preventing Candida albicans infection in the invertebrate model Caenorhabditis elegans: First mechanistic insights
- Use of latent class analysis to identify multimorbidity patterns and associated factors in Korean adults aged 50 years and older
- A study of psychological pain in substance use disorder and its relationship to treatment outcome
- Effects of artificially introduced Enterococcus faecalis strains in experimental necrotizing enterocolitis
- Treatment-seeking for vaginal fistula in sub-Saharan Africa
- Dissemination and stakeholder engagement practices among dissemination & implementation scientists: Results from an online survey
- Comparative analysis of the accelerated aged seed transcriptome profiles of two maize chromosome segment substitution lines
- Transactional sex among men who have sex with men participating in the CohMSM prospective cohort study in West Africa
- Addiction of mesenchymal phenotypes on the FGF/FGFR axis in oral squamous cell carcinoma cells
- Left parietal tACS at alpha frequency induces a shift of visuospatial attention
- Microtranscriptome analysis of sugarcane cultivars in response to aluminum stress
- The role of alien species on plant-floral visitor network structure in invaded communities
- Predictive factors for unfavourable treatment in MDR-TB and XDR-TB patients in Rio de Janeiro State, Brazil, 2000-2016
- Agricultural impacts on streams near Nitrate Vulnerable Zones: A case study in the Ebro basin, Northern Spain
- Development of a multi-locus typing scheme for an Enterobacteriaceae linear plasmid that mediates inter-species transfer of flagella
- The roles of MRI-based prostate volume and associated zone-adjusted prostate-specific antigen concentrations in predicting prostate cancer and high-risk prostate cancer
- Re-modeling of foliar membrane lipids in a seagrass allows for growth in phosphorus-deplete conditions
- Effect of sampling frequency on fractal fluctuations during treadmill walking
- Effect of calcium intake and the dietary cation-anion difference during early lactation on the bone mobilization dynamics throughout lactation in dairy cows
- Facilitators and barriers to linkage to HIV care and treatment among female sex workers in a community-based HIV prevention intervention in Tanzania: A qualitative study
- Tuberculosis treatment outcome: The case of women in Ethiopia and China, ten-years retrospective cohort study
- Protein:Protein interactions in the cytoplasmic membrane apparently influencing sugar transport and phosphorylation activities of the e. coli phosphotransferase system
- A digital collection of rare and endangered lemurs and other primates from the Duke Lemur Center
- Computational fluid dynamics simulation of changes in the morphology and airflow dynamics of the upper airways in OSAHS patients after treatment with oral appliances
- Resistome metagenomics from plate to farm: The resistome and microbial composition during food waste feeding and composting on a Vermont poultry farm
- Lower limb chronic edema management program: Perspectives of disengaged patients on challenges, enablers and barriers to program attendance and adherence
- Discovery of powdery mildew resistance gene candidates from Aegilops biuncialis chromosome 2Mb based on transcriptome sequencing
- Modelling vegetation understory cover using LiDAR metrics
- Assessing the impact of the “one-child policy” in China: A synthetic control approach
- CRISPR-Cas9 modified bacteriophage for treatment of Staphylococcus aureus induced osteomyelitis and soft tissue infection
- Forecasting type-specific seasonal influenza after 26 weeks in the United States using influenza activities in other countries
- Chronic exercise modulates the cellular immunity and its cannabinoid receptors expression
- Characterization of the diverse plasmid pool harbored by the blaNDM-1-containing Acinetobacter bereziniae HPC229 clinical strain
- What does mitogenomics tell us about the evolutionary history of the Drosophila buzzatii cluster (repleta group)?
- A cell-based evaluation of a non-essential amino acid formulation as a non-bioactive control for activation and stimulation of muscle protein synthesis using ex vivo human serum
- Conjugated linoleic acid as a novel insecticide targeting the agricultural pest Leptinotarsa decemlineata
- Relationship between pattern electroretinogram and optic disc morphology in glaucoma
- Depicting changes in land surface cover at Al-Hassa oasis of Saudi Arabia using remote sensing and GIS techniques
- Land snail dispersal, abundance and diversity on green roofs
- Fanconi-BRCA pathway mutations in childhood T-cell acute lymphoblastic leukemia
- Mesenchymal Stem/ Stromal Cells metabolomic and bioactive factors profiles: A comparative analysis on the umbilical cord and dental pulp derived Stem/ Stromal Cells secretome
- The association between caesarean section delivery and later life obesity in 21-24 year olds in an Urban South African birth cohort
- Diagnosis and treatment of acute respiratory illness in children under five in primary care in low-, middle-, and high-income countries: A descriptive FRESH AIR study
- Quality control of cervical cytology using a 3-type HPV mRNA test increases screening program sensitivity of cervical intraepithelial neoplasia grade 2+ in young Norwegian women—A cohort study
- Toxicity and sublethal effects of two plant allelochemicals on the demographical traits of cotton aphid, Aphis gossypii Glover (Hemiptera: Aphididae)
- Protocol development for discovery of angiogenesis inhibitors via automated methods using zebrafish
- Friends with malefit. The effects of keeping dogs and cats, sustaining animal-related injuries and Toxoplasma infection on health and quality of life
- Trueness of digital intraoral impression in reproducing multiple implant position
- Comparison of drug safety data obtained from the monitoring system, literature, and social media: An empirical proof from a Chinese patent medicine
- Norm values and psychometric properties of the short version of the Trier Inventory for Chronic Stress (TICS) in a representative German sample
- Maternal health and birth outcomes in a South African birth cohort study
- Structural characterization of scorpion peptides and their bactericidal activity against clinical isolates of multidrug-resistant bacteria
- Molecular evolution of genes encoding allergen proteins in the peanuts genus Arachis: Structural and functional implications
- Structural characterization of the saxitoxin-targeting APTSTX1 aptamer using optical tweezers and molecular dynamics simulations
- Residential household yard care practices along urban-exurban gradients in six climatically-diverse U.S. metropolitan areas
- Formal comment on “Assessing the impact of the ‘one-child policy’ in China: A synthetic control approach”
- Evaluation of a global spring wheat panel for stripe rust: Resistance loci validation and novel resources identification
- “Big men” in the office: The gender-specific influence of weight upon persuasiveness
- Modification of everyday activities and its association with self-awareness in cognitively diverse older adults
- The effect of bivalve filtration on eDNA-based detection of aquatic organisms
- Selective culture enrichment and sequencing of feces to enhance detection of antimicrobial resistance genes in third-generation cephalosporin resistant Enterobacteriaceae
- Development and validation of rapid environmental DNA (eDNA) detection methods for bog turtle (Glyptemys muhlenbergii)
- Average and time-specific maternal prenatal inflammatory biomarkers and the risk of labor epidural associated fever
- Preference-based measure of health-related quality of life and its determinants in sickle cell disease in Nigeria
- Factors influencing participation dynamics in research for development interventions with multi-stakeholder platforms: A metric approach to studying stakeholder participation
- Contextual variation in young children’s acquisition of social-emotional skills
- Prokaryotic and eukaryotic microbiomes associated with blooms of the ichthyotoxic dinoflagellate Cochlodinium (Margalefidinium) polykrikoides in New York, USA, estuaries
- Reconciling the statistics of spectral reflectance and colour
- Temporal weights in loudness: Investigation of the effects of background noise and sound level
- A global assessment of street-network sprawl
- Correction: KRIT1 Regulates the Homeostasis of Intracellular Reactive Oxygen Species
- Mindfulness-Based Blood Pressure Reduction (MB-BP): Stage 1 single-arm clinical trial
- Measurement of abortion safety using community-based surveys: Findings from three countries
- Behavioral response of naïve and non-naïve deer to wolf urine
- SNARE proteins rescue impaired autophagic flux in Down syndrome
- Negative impact of gestational diabetes mellitus on progress of pelvic floor muscle electromyography activity: Cohort study
- Change in left inferior frontal connectivity with less unexpected harmonic cadence by musical expertise
- Structural mechanism for regulation of DNA binding of BpsR, a Bordetella regulator of biofilm formation, by 6-hydroxynicotinic acid
- How does open innovation lead competitive advantage? A dynamic capability view perspective
- Bull efficiency using dairy genetic traits
- Improved cortical boundary registration for locally distorted fMRI scans
- Extractive single document summarization using binary differential evolution: Optimization of different sentence quality measures
- Measuring the tilt and slant of Chinese handwriting in primary school students: A computerized approach
- Isolation and identification of an isoflavone reducing bacterium from feces from a pregnant horse
- Sugar labeling: How numerical information of sugar content influences healthiness and tastiness expectations
- Optimally adjusted last cluster for prediction based on balancing the bias and variance by bootstrapping
- Quantifying normal and parkinsonian gait features from home movies: Practical application of a deep learning–based 2D pose estimator
- Heterogeneity of porcine bone marrow-derived dendritic cells induced by GM-CSF
- Can visual interpretation of NucliSens graphs reduce the need for repeat viral load testing?
- Manganese levels in infant formula and young child nutritional beverages in the United States and France: Comparison to breast milk and regulations
- Association between metabolic body composition status and risk for impaired renal function: A cross-sectional study
- Toddler skills predict moderate-to-late preterm born children’s cognition and behaviour at 6 years of age
- The bacterial community in potato is recruited from soil and partly inherited across generations
- Infective endocarditis and diabetes mellitus: Results from a single-center study from 1994 to 2017
- Patient satisfaction with HIV services in Vietnam: Status, service models and association with treatment outcome
- Ion concentration polarization (ICP) of proteins at silicon micropillar nanogaps
- The trajectory of patterns of light and sedentary physical activity among females, ages 14-23
- Coadministration of kla peptide with HPRP-A1 to enhance anticancer activity
- Measuring the complexity of directed graphs: A polynomial-based approach
- Estimation of maize evapotraspiration under drought stress - A case study of Huaibei Plain, China
- Publication rates in animal research. Extent and characteristics of published and non-published animal studies followed up at two German university medical centres
- Developmental conservation of microRNA gene localization at the nuclear periphery
- Exploring critical factors of the perceived usefulness of blended learning for higher education students
- Anti-Alzheimer potential, metabolomic profiling and molecular docking of green synthesized silver nanoparticles of Lampranthus coccineus and Malephora lutea aqueous extracts
- Protective effect of Platymiscium floribundum Vog. in tree extract on periodontitis inflammation in rats
- Direct transport vs secondary transfer to level I trauma centers in a French exclusive trauma system: Impact on mortality and determinants of triage on road-traffic victims
- Honey bee microbiome associated with different hive and sample types over a honey production season
- Bacterial communities in the rhizosphere, phyllosphere and endosphere of tomato plants
- Sildenafil citrate long-term treatment effects on cardiovascular reactivity in a SHR experimental model of metabolic syndrome
- Postoperative delirium after lung resection for primary lung cancer: Risk factors, risk scoring system, and prognosis
- The CSF-1-receptor inhibitor, JNJ-40346527 (PRV-6527), reduced inflammatory macrophage recruitment to the intestinal mucosa and suppressed murine T cell mediated colitis
- Using Er:YAG laser to remove lithium disilicate crowns from zirconia implant abutments: An in vitro study
- Antibacterial efficacy of cold atmospheric plasma against Enterococcus faecalis planktonic cultures and biofilms in vitro
- Mechanisms of African swine fever virus pathogenesis and immune evasion inferred from gene expression changes in infected swine macrophages
- Application of ensemble methods to analyse the decline of organochlorine pesticides in relation to the interactions between age, gender and time
- Mitogenomic diversity in Sacred Ibis Mummies sheds light on early Egyptian practices
- Automated detection of a nonperfusion area caused by retinal vein occlusion in optical coherence tomography angiography images using deep learning
- Characterisation of a novel SCCmec VI element harbouring fusC in an emerging Staphylococcus aureus strain from the Arabian Gulf region
- Inducible UCP1 silencing: A lentiviral RNA-interference approach to quantify the contribution of beige fat to energy homeostasis
- iCrotoK-PseAAC: Identify lysine crotonylation sites by blending position relative statistical features according to the Chou’s 5-step rule
- Emerging practices supporting diabetes self-management among food insecure adults and families: A scoping review
- Does aneurysm side influence the infarction side and patients´ outcome after subarachnoid hemorrhage?
- Raising the bar: Recovery ambition for species at risk in Canada and the US
- Management of locally advanced non-small cell lung cancer in the modern era: A national Italian survey on diagnosis, treatment and multidisciplinary approach
- Foraging strategies are maintained despite workforce reduction: A multidisciplinary survey on the pollen collected by a social pollinator
- Incidence of colorectal cancer in Eritrea: Data from the National Health Laboratory, 2011-2017
- Integrated analysis of miRNA landscape and cellular networking pathways in stage-specific prostate cancer
- Evaluation of the reactogenicity, adjuvanticity and antigenicity of LT(R192G) and LT(R192G/L211A) by intradermal immunization in mice
- Role of rhesus macaque IFITM3(2) in simian immunodeficiency virus infection of macaques
- Variation in the LRR region of Pi54 protein alters its interaction with the AvrPi54 protein revealed by in silico analysis
- Evolutionarily conserved susceptibility of the mitochondrial respiratory chain to SDHI pesticides and its consequence on the impact of SDHIs on human cultured cells
- Statistical determination of synergy based on Bliss definition of drugs independence
- The association between sleep problems and academic performance in primary school-aged children: Findings from a Norwegian longitudinal population-based study
- Estimating the national cost burden of in-hospital needlestick injuries among healthcare workers in Japan
- Assessing reliability of intra-tumor heterogeneity estimates from single sample whole exome sequencing data
- Dispersion of Legionella bacteria in atmosphere: A practical source location estimation method
- Integrative proteomic and phosphoproteomic profiling of prostate cell lines
- Treatment paths for localised prostate cancer in Italy: The results of a multidisciplinary, observational, prospective study (Pros-IT CNR)
- Why are undergraduate emerging adults anxious and avoidant in their romantic relationships? The role of family relationships
- Barriers to implementation of emergency obstetric and neonatal care in rural Pakistan
- Testosterone supplementation improves insulin responsiveness in HFD fed male T2DM mice and potentiates insulin signaling in the skeletal muscle and C2C12 myocyte cell line
- Ang-(1-7)/ MAS1 receptor axis inhibits allergic airway inflammation via blockade of Src-mediated EGFR transactivation in a murine model of asthma
- Factors influencing bird-building collisions in the downtown area of a major North American city
- Collembola laterally move biochar particles
- Decreased retinal thickness in patients with Alzheimer’s disease is correlated with disease severity
- Moving system with action sport cameras: 3D kinematics of the walking and running in a large volume
- Factors influencing subclinical atherosclerosis in patients with biopsy-proven nonalcoholic fatty liver disease
- Boundary violations and adolescent drinking: Observational evidence that symbolic boundaries moderate social influence
- Inadequate conflict of interest policies at most French teaching hospitals: A survey and website analysis
- A new resolution function to evaluate tree shape statistics
- Thermostat wars? The roles of gender and thermal comfort negotiations in household energy use behavior
- Patients undergoing surgery for lumbar spinal stenosis experience unique courses of pain and disability: A group-based trajectory analysis
- Lifetime prevalence of intimate partner violence against women in an urban Brazilian city: A cross-sectional survey
- The factors associated with being left-behind children in China: Multilevel analysis with nationally representative data
- High heat tolerance in plants from the Andean highlands: Implications for paramos in a warmer world
- Quantifying pediatric patient need for second- and third-line HIV treatment: A tool for decision-making in resource-limited settings
- Discovery of actionable genetic alterations with targeted panel sequencing in children with relapsed or refractory solid tumors
- Iodine status of non-pregnant women and availability of food vehicles for fortification with iodine in a remote community in Gulf province, Papua New Guinea
- Fibre and extracellular matrix contributions to passive forces in human skeletal muscles: An experimental based constitutive law for numerical modelling of the passive element in the classical Hill-type three element model
- The status of imported Barremian-Bedoulian flint in north-eastern Iberia during the Middle Neolithic. Insights from the variscite mines of Gavà (Barcelona)
- Psychology of personal data donation
- Radiocarbon dating and cultural dynamics across Mongolia’s early pastoral transition
- MARGO (Massively Automated Real-time GUI for Object-tracking), a platform for high-throughput ethology
- Visual detection of time-varying signals: Opposing biases and their timescales
- Results from a World Health Organization pilot of the Basic Emergency Care Course in Sub Saharan Africa
- Scientists’ opinions and attitudes towards citizens’ understanding of science and their role in public engagement activities
- Dacentrurine stegosaurs (Dinosauria): A new specimen of Miragaia longicollum from the Late Jurassic of Portugal resolves taxonomical validity and shows the occurrence of the clade in North America
- Integrated pan-cancer gene expression and drug sensitivity analysis reveals SLFN11 mRNA as a solid tumor biomarker predictive of sensitivity to DNA-damaging chemotherapy
- Does membrane feeding compromise the quality of Aedes aegypti mosquitoes?
- Morphology, phylogeny, and taxonomy of two species of colonial volvocine green algae from Lake Victoria, Tanzania
- Metabolomics profiles associated with HbA1c levels in patients with type 2 diabetes
- Exploring local realities: Perceptions and experiences of healthcare workers on the management and control of drug-resistant tuberculosis in Addis Ababa, Ethiopia
- Sex differences in the treatment and outcome of emergency general surgery
- Comorbidities and costs in HIV patients: A retrospective claims database analysis in Germany
- Barriers to integration of bioinformatics into undergraduate life sciences education: A national study of US life sciences faculty uncover significant barriers to integrating bioinformatics into undergraduate instruction
- Local unemployment changes the springboard effect of low pay: Evidence from England
- A comparison of body composition assessment methods in climbers: Which is better?
- Comparison of an in-house ‘home-brew’ and commercial ViroSeq integrase genotyping assays on HIV-1 subtype C samples
- Elucidating genetic variability and population structure in Venturia inaequalis associated with apple scab diseaseusing SSR markers
- Clustering via hypergraph modularity
- Indomethacin enhances anti-tumor efficacy of a MUC1 peptide vaccine against breast cancer in MUC1 transgenic mice
- Multistage fuzzy comprehensive evaluation of landslide hazards based on a cloud model
- Inducible microRNA-200c decreases motility of breast cancer cells and reduces filamin A
- Pharmacological signatures of the reduced incidence and the progression of cognitive decline in ageing populations suggest the protective role of beneficial polypharmacy
- Continuous influenza virus production in a tubular bioreactor system provides stable titers and avoids the “von Magnus effect”
- Complex interaction networks of cytokines after transarterial chemotherapy in patients with hepatocellular carcinoma
- Gender essentialism in transgender and cisgender children
- Insertional mutagenesis in the zoonotic pathogen Chlamydia caviae
- Being there: A scoping review of grief support training in medical education
- Does the psychological profile influence the position of promising young futsal players?
- Effect of self-rated health status on functioning difficulties among older adults in Ghana: Coarsened exact matching method of analysis of the World Health Organization’s study on global AGEing and adult health, Wave 2
- Olfactory screening of Parkinson’s Disease patients and healthy subjects in China and Germany: A study of cross-cultural adaptation of the Sniffin’ Sticks 12-identification test
- Molecular evolution of cytochrome C oxidase-I protein of insects living in Saudi Arabia
- Correlates of leisure-time sedentary behavior among 181,793 adolescents aged 12-15 years from 66 low- and middle-income countries
- Cost-effectiveness analysis of Mucosal Leishmaniasis diagnosis with PCR-based vs parasitological tests in Colombia
- Spatiotemporal analysis of historical records (2001–2012) on dengue fever in Vietnam and development of a statistical model for forecasting risk
- Resilience assessment of Puerto Rico’s coral reefs to inform reef management
- Effect of community based health education on knowledge and attitude towards iron and folic acid supplementation among pregnant women in Kiambu County, Kenya: A quasi experimental study
- Implementation and effectiveness of non-specialist mediated interventions for children with Autism Spectrum Disorder: A systematic review and meta-analysis
- A tailored cognitive behavioral program for juvenile justice-referred females at risk of substance use and delinquency: A pilot quasi-experimental trial
- Impact of adjusted kidney volume measured in the bench surgery on one-year renal function in kidney transplantation
- Machine learning algorithm validation with a limited sample size
- The magnitude of suicidal ideation, attempts and associated factors of HIV positive youth attending ART follow ups at St. Paul’s hospital Millennium Medical College and St. Peter’s specialized hospital, Addis Ababa, Ethiopia, 2018
- The nonlinear effect of financial and fiscal policies on poverty alleviation in China—An empirical analysis of Chinese 382 impoverished counties with PSTR models
- Impacts of risk and competition on the profitability of banks: Empirical evidence from Pakistan
- Molecular characterization of lung adenocarcinoma from Korean patients using next generation sequencing
- An expansin-like protein expands forage cell walls and synergistically increases hydrolysis, digestibility and fermentation of livestock feeds by fibrolytic enzymes
- Joint image compression and encryption based on sparse Bayesian learning and bit-level 3D Arnold cat maps
- Urticating setae of tarantulas (Araneae: Theraphosidae): Morphology, revision of typology and terminology and implications for taxonomy
- Live observation of the oviposition process in Daphnia magna
- On the accuracy of displacement-based wave intensity analysis: Effect of vessel wall viscoelasticity and nonlinearity
- Nodosilinea signiensis sp. nov. (Leptolyngbyaceae, Synechococcales), a new terrestrial cyanobacterium isolated from mats collected on Signy Island, South Orkney Islands, Antarctica
- A 3’ UTR SNP rs885863, a cis-eQTL for the circadian gene VIPR2 and lincRNA 689, is associated with opioid addiction
- Characterizing the Randot Preschool stereotest: Testability, norms, reliability, specificity and sensitivity in children aged 2-11 years
- Tributyltin chloride (TBT) induces RXRA down-regulation and lipid accumulation in human liver cells
- Amazon climatic factors driving terpene composition of Iryanthera polyneura Ducke in terra-firme forest: A statistical approach
- Differences in clinical features of cluster headache between drinkers and nondrinkers in Japan
- Distribution of macular ganglion cell layer thickness in foveal hypoplasia: A new diagnostic criterion for ocular albinism
- Polo-like kinase 1 (Plk1) inhibition synergizes with taxanes in triple negative breast cancer
- Effect of mechanochemical activation of natural phosphorite structure as well as phosphorus solubility
- Automated content analysis across six languages
- A deep learning reconstruction framework for X-ray computed tomography with incomplete data
- Integrating interconception care in preventive child health care services: The Healthy Pregnancy 4 All program
- The prognostic significance of tumor-infiltrating lymphocytes assessment with hematoxylin and eosin sections in resected primary lung adenocarcinoma
- Effectiveness of novel fabrics to resist punctures and lacerations from white shark (Carcharodon carcharias): Implications to reduce injuries from shark bites
- Bacillus Calmette-Guérin (BCG) therapy lowers the incidence of Alzheimer’s disease in bladder cancer patients
- Serial block-face scanning electron microscopy reveals neuronal-epithelial cell fusion in the mouse cornea
- Salt or fish (or salted fish)? The Bronze Age specialised sites along the Tyrrhenian coast of Central Italy: New insights from Caprolace settlement
- Pragmatic language dysfunction in systemic lupus erythematosus patients: Results from a single center Italian study
- Association between cerebral atrophy and osteoporotic vertebral compression fractures
- Latitudinal gradient of cyanobacterial diversity in tidal flats
- Gene expression based survival prediction for cancer patients—A topic modeling approach
- Understanding allergic multimorbidity within the non-eosinophilic interactome
- The association between psychological distress and angina pectoris: A population-based study
- Comparative analysis on Facebook post interaction using DNN, ELM and LSTM
- Cerebellum-mediated trainability of eye and head movements for dynamic gazing
- Psychological and physiological effects of applying self-control to the mobile phone
- Omecamtiv mecarbil lowers the contractile deficit in a mouse model of nebulin-based nemaline myopathy
- Genome-wide SNP analyses reveal population structure of Portunus pelagicus along Vietnam coastline
- Modulating transcription through development of semi-synthetic yeast core promoters
- Left-handed metamaterial bandpass filter for GPS, Earth Exploration-Satellite and WiMAX frequency sensing applications
- Cost-effectiveness analysis of PSA-based mass screening: Evidence from a randomised controlled trial combined with register data
- A good tennis player does not lose matches. The effects of valence congruency in processing stance-argument pairs
- Validation of the group tasks uncertainty model (MITAG) in a German sample
- Parent psychological wellbeing in a single-family room versus an open bay neonatal intensive care unit
- Optimizing the procedure of grain nutrient predictions in barley via hyperspectral imaging
- In-situ time resolved spectrographic measurement using an additively manufactured metallic micro-fluidic analysis platform
- Race disparity in blood sphingolipidomics associated with lupus cardiovascular comorbidity
- Characterization of the placental transcriptome through mid to late gestation in the mare
- Indirect violence exposure and mental health symptoms among an urban public-school population: Prevalence and correlates
- Diagnostic ability of multifocal electroretinogram in early multiple sclerosis using a new signal analysis method
- Predictors of never having a mammogram among Chinese, Vietnamese, and Korean immigrant women in the U.S.
- The impact of hepatic steatosis on portal hypertension
- How do and could clinical guidelines support patient-centred care for women: Content analysis of guidelines
- Study of the epidemiological behavior of malaria in the Darien Region, Panama. 2015–2017
- School-based obesity prevention for busy low-income families—Organisational and personal barriers and facilitators to implementation
- Neighborhood crime, disorder and substance use in the Caribbean context: Jamaica National Drug Use Prevalence Survey 2016
- Genomic comparison of diverse Salmonella serovars isolated from swine
- Significance of the lobe-specific emphysema index to predict prolonged air leak after anatomical segmentectomy
- Modeling of inter-organizational coordination dynamics in resilience planning of infrastructure systems: A multilayer network simulation framework
- Manipulating the odds: The effects of Machiavellianism and construal level on cheating behavior
- Early recognition of anorexia through patient-generated assessment predicts survival in patients with oesophagogastric cancer
- Identifying publications in questionable journals in the context of performance-based research funding
- ITGAM is a risk factor to systemic lupus erythematosus and possibly a protection factor to rheumatoid arthritis in patients from Mexico
- Nurses’ and patients’ experiences and preferences of the ankle-brachial pressure index and multi-site photoplethysmography for the diagnosis of peripheral arterial disease: A qualitative study
- Cluster tendency assessment in neuronal spike data
- Voluntary medical male circumcision for HIV prevention among adolescents in Kenya: Unintended consequences of pursuing service-delivery targets
- Primary care in five European countries: A citizens’ perspective on the quality of care for children
- High Order Profile Expansion to tackle the new user problem on recommender systems
- Psychometric properties of the Korean version of the Health Literacy on Social Determinants of Health Questionnaire (K-HL-SDHQ)
- Flood hazard mapping and assessment in data-scarce Nyaungdon area, Myanmar
- Methods for the identification of farm escapees in feral mink (Neovison vison) populations
- Transcriptional analysis of amino acid, metal ion, vitamin and carbohydrate uptake in butanol-producing Clostridium beijerinckii NRRL B-598
- Long-term vancomycin use had low risk of ototoxicity
- Overcoming platinum resistance in ovarian cancer by targeting pregnancy-associated plasma protein-A
- Exploration of muscle loss and metabolic state during prolonged critical illness: Implications for intervention?
- Pan-caspase inhibitor F573 mitigates liver ischemia reperfusion injury in a murine model
- Efficacy of interleukin 10 gene hydrofection in pig liver vascular isolated ‘in vivo’ by surgical procedure with interest in liver transplantation
- Molecular characteristics of segment 5, a unique fragment encoding two partially overlapping ORFs in the genome of rice black-streaked dwarf virus
- Early economic evaluation of MRI-guided laser interstitial thermal therapy (MRgLITT) and epilepsy surgery for mesial temporal lobe epilepsy
- GLADS: A gel-less approach for detection of STMS markers in wheat and rice
- Anterior tooth-use behaviors among early modern humans and Neandertals
- Incidence patterns of orofacial clefts in purebred dogs
- Capacity of the medullary cavity of tibia and femur for intra-bone marrow transplantation in mice
- Association of thoracic spine deformity and cardiovascular disease in a mouse model for Marfan syndrome
- Predicting atrial fibrillation in primary care using machine learning
- M3VR—A multi-stage, multi-resolution, and multi-volumes-of-interest volume registration method applied to 3D endovaginal ultrasound
- A developmental trajectory supporting the evaluation and achievement of competencies: Articulating the Mastery Rubric for the nurse practitioner (MR-NP) program curriculum
- Mobile medication manager application to improve adherence with immunosuppressive therapy in renal transplant recipients: A randomized controlled trial
- Default Mode Network structural alterations in Kocher-Monro trajectory white matter transection: A 3 and 7 tesla simulation modeling approach
- Phylogenetic revision of Gymnotidae (Teleostei: Gymnotiformes), with descriptions of six subgenera
- Population genetic analysis of 36 Y-chromosomal STRs yields comprehensive insights into the forensic features and phylogenetic relationship of Chinese Tai-Kadai-speaking Bouyei
- Prevention of suicidal behaviour: Results of a controlled community-based intervention study in four European countries
- An assessment of khat consumption habit and its linkage to household economies and work culture: The case of Harar city
- Fixation of genetic variation and optimization of gene expression: The speed of evolution in isolated lizard populations undergoing Reverse Island Syndrome
- One simple claudication question as first step in Peripheral Arterial Disease (PAD) screening: A meta-analysis of the association with reduced Ankle Brachial Index (ABI) in 27,945 subjects
- Direct cost of health care for individuals with community associated Clostridium difficile infections: A population-based cohort study
- Association between serum homocysteine level and cognitive function in middle-aged type 2 diabetes mellitus patients
- A qualitative research synthesis of contextual factors contributing to female overweight and obesity over the life course in sub-Saharan Africa
- Insight into the relationship between aryl-hydrocarbon receptor and β-catenin in human colon cancer cells
- Hidden noise in immunologic parameters might explain rapid progression in early-onset periodontitis
- The role of stigma in the acceptance and disclosure of HIV among recently diagnosed men who have sex with men in Australia: A qualitative study
- Detection of Schistosoma japonicum and Oncomelania hupensis quadrasi environmental DNA and its potential utility to schistosomiasis japonica surveillance in the Philippines
- Does age influence the quality of life in children with atopic dermatitis?
- Questioning the lasting effect of galvanic vestibular stimulation on postural control
- Identification of a novel monocytic phenotype in Classic Hodgkin Lymphoma tumor microenvironment
- Characterization of 20 complete plastomes from the tribe Laureae (Lauraceae) and distribution of small inversions
- Binding and dynamics of melatonin at the interface of phosphatidylcholine-cholesterol membranes
- Recent climate-driven ecological change across a continent as perceived through local ecological knowledge
- Nonalcoholic fatty liver disease is an early predictor of metabolic diseases in a metabolically healthy population
- Occurrence and multilocus genotyping of Giardia duodenalis from post-weaned dairy calves in Sichuan province, China
- Retinoic acid-stimulated ERK1/2 pathway regulates meiotic initiation in cultured fetal germ cells
- Gender disparities in scientific production: A nationwide assessment among physicians in Peru
- Effect of F1 and F2 generations on genetic variability and working steps of doubled haploid production in maize
- Mitochondrial dysfunction in rheumatoid arthritis: A comprehensive analysis by integrating gene expression, protein-protein interactions and gene ontology data
- A caspase-6-cleaved fragment of Glial Fibrillary Acidic Protein as a potential serological biomarker of CNS injury after cardiac arrest
- A handy method to remove bacterial contamination from fungal cultures
- The self-care profiles and its determinants among adults with hypertension in primary health care clinics in Selangor, Malaysia
- The mutational landscape of quinolone resistance in Escherichia coli
- Exploring the influence of self-perceptions on the relationship between motor competence and identity in adolescents
- Study on the damage characteristics of gas-bearing shale under different unloading stress paths
- EPILAT-IRA Study: A contribution to the understanding of the epidemiology of acute kidney injury in Latin America
- 16S rDNA droplet digital PCR for monitoring bacterial DNAemia in bloodstream infections
- Three-dimensional (3D) brain microphysiological system for organophosphates and neurochemical agent toxicity screening
- Diversity of endocervical microbiota associated with genital Chlamydia trachomatis infection and infertility among women visiting obstetrics and gynecology clinics in Malaysia
- Health impact of hepatic-venous-occlusive disease in a small town in Ethiopia—Case study from Tahtay koraro district in Tigray region, 2017
- Development of a novel automatable fabrication method based on electrospinning co electrospraying for rotator cuff augmentation patches
- Development of a quantitative PCR assay for the detection and enumeration of a potentially ciguatoxin-producing dinoflagellate, Gambierdiscus lapillus (Gonyaulacales, Dinophyceae)
- Association of clinical factors with survival outcomes in laryngeal squamous cell carcinoma (LSCC)
- Seasonal oyster harvesting recorded in a Late Archaic period shell ring
- Population preferences for breast cancer screening policies: Discrete choice experiment in Belarus
- Respiratory health and inflammatory markers - Exposure to respirable dust and quartz and chemical binders in Swedish iron foundries
- Trends and predictors of mother-to-child transmission of HIV in an era of protocol changes: Findings from two large health facilities in North East Nigeria
- Elevated Ki-67 (MIB-1) expression as an independent predictor for unfavorable pathologic outcomes and biochemical recurrence after radical prostatectomy in patients with localized prostate cancer: A propensity score matched study
- Genome-wide identification and gene expression analysis of SOS family genes in tuber mustard (Brassica juncea var. tumida)
- Carvedilol improves glucose tolerance and insulin sensitivity in treatment of adrenergic overdrive in high fat diet-induced obesity in mice
- Institutional differences in USMLE Step 1 and 2 CK performance: Cross-sectional study of 89 US allopathic medical schools
- Molecular epidemiological characteristics of dengue virus carried by 34 patients in Guangzhou in 2018
- Heteroplasmy in the complete chicken mitochondrial genome
- Candida blood stream infections observed between 2011 and 2016 in a large Italian University Hospital: A time-based retrospective analysis on epidemiology, biofilm production, antifungal agents consumption and drug-susceptibility
- Sixty years since the creation of Lake Kariba: Thermal and oxygen dynamics in the riverine and lacustrine sub-basins
- Association of uric acid in serum and urine with subclinical renal damage: Hanzhong Adolescent Hypertension Study
- Appropriate management of acute gastroenteritis in Australian children: A population-based study
- The plasma metabolome of women in early pregnancy differs from that of non-pregnant women
- Effectiveness of four types of neuraminidase inhibitors approved in Japan for the treatment of influenza
- More than just availability: Who has access and who administers take-home naloxone in Baltimore, MD
- Evaluating the cross-cultural validity of the Dutch version of the Social Exclusion Index for Health Surveys (SEI-HS): A mixed methods study
- Diminuendo al bottom—Clarifying the semantics of music notation by re-modeling
- Structural analysis of the manganese transport regulator MntR from Bacillus halodurans in apo and manganese bound forms
- Serum uromodulin is associated with the severity of clinicopathological findings in ANCA-associated glomerulonephritis
- Male support for cervical cancer screening and treatment in rural Ghana
- ADAPTS: Automated deconvolution augmentation of profiles for tissue specific cells
- Comparison of shape quantification methods for genomic prediction, and genome-wide association study of sorghum seed morphology
- An attempt to identify the issues underlying the lack of consistent conceptualisations in the field of student mathematics-related beliefs
- Video abstracts and plain language summaries are more effective than graphical abstracts and published abstracts
- Trophic structure of the macrofauna associated to deep-vents of the southern Gulf of California: Pescadero Basin and Pescadero Transform Fault
- Incomplete insertion of pedicle screws in a standard construct reduces the fatigue life: A biomechanical analysis
- Cost savings associated with timely treatment of botulism with botulism antitoxin heptavalent product
- Effects of light and nitrogen availability on photosynthetic efficiency and fatty acid content of three original benthic diatom strains
- Early signal detection of adverse events following influenza vaccination using proportional reporting ratio, Victoria, Australia
- Bioinformatic analysis of a novel Echinococcus granulosus nuclear receptor with two DNA binding domains
- Genome-wide identification and characterization, phylogenetic comparison and expression profiles of SPL transcription factor family in B. juncea (Cruciferae)
- Hypoxia inhibits TNF-α-induced TSLP expression in keratinocytes
- Conceptualising alcohol consumption in relation to long-term health conditions: Exploring risk in interviewee accounts of drinking and taking medications
- Elevated interleukin-25 and its association to Th2 cytokines in systemic lupus erythematosus with lupus nephritis
- Thrombocytopenia and thrombocytosis are associated with different outcome in atrial fibrillation patients on anticoagulant therapy
- Involvement of extracellular vesicles in the macrophage-tumor cell communication in head and neck squamous cell carcinoma
- Comparison of Humphrey Field Analyzer and imo visual field test results in patients with glaucoma and pseudo-fixation loss
- Out-of-pocket expenditure and catastrophic health expenditure for hospitalization due to injuries in public sector hospitals in North India
- Concurrent validity and discriminative ability of Dutch performance-based motor tests in 5 to 6 years old children
- Cumulative viral load as a predictor of CD4+ T-cell response to antiretroviral therapy using Bayesian statistical models
- Can General Practitioners manage mental disorders in primary care? A partially randomised, pragmatic, cluster trial
- Self-serving incentives impair collective decisions by increasing conformity
- Mutation and immune profiling of metaplastic breast cancer: Correlation with survival
- The clinicopathological significance of Thrombospondin-4 expression in the tumor microenvironment of gastric cancer
- Propofol-based total intravenous anesthesia did not improve survival compared to desflurane anesthesia in breast cancer surgery
- Association between ossification of the posterior longitudinal ligament and ossification of the nuchal ligament in the cervical spine
- Effects of Debaryomyces hansenii treatment on intestinal mucosa microecology in mice with antibiotic-associated diarrhea
- Molecular validation of clinical Pantoea isolates identified by MALDI-TOF
- A novel wheat lodging resistance evaluation method and device based on the thrust force of the stalks
- Evolution of high tooth replacement rates in theropod dinosaurs
- Outpatient facility-based order variation in combined imaging
- Ethnic-racial identity affirmation: Validation in Aboriginal Australian children
- Non-intubated anesthesia in patients undergoing video-assisted thoracoscopic surgery: A systematic review and meta-analysis
- Tissue-type plasminogen activator selectively inhibits multiple toll-like receptors in CSF-1-differentiated macrophages
- Changes of serum pentraxin-3 and hypersensitive CRP levels during pregnancy and their relationship with gestational diabetes mellitus
- Synergistic immuno-modulatory activity in human macrophages of a medicinal mushroom formulation consisting of Reishi, Shiitake and Maitake
- Investigating reindeer pastoralism and exploitation of high mountain zones in northern Mongolia through ice patch archaeology
- Diversity pattern of Plasmodium knowlesi merozoite surface protein 4 (MSP4) in natural population of Malaysia
- Protein synthesis rates of muscle, tendon, ligament, cartilage, and bone tissue in vivo in humans
- “What gets measured better gets done better”: The landscape of validation of global maternal and newborn health indicators through key informant interviews
- Contactless monitoring of heart and respiratory rate in anesthetized pigs using infrared thermography
- Molecular characterisation of genital human papillomavirus among women in Southwestern, Nigeria
- The impact of “male clinics” on health-seeking behaviors of adult men in rural Kenya
- Gene expression microarray public dataset reanalysis in chronic obstructive pulmonary disease
- Utility of the new cobas HCV test for viral load monitoring during direct-acting antiviral therapy
- Impact of negative tuberculin skin test on growth among disadvantaged Bangladeshi children
- Streptococcal phosphotransferase system imports unsaturated hyaluronan disaccharide derived from host extracellular matrices
- Maternal diet modulates placental nutrient transporter gene expression in a mouse model of diabetic pregnancy
- Effects of an incremental theory of personality intervention on the reciprocity between bullying and cyberbullying victimization and perpetration in adolescents
- The clot thickens: Autologous and allogeneic fibrin sealants are mechanically equivalent in an ex vivo model of cartilage repair
- Reproducibility, stability, and accuracy of microbial profiles by fecal sample collection method in three distinct populations
- Cooperation with autonomous machines through culture and emotion
- Variation in hybridogenetic hybrid emergence between populations of water frogs from the Pelophylax esculentus complex
- Breast cancer in Tanzanian, black American, and white American women: An assessment of prognostic and predictive features, including tumor infiltrating lymphocytes
- Intramolecular tautomerization of the quercetin molecule due to the proton transfer: QM computational study
- A global overview of cassava genetic diversity
- Whole body periodic acceleration in normal and reduced mucociliary clearance of conscious sheep
- Identifying resurrection genes through the differentially expressed genes between Selaginella tamariscina (Beauv.) spring and Selaginella moellendorffii Hieron under drought stress
- Impact of hemodialysis on the concentrations of sodium and potassium during infusion of sodium thiosulfate using an In Vitro hemodialysis model
- Minimal effects of oyster aquaculture on local water quality: Examples from southern Chesapeake Bay
- Suboptimal infant and young child feeding practices in rural Boucle du Mouhoun, Burkina Faso: Findings from a cross-sectional population-based survey
- High salinity tolerance of invasive blue catfish suggests potential for further range expansion in the Chesapeake Bay region
- From waste to food: Optimising the breakdown of oil palm waste to provide substrate for insects farmed as animal feed
- Quantitative assessment of interstitial lung disease in Sjögren’s syndrome
- Comparative efficacy of tenofovir and entecavir in nucleos(t)ide analogue-naive chronic hepatitis B: A systematic review and meta-analysis
- Reference ranges for ultrasonographic renal dimensions as functions of age and body indices: A retrospective observational study in Taiwan
- Finding phrases: On the role of co-verbal facial information in learning word order in infancy
- Mathematical modeling reveals the factors involved in the phenomena of cancer stem cells stabilization
- Effects of forest management and roe deer impact on a mountain forest development in the Italian Apennines: A modelling approach using LANDIS-II
- Evaluation of comprehensive improvement for mild and moderate soil salinization in arid zone
- Efficacy, acceptability and feasibility of daily text-messaging in promoting glycaemic control and other clinical outcomes in a low-resource setting of South Africa: A randomised controlled trial
- Magnitude and associated factors of postpartum depression among women in Nekemte town, East Wollega zone, west Ethiopia, 2019: A community-based study
- Comparison of continuous wave and cold lateral condensation filling techniques in 3D printed simulated C-shape canals instrumented with Reciproc Blue or Hyflex EDM
- Effect of caffeine on neuromuscular function following eccentric-based exercise
- AtUBL5 regulates growth and development through pre-mRNA splicing in Arabidopsis thaliana
- The gut microbiome of freshwater Unionidae mussels is determined by host species and is selectively retained from filtered seston
- Alcohol consumption and survival after breast cancer diagnosis in Japanese women: A prospective patient cohort study
- Selection of reference genes for normalization of cranberry (Vaccinium macrocarpon Ait.) gene expression under different experimental conditions
- The household economic costs associated with depression symptoms: A cross-sectional household study conducted in the North West province of South Africa
- Increased cell size, structural complexity and migration of cancer cells acquiring fibroblast organelles by cell-projection pumping
- Acute low- compared to high-load resistance training to failure results in greater energy expenditure during exercise in healthy young men
- Impact of body mass index and metabolically unhealthy status on mortality in the Japanese general population: The JMS cohort study
- Characterization of two thermophilic cellulases from Talaromyces leycettanus JCM12802 and their synergistic action on cellulose hydrolysis
- Ecohydrology of urban trees under passive and active irrigation in a semiarid city
- Cyclosporine A eyedrops with self-nanoemulsifying drug delivery systems have improved physicochemical properties and efficacy against dry eye disease in a murine dry eye model
- LFastqC: A lossless non-reference-based FASTQ compressor
- Highly accurate prediction of flammability limits of chemical compounds using novel integrated hybrid models
- Nonsteroidal anti-inflammatory drugs and acetaminophen ameliorate muscular mechanical hyperalgesia developed after lengthening contractions via cyclooxygenase-2 independent mechanisms in rats
- A popular Indian clove-based mosquito repellent is less effective against Culex quinquefasciatus and Aedes aegypti than DEET
- Yeasts affect tolerance of Drosophila melanogaster to food substrate with high NaCl concentration
- The effect of climate change on cholera disease: The road ahead using artificial neural network
- Grit (effortful persistence) can be measured with a short scale, shows little variation across socio-demographic subgroups, and is associated with career success and career engagement
- Micro-dislodgement during transcatheter aortic valve implantation with a contemporary self-expandable prosthesis
- Improving the antimicrobial efficacy against resistant Staphylococcus aureus by a combined use of conjugated oligoelectrolytes
- Kin discrimination and outer membrane exchange in Myxococcus xanthus: Experimental analysis of a natural population
- Inflammatory cell infiltrates, hypoxia, vascularization, pentraxin 3 and osteoprotegerin in abdominal aortic aneurysms – A quantitative histological study
- Effects of virtual reality rehabilitation training on gait and balance in patients with Parkinson's disease: A systematic review
- Serum miR-33a is associated with steatosis and inflammation in patients with non-alcoholic fatty liver disease after liver transplantation
- Association between housing tenure and self-rated health in Japan: Findings from a nationwide cross-sectional survey
- Investigation of biochemical and physiological parameters of the newborn Saiga antelope (Saiga tatarica) in Gansu Province, China
- One-year follow-up of changes in refraction and aberrations induced by corneal incision
- Evaluation of upper limb superficial venous percussion as a sign of anatomical location and venous permeability. A comparative study of superficial venous percussion to ultrasound findings on non-renal patients and on chronic kidney disease patients
- An assessment of the Dutch experience with health insurers acting as healthcare advisors
- Perception of potential harm and benefits of HIV vaccine trial participation: A qualitative study from urban Tanzania
- Veterans with Gulf War Illness exhibit distinct respiratory patterns during maximal cardiopulmonary exercise
- Deep brain stimulation restores the glutamatergic and GABAergic synaptic transmission and plasticity to normal levels in kindled rats
- Metformin strongly affects transcriptome of peripheral blood cells in healthy individuals
- Cranberry extracts promote growth of Bacteroidaceae and decrease abundance of Enterobacteriaceae in a human gut simulator model
- Long-term retention on antiretroviral therapy among infants, children, adolescents and adults in Malawi: A cohort study
- Histochemical quantification of collagen content in articular cartilage
- Optogenetically transduced human ES cell-derived neural progenitors and their neuronal progenies: Phenotypic characterization and responses to optical stimulation
- Ion torrent high throughput mitochondrial genome sequencing (HTMGS)
- Outpatient antibiotic prescription rate and pattern in the private sector in India: Evidence from medical audit data
- Acute Influenza A virus outbreak in an enzootic infected sow herd: Impact on viral dynamics, genetic and antigenic variability and effect of maternally derived antibodies and vaccination
- Prevalence and correlates of low serum calcium in late pregnancy: A cross sectional study in the Nkongsamba Regional Hospital; Littoral Region of Cameroon
- Home-cage monitoring ascertains signatures of ictal and interictal behavior in mouse models of generalized seizures
- CRISPR/Cas9 gene editing in the West Nile Virus vector, Culex quinquefasciatus Say
- Genetic susceptibility to angiotensin-converting enzyme-inhibitor induced angioedema: A systematic review and evaluation of methodological approaches
- Proton pump inhibitor use increases the risk of peritonitis in peritoneal dialysis patients
- Comparative distribution of extended-spectrum beta-lactamase–producing Escherichia coli from urine infections and environmental waters
- Sex differences in thigh muscle volumes, sprint performance and mechanical properties in national-level sprinters
- Maternal serum and cord blood leptin concentrations at delivery
- Winter nitrification in ice-covered lakes
- Intolerance of uncertainty fuels depressive symptoms through rumination: Cross-sectional and longitudinal studies
- Monitoring exercise-induced muscle damage indicators and myoelectric activity during two weeks of knee extensor exercise training in young and old men
- Can adoption of pollution prevention techniques reduce pollution substitution?
- The association between self-efficacy and self-management behaviors among Chinese patients with type 2 diabetes
- Poly-arginine-18 peptides do not exacerbate bleeding, or improve functional outcomes following collagenase-induced intracerebral hemorrhage in the rat
- Affective disorders in the elderly in different European countries: Results from the MentDis_ICF65+ study
- Evaluation of forearm vascular resistance during orthostatic stress: Velocity is proportional to flow and size doesn’t matter
- Proton pencil minibeam irradiation of an in-vivo mouse ear model spares healthy tissue dependent on beam size
- Maternal stress in Shank3ex4-9 mice increases pup-directed care and alters brain white matter in male offspring
- Aspartate aminotransferase-to-platelet ratio index (APRI): A potential marker for diagnosis in patients at risk of severe malaria caused by Plasmodium vivax
- Exploiting open source 3D printer architecture for laboratory robotics to automate high-throughput time-lapse imaging for analytical microbiology
- Long non-coding RNAs and latent HIV – A search for novel targets for latency reversal
- Clinical characteristics of neonatal fulminant necrotizing enterocolitis in a tertiary Children's hospital in the last 10 years
- Effects of neuromuscular electrical stimulation training on muscle size in collegiate track and field athletes
- Adaptive fuzzy flow rate control considering multifractal traffic modeling and 5G communications
- Evaluation of four commercial tests for detecting ceftiofur in waste milk bulk tank samples
- A smart tele-cytology point-of-care platform for oral cancer screening
- Vasopressin SNP pain factors and stress in sickle cell disease
- Carbonate production of Micronesian reefs suppressed by thermal anomalies and Acanthaster as sea-level rises
- Microbial metabolisms in an abyssal ferromanganese crust from the Takuyo-Daigo Seamount as revealed by metagenomics
- Incidence of chronic kidney disease hospitalisations and mortality in Espírito Santo between 1996 to 2017
- The impact of short-term machine perfusion on the risk of cancer recurrence after rat liver transplantation with donors after circulatory death
- Proteomic profiling of the thrombin-activated canine platelet secretome (CAPS)
- Blood metal levels and serum testosterone concentrations in male and female children and adolescents: NHANES 2011–2012
- The effects of prolonged single night session of videogaming on sleep and declarative memory
- Diversity, distribution and dynamics of large trees across an old-growth lowland tropical rain forest landscape
- Mapping developmental QTL for plant height in soybean [Glycine max (L.) Merr.] using a four-way recombinant inbred line population
- Vaginal ring acceptability and related preferences among women in low- and middle-income countries: A systematic review and narrative synthesis
- UM171 induces a homeostatic inflammatory-detoxification response supporting human HSC self-renewal
- Positive selection and precipitation effects on the mitochondrial NADH dehydrogenase subunit 6 gene in brown hares (Lepus europaeus) under a phylogeographic perspective
- Evaluation of Minimum Inhibitory Concentrations for 154 Mycoplasma synoviae isolates from Italy collected during 2012-2017
- Enhancement of antibiotics antimicrobial activity due to the silver nanoparticles impact on the cell membrane
- Correction: Smoking, alcohol use disorder and tuberculosis treatment outcomes: A dual co-morbidity burden that cannot be ignored
- Correction: Effect of corruption on perceived difficulties in healthcare access in sub-Saharan Africa
- Knowledge-based best of breed approach for automated detection of clinical events based on German free text digital hospital discharge letters
- Importance of thorough tissue and cellular level characterization of targeted drugs in the evaluation of pharmacodynamic effects
- Integrated value-chain and risk assessment of Pig-Related Zoonoses in Ghana
- Failed sperm retrieval from severely oligospermic or non-obstructive azoospermic patients on oocyte retrieval day: Emergent oocyte cryopreservation is a feasible strategy
- Cassava yield traits predicted by genomic selection methods
- Verification of hub genes in the expression profile of aortic dissection
- Pig farmers’ willingness to pay for management strategies to reduce aggression between pigs
- Metabolomic response of Euglena gracilis and its bleached mutant strain to light
- Diagnostic value of ASVS for insulinoma localization: A systematic review and meta-analysis
- Newly educated care managers’ experiences of providing care for persons with stress-related mental disorders in the clinical primary care context
- Real-time telemetry monitoring of oxygen in the central complex of freely-walking Gromphadorhina portentosa
- Qualification programmes for immigrant health professionals: A systematic review
- An analytical model to minimize the latency in healthcare internet-of-things in fog computing environment
- Grain filling of early-season rice cultivars grown under mechanical transplanting
- Intercalation of small molecules into DNA in chromatin is primarily controlled by superhelical constraint
- Correlative evidence for co-regulation of phosphorus and carbon exchanges with symbiotic fungus in the arbuscular mycorrhizal Medicago truncatula
- How to design a dose-finding study on combined agents: Choice of design and development of R functions
- Altered expression of Notch1 in Alzheimer's disease
- The ZJU index is a powerful surrogate marker for NAFLD in severely obese North American women
- Trunk velocity-dependent Light Touch reduces postural sway during standing
- Evaluation of cytological diagnostic accuracy for canine splenic neoplasms: An investigation in 78 cases using STARD guidelines
- Trade-offs in motivating volunteer effort: Experimental evidence on voluntary contributions to science
- Does caching strategy vary with microclimate in endangered Mt. Graham red squirrels?
- Assessment of energy expenditure during high intensity cycling and running using a heart rate and activity monitor in young active adults
- Evaluating rectal swab collection method for gut microbiome analysis in the common marmoset (Callithrix jacchus)
- Implementation of a screening, brief intervention and referral to treatment programme for risky substance use in South African emergency centres: A mixed methods evaluation study
- Can the CalproQuest predict a positive Calprotectin test? A prospective diagnostic study
- The calcium sensor OsCBL1 modulates nitrate signaling to regulate seedling growth in rice
- Acceptability of and treatment preferences for recurrent bacterial vaginosis—Topical lactic acid gel or oral metronidazole antibiotic: Qualitative findings from the VITA trial
- Mathematical determination of the HIV-1 matrix shell structure and its impact on the biology of HIV-1
- Contingent negative variation during a modified cueing task in simulated driving
- CAMDI interacts with the human memory-associated protein KIBRA and regulates AMPAR cell surface expression and cognition
- Effect of feeding patterns on growth and nutritional status of children aged 0-24 months: A Chinese cohort study
- A fecal sequel: Testing the limits of a genetic assay for bat species identification
- Measuring the impact of chronic conditions and associated multimorbidity on health-related quality of life in the general population in Hong Kong SAR, China: A cross-sectional study
- Short and long-term clinical effectiveness and cost-effectiveness of a late-phase community-based balance and gait exercise program following hip fracture. The EVA-Hip Randomised Controlled Trial
- Vaccine cold chain in general practices: A prospective study in 75 refrigerators (Keep Cool study)
- Brazilian norms for the Bank of Standardized Stimuli (BOSS)
- Distinct varieties of aesthetic chills in response to multimedia
- Interaction between apolipoprotein E genotype and hypertension on cognitive function in older women in the Nurses’ Health Study
- Correction: Resistance profile of the HIV-1 maturation inhibitor GSK3532795 in vitro and in a clinical study
- New formulation of the Gompertz equation to describe the kinetics of untreated tumors
- Development of visual perception of others’ actions: Children’s judgment of lifted weight
- Retrospective comparative analysis of intraocular lens calculation formulas after hyperopic refractive surgery
- Human vitreous concentrations of citicoline following topical application of citicoline 2% ophthalmic solution
- Development and validation of exhaled breath condensate microRNAs to identify and endotype asthma in children
- Arthroscopic release for frozen shoulder: Does the timing of intervention and diabetes affect outcome?
- Risk factors affecting dairy cattle protective grouping behavior, commonly known as bunching, against Stomoxys calcitrans (L.) on California dairies
- Acceleration of chemical shift encoding-based water fat MRI for liver proton density fat fraction and T2* mapping using compressed sensing
- Characterisation and microbial community analysis of lipid utilising microorganisms for biogas formation
- Sexuality in male partners of women with fibromyalgia syndrome: A qualitative study
- Exploring optimization strategies for improving explicit water models: Rigid n-point model and polarizable model based on Drude oscillator
- Artificial insemination with fresh, liquid stored and frozen thawed semen in dromedary camels
- Moving into an urban drug scene among people who use drugs in Vancouver, Canada: Latent class growth analysis
- Numerical study on the start and unstart phenomena in a scramjet inlet-isolator model
- Effects of dietary supplementation with apple peel powder on the growth, blood and liver parameters, and transcriptome of genetically improved farmed tilapia (GIFT, Oreochromis niloticus)
- Urban growth simulation in different scenarios using the SLEUTH model: A case study of Hefei, East China
- Chronic bronchitis without airflow obstruction, asthma and rhinitis are differently associated with cardiovascular risk factors and diseases
- Factors associated with medication adherence among people with diabetes mellitus in poor urban areas of Cambodia: A cross-sectional study
- Mammary microbiome of lactating organic dairy cows varies by time, tissue site, and infection status
- Force field generalization and the internal representation of motor learning
- Polyphenism of visual and chemical secondary sexually-selected wing traits in the butterfly Bicyclus anynana: How different is the intermediate phenotype?
- Minimal genetic differentiation of the malaria vector Nyssorhynchus darlingi associated with forest cover level in Amazonian Brazil
- The impact of leisure activities on older adults’ cognitive function, physical function, and mental health
- scafSLICR: A MATLAB-based slicing algorithm to enable 3D-printing of tissue engineering scaffolds with heterogeneous porous microarchitecture
- Association of serum leptin and adiponectin concentrations with echocardiographic parameters and pathophysiological states in patients with cardiovascular disease receiving cardiovascular surgery
- Operation of cognitive memory inhibition in adults with Down syndrome: Effects of maintenance load and material
- Influences on surgical antimicrobial prophylaxis decision making by surgical craft groups, anaesthetists, pharmacists and nurses in public and private hospitals
- Post-treatment Lyme disease symptoms score: Developing a new tool for research
- Expression of Concern: The Role of the RACK1 Ortholog Cpc2p in Modulating Pheromone-Induced Cell Cycle Arrest in Fission Yeast
- Equine bronchial fibroblasts enhance proliferation and differentiation of primary equine bronchial epithelial cells co-cultured under air-liquid interface
- Investigating cooperation with robotic peers
- Synthesis, purification and crystallization of a putative critical bulge of HAR1 RNA
- Prosthetic push-off power in trans-tibial amputee level ground walking: A systematic review
- A case study of the use of verbal reports for talent identification purposes in soccer: A Messi affair!
- Transgenerational deep sequencing revealed hypermethylation of hippocampal mGluR1 gene with altered mRNA expression of mGluR5 and mGluR3 associated with behavioral changes in Sprague Dawley rats with history of prolonged febrile seizure
- Obesity is associated with an impaired survival in lymphoma patients undergoing autologous stem cell transplantation
- Periodontal disease: Repercussions in pregnant woman and newborn health—A cohort study
- Origins of Chinese reindeer (Rangifer tarandus) based on mitochondrial DNA analyses
- Regional, racial, gender, and tumor biology disparities in breast cancer survival rates in Africa: A systematic review and meta-analysis
- How effective are films in inducing positive and negative emotional states? A meta-analysis
- 3D nanostructural characterisation of grain boundaries in atom probe data utilising machine learning methods
- An outbreak of tuberculosis in a middle school in Henan, China: Epidemiology and risk factors
- Initial clinical radiological findings and staging to predict prognosis of primary hepatic angiosarcoma: A retrospective analysis
- A new early Eocene deperetellid tapiroid illuminates the origin of Deperetellidae and the pattern of premolar molarization in Perissodactyla
- Longevity and marginal bone loss of narrow-diameter implants supporting single crowns: A systematic review
- Impact of UVC-sustained recirculating air filtration on airborne bacteria and dust in a pig facility
- Cold-related Florida manatee mortality in relation to air and water temperatures
- Conceptual fluency in inductive reasoning
- Clinical outcomes and treatment patterns among Medicare patients with nonvalvular atrial fibrillation (NVAF) and chronic kidney disease
- Improvements in the learnability of smartphone haptic interfaces for visually impaired users
- Role of the malic enzyme in metabolism of the halotolerant methanotroph Methylotuvimicrobium alcaliphilum 20Z
- Cyclic loading test study on a new cast-in-situ insulated sandwich concrete wall
- Natural compounds as angiogenic enzyme thymidine phosphorylase inhibitors: In vitro biochemical inhibition, mechanistic, and in silico modeling studies
- Analysis of virulence potential of Escherichia coli O145 isolated from cattle feces and hide samples based on whole genome sequencing
- Pre-clinical medical student reflections on implicit bias: Implications for learning and teaching
- Prognostic significance of non-sustained ventricular tachycardia on stored electrograms in pacemaker recipients
- Determinants of preterm birth among mothers who gave birth at public hospitals in the Amhara region, Ethiopia: A case-control study
- Real-world evidence of the effectiveness of ombitasvir-paritaprevir/r ± dasabuvir ± ribavirin in patients monoinfected with chronic hepatitis C or coinfected with human immunodeficiency virus-1 in Spain
- Unique transcriptomic landscapes identified in idiopathic spontaneous and infection related preterm births compared to normal term births
- Restrained expansion of the recall germinal center response as biomarker of protection for influenza vaccination in mice
- Arabidopsis TRM5 encodes a nuclear-localised bifunctional tRNA guanine and inosine-N1-methyltransferase that is important for growth
- Achievement of weight loss in patients with overweight during dietetic treatment in primary health care
- Autophagy deficiency exacerbates colitis through excessive oxidative stress and MAPK signaling pathway activation
- The impacts of parity on lung function data (LFD) of healthy females aged 40 years and more issued from an upper middle income country (Algeria): A comparative study
- Reorganization of spatial configurations in visual working memory: A matter of set size?
- Unravelling travellers’ route choice behaviour at full-scale urban network by focusing on representative OD pairs in computer experiments
- Evaluating the higher-order structure of the Profile of Emotional Competence (PEC): Confirmatory factor analysis and Bayesian structural equation modeling
- HIV prevalence and correlated factors among male clients of female sex workers in a border region of China
- Next generation sequencing and RNA-seq characterization of adipose tissue in the Nile crocodile (Crocodylus niloticus) in South Africa: Possible mechanism(s) of pathogenesis and pathophysiology of pansteatitis
- Association between advanced maternal age and maternal and neonatal morbidity: A cross-sectional study on a Spanish population
- Ethnic differences in the prevalence, socioeconomic and health related risk factors of knee pain and osteoarthritis symptoms in older Malaysians
- Increasing knowledge of HIV status in a country with high HIV testing coverage: Results from the Botswana Combination Prevention Project
- Friends with benefits: The effects of vegetative shading on plant survival in a green roof environment
- Comparison of the fecal, cecal, and mucus microbiome in male and female mice after TNBS-induced colitis
- Identifying candidate diagnostic markers for early stage of non-small cell lung cancer
- Complex alternative splicing of human Endonuclease V mRNA, but evidence for only a single protein isoform
- Correction: KML001 Induces Apoptosis and Autophagic Cell Death in Prostate Cancer Cells via Oxidative Stress Pathway
- Unique developmental trajectories of risk behaviors in adolescence and associated outcomes in young adulthood
- Enhanced fibrinolysis detection in a natural occurring canine model with intracavitary effusions: Comparison and degree of agreement between thromboelastometry and FDPs, D-dimer and fibrinogen concentrations
- Overexpression of Saussurea involucrata dehydrin gene SiDHN promotes cold and drought tolerance in transgenic tomato plants
- Foxtail millet (Setaria italica (L.) P. Beauv) CIPKs are responsive to ABA and abiotic stresses
- Autonomous drone hunter operating by deep learning and all-onboard computations in GPS-denied environments
- Heterogeneity Diffusion Imaging of gliomas: Initial experience and validation
- Frequency cluster formation and slow oscillations in neural populations with plasticity
- DHP23002 as a next generation oral paclitaxel formulation for pancreatic cancer therapy
- Diagnostic accuracy of SOX11 immunohistochemistry in mantle cell lymphoma: A meta-analysis
- Analytical solution to swing equations in power grids
- Pathways to conspiracy: The social and linguistic precursors of involvement in Reddit’s conspiracy theory forum
- Spatiotemporally random and diverse grid cell spike patterns contribute to the transformation of grid cell to place cell in a neural network model
- Empathic concern and personal distress depend on situational but not dispositional factors
- Who is more susceptible to job stressors and resources? Sensory-processing sensitivity as a personal resource and vulnerability factor
- Cost-effectiveness of integrating postpartum antiretroviral therapy and infant care into maternal & child health services in South Africa
- A substitution mutation in a conserved domain of mammalian acetate-dependent acetyl CoA synthetase 2 results in destabilized protein and impaired HIF-2 signaling
- One step at a time: Physical activity is linked to positive interpretations of ambiguity
- Calreticulin regulates vascular endothelial growth factor-A mRNA stability in gastric cancer cells
- Evaluation of various methods of selection of B. subtilis strains capable of secreting surface-active compounds
- Association between US Pharmacopeia (USP) monograph standards, generic entry and prescription drug costs
- Molecular characterisation of the synovial fluid microbiome in rheumatoid arthritis patients and healthy control subjects
- On sorption hysteresis in wood: Separating hysteresis in cell wall water and capillary water in the full moisture range
- Inbreeding, Allee effects and stochasticity might be sufficient to account for Neanderthal extinction
- Reliability and construct validity of the stepping-forward affordance perception test for fall risk assessment in community-dwelling older adults
- Socioeconomic determinants of nutritional status among ‘Baiga’ tribal children In Balaghat district of Madhya Pradesh: A qualitative study
- Study on characteristics of fire plume in building facade window under lateral blow
- ‘When you talk to someone in a bad way or always put her under pressure, it is actually worse than beating her’: Conceptions and experiences of emotional intimate partner violence in Rwanda and South Africa
- Effects of 6-mercaptopurine in pressure overload induced right heart failure
- The association between haemoglobin levels in the first 20 weeks of pregnancy and pregnancy outcomes
- Implementation and evaluation of an antimicrobial stewardship programme in companion animal clinics: A stepped-wedge design intervention study
- Factors associated with persistently high-cost health care utilization for musculoskeletal pain
- Nitrogen and chlorophyll status determination in durum wheat as influenced by fertilization and soil management: Preliminary results
- Effect of repeated in vivo microCT imaging on the properties of the mouse tibia
- Coupling environment and physiology to predict effects of climate change on the taxonomic and functional diversity of fish assemblages in the Murray-Darling Basin, Australia
- Hematology and plasma biochemistries in the Blanding’s turtle (Emydoidea blandingii) in Lake County, Illinois
- CRISPR-Cas influences the acquisition of antibiotic resistance in Klebsiella pneumoniae
- Phosphorylation-dependent activity-based conformational changes in P21-activated kinase family members and screening of novel ATP competitive inhibitors
- Antidepressant prescriptions, discontinuation, depression and perinatal outcomes, including breastfeeding: A population cohort analysis
- Why men with a low-risk prostate cancer select and stay on active surveillance: A qualitative study
- Imported severe malaria and risk factors for intensive care: A single-centre retrospective analysis
- Combined treatment (image-guided thrombectomy and endovascular therapy with open femoral access) for acute lower limb ischemia: Clinical efficacy and outcomes
- Low-latency single channel real-time neural spike sorting system based on template matching
- Quantifying the scale effect in geospatial big data using semi-variograms
- Paper-and-pencil versus computerized administration mode: Comparison of data quality and risk behavior prevalence estimates in the European school Survey Project on Alcohol and other Drugs (ESPAD)
- Regression adjusted colocalisation colour mapping (RACC): A novel biological visual analysis method for qualitative colocalisation analysis of 3D fluorescence micrographs
- Ostrich eggshell bead diameter in the Holocene: Regional variation with the spread of herding in eastern and southern Africa
- Spatial and temporal variations in female size at maturity of a Southern Rock Lobster (Jasus edwardsii) population: A likely response to climate change
- Inactive USP14 and inactive UCHL5 cause accumulation of distinct ubiquitinated proteins in mammalian cells
- Training rhesus macaques to take daily oral antiretroviral therapy for preclinical evaluation of HIV prevention and treatment strategies
- Left ventricular structural and functional changes in Friedreich ataxia – Relationship with body size, sex, age and genetic severity
- Magnitude and factors associated with anemia among pregnant women attending antenatal care in Bench Maji, Keffa and Sheka zones of public hospitals, Southwest, Ethiopia, 2018: A cross -sectional study
- Effectiveness of telerehabilitation in the management of adults with stroke: A systematic review
- Hydrogen sulphide-induced hypometabolism in human-sized porcine kidneys
- Correction: Comparison of the molecular properties of retinitis pigmentosa P23H and N15S amino acid replacements in rhodopsin
- Retraction: Regulation of gastric smooth muscle contraction via Ca2+-dependent and Ca2+-independent actin polymerization
- Evaluation of neutral oral contrast agents for assessment of the small bowel at abdominal staging CT
- Blood type and breed-associated differences in cell marker expression on equine bone marrow-derived mesenchymal stem cells including major histocompatibility complex class II antigen expression
- Induced abortion and future use of IVF treatment; A nationwide register study
- Psychosocial determinants of sustained maternal functional impairment: Longitudinal findings from a pregnancy-birth cohort study in rural Pakistan
- Measurement of finger joint angle using stretchable carbon nanotube strain sensor
- Determinants of mortality among patients with drug-resistant tuberculosis in northern Nigeria
- Drugs modulating stochastic gene expression affect the erythroid differentiation process
- Efficacy of UB0316, a multi-strain probiotic formulation in patients with type 2 diabetes mellitus: A double blind, randomized, placebo controlled study
- Prognostic value of des-γ-carboxy prothrombin in patients with hepatocellular carcinoma treated with transarterial chemotherapy: A systematic review and meta-analysis
- Avermectin induces the oxidative stress, genotoxicity, and immunological responses in the Chinese Mitten Crab, Eriocheir sinensis
- Antibiotic use in mandarin production (Citrus reticulata Blanco) in major mandarin-producing areas in Thailand: A survey assessment
- Application of CPI cutoff value based on parentage testing of duos and trios typed by four autosomal kits
- Correction: Good and Bad in the Hands of Politicians: Spontaneous Gestures during Positive and Negative Speech
- Adolescents with worse levels of oral health literacy have more cavitated carious lesions
- Effective methods for the inactivation of Francisella tularensis
- Detection of early-stage Alzheimer’s pathology using blood-based autoantibody biomarkers in elderly hip fracture repair patients
- Correlation between internal pudendal artery stenosis and erectile dysfunction in patients with suspected coronary artery disease
- Analysis of HER2 genomic binding in breast cancer cells identifies a global role in direct gene regulation
- Population productivity of shovelnose rays: Inferring the potential for recovery
- Correction: Long-term clinical outcomes in a cohort of patients with solitary plasmacytoma treated in the modern era
- Effects of tetracycline on myocardial infarct size in obese rats with chemically-induced colitis
- Mineral absorption is an enriched pathway in a brain region of restless legs syndrome patients with reduced MEIS1 expression
- Changes in weight and body composition across five years at university: A prospective observational study
- Adeno-associated virus-mediated expression of human butyrylcholinesterase to treat organophosphate poisoning
- Effects of insulin signaling on mouse taste cell proliferation
- Patient-level cost of home- and facility-based child pneumonia treatment in Suba Sub County, Kenya
- TAP: A static analysis model for PHP vulnerabilities based on token and deep learning technology
- Cost-effectiveness of QuantiFERON-TB Gold In-Tube versus tuberculin skin test for diagnosis and treatment of Latent Tuberculosis Infection in primary health care workers in Brazil
- Multifaceted intervention for the prevention and management of musculoskeletal pain in nursing staff: Results of a cluster randomized controlled trial
- Changes over time in creatinine clearance and comparison of emergent adverse events for HIV-positive adults receiving standard doses (300 mg/day) of lamivudine-containing antiretroviral therapy with baseline creatinine clearance of 30–49 vs ≥50 mL/min
- Population dynamics of foxes during restricted-area culling in Britain: Advancing understanding through state-space modelling of culling records
- Impacts of experimental advisory exit speed sign on traffic speeds for freeway exit ramp
- In-hospital outcomes and 30-day readmission rates among ischemic and hemorrhagic stroke patients with delirium
- Monitoring quality indicators for the Xpert MTB/RIF molecular assay in Ethiopia
- Delivering genes across the blood-brain barrier: LY6A, a novel cellular receptor for AAV-PHP.B capsids
- Correction: Using remote sensing to detect whale strandings in remote areas: The case of sei whales mass mortality in Chilean Patagonia
- Comparison of the inoculum size effects of antibiotics on IMP-6 β-lactamase-producing Enterobacteriaceae co-harboring plasmid-mediated quinolone resistance genes
- Contrast-enhanced computed tomography findings of canine primary renal tumors including renal cell carcinoma, lymphoma, and hemangiosarcoma
- Non-invasive in vivo imaging of UCP1 expression in live mice via near-infrared fluorescent protein iRFP720
- Overexpression of pink1 or parkin in indirect flight muscles promotes mitochondrial proteostasis and extends lifespan in Drosophila melanogaster
- Fiber stiffness, pore size and adhesion control migratory phenotype of MDA-MB-231 cells in collagen gels
- Comparison of two experimental ARDS models in pigs using electrical impedance tomography
- Are primary school children attending full-day school still engaged in sports clubs?
- Stroke risks in women with dysmenorrhea by age and stroke subtype
- Changes in patterns of mortality rates and years of life lost due to firearms in the United States, 1999 to 2016: A joinpoint analysis
- In vitro modeling of Batrachochytrium dendrobatidis infection of the amphibian skin
- Development and validation of LC-MS/MS method for imatinib and norimatinib monitoring by finger-prick DBS in gastrointestinal stromal tumor patients
- Correction: Habitat disturbance and the organization of bacterial communities in Neotropical hematophagous arthropods
- Characterisation of early metazoan secretion through associated signal peptidase complex subunits, prohormone convertases and carboxypeptidases of the marine sponge (Amphimedon queenslandica)
- Time trends between 2002 and 2017 in correlates of self-reported sitting time in European adults
- Performance of patient acuity rating by rapid response team nurses for predicting short-term prognosis
- Changes in HbA1c during the first six years after the diagnosis of Type 2 diabetes mellitus predict long-term microvascular outcomes
- Correction: Antimicrobial resistance genotypes and phenotypes of Campylobacter jejuni isolated in Italy from humans, birds from wild and urban habitats, and poultry
- Correction: Mental health and quality of life outcomes in family members of patients with chronic critical illness admitted to the intensive care units of two Brazilian hospitals serving the extremes of the socioeconomic spectrum
- Correction: Establishing an infrastructure for collaboration in primate cognition research
- Correction: The impact of public health insurance on health care utilisation, financial protection and health status in low- and middle-income countries: A systematic review
- Health provider and service-user experiences of sensory modulation rooms in an acute inpatient psychiatry setting
- Comparison of potential drug-drug interactions with metabolic syndrome medications detected by two databases
- The Polish version of the Cultural Intelligence Scale: Assessment of its reliability and validity among healthcare professionals and medical faculty students
- Selection of optimal reference genes for qRT-PCR analysis of shoot development and graviresponse in prostrate and erect chrysanthemums
- Metastasis risk prediction model in osteosarcoma using metabolic imaging phenotypes: A multivariable radiomics model
- Defining hospital community benefit activities using Delphi technique: A comparison between China and the United States
- Establishment of the experimental procedure for prediction of conjugation capacity in mutant UGT1A1
- A robust multi-objective optimization framework to capture both cellular and intercellular properties in cardiac cellular model tuning: Analyzing different regions of membrane resistance profile in parameter fitting
- Sea star wasting disease demography and etiology in the brooding sea star Leptasterias spp.
- Diagnostic plasma miRNA-profiles for ovarian cancer in patients with pelvic mass
- Genetic diversity and drug resistance of HIV-1 among infected pregnant women newly diagnosed in Luanda, Angola
- I’ve been robbed! – Can changes in floral traits discourage bee pollination?
- Visualising statistical models using dynamic nomograms
- Assessing the capacity of Malawi’s district and central hospitals to manage traumatic diaphyseal femoral fractures in adults
- Diagnostic performance of basal cortisol level at 0900-1300h in adrenal insufficiency
- The Mastery Rubric for Bioinformatics: A tool to support design and evaluation of career-spanning education and training
- Microdissection and whole chromosome painting confirm karyotype transformation in cryptic species of the Lariophagus distinguendus (Förster, 1841) complex (Hymenoptera: Pteromalidae)
- Quality of Kangaroo Mother Care services in Ethiopia: Implications for policy and practice
- Gemcitabine potentiates the anti-tumour effect of radiation on medullary thyroid cancer
- iTRAQ-based high-throughput proteomics analysis reveals alterations of plasma proteins in patients infected with human bocavirus
- The detection of a non-anemophilous plant species using airborne eDNA
- Perception and control of low cable operation forces in voluntary closing body-powered upper-limb prostheses
- Neoadjuvant chemotherapy plus surgery versus concurrent chemoradiotherapy in stage IB2-IIB cervical cancer: A systematic review and meta-analysis
- Randomized methods to characterize large-scale vortical flow networks
- Disentangling the coexistence strategies of mud-daubing wasp species through trophic analysis in oases of Baja California peninsula
- Front-of-pack nutritional labels: Understanding by low- and middle-income Mexican consumers
- Distress in patients with end-stage renal disease: Staff perceptions of barriers to the identification of mild-moderate distress and the provision of emotional support
- Pathways to antibiotics in Bangladesh: A qualitative study investigating how and when households access medicine including antibiotics for humans or animals when they are ill
- DOC export is exceeded by C fixation in May Creek: A late-successional watershed of the Copper River Basin, Alaska
- Behavioral observation of prosocial behavior and social initiative is related to preschoolers’ psychopathological symptoms
- Evaluating the impact of citations of articles based on knowledge flow patterns hidden in the citations
- Correction: Economic sanctions and academia: Overlooked impact and long-term consequences
- Correction: A novel association between relaxin receptor polymorphism and hematopoietic stem cell yield after mobilization
- Expression of Concern: Cooperativity of Oncogenic K-Ras and Downregulated p16/INK4A in Human Pancreatic Tumorigenesis
- Price dispersion of generic medications
- Sex differences in body composition but not neuromuscular function following long-term, doxycycline-induced reduction in circulating levels of myostatin in mice
- The emotion regulation effect of cognitive control is related to depressive state through the mediation of rumination: An ERP study
- Comparison of SMS-EPI and 3D-EPI at 7T in an fMRI localizer study with matched spatiotemporal resolution and homogenized excitation profiles
- Left ventricular mass normalization for body size in children based on an allometrically adjusted ratio is as accurate as normalization based on the centile curves method
- Correction: Combining biophysical parameters, spectral indices and multivariate hyperspectral models for estimating yield and water productivity of spring wheat across different agronomic practices
- Correction: Flowers as viral hot spots: Honey bees (Apis mellifera) unevenly deposit viruses across plant species
- 'Small small quarrels bring about happiness or love in the relationships’: Exploring community perceptions and gendered norms contributing to male perpetrated intimate partner violence in the Central Region of Ghana
- The performance of practitioners conducting facial comparisons on images of children across age
- Increased amounts and stability of telomeric repeat-containing RNA (TERRA) following DNA damage induced by etoposide
- Patients with limitation or withdrawal of life supporting care admitted in a medico-surgical intermediate care unit: Prevalence, description and outcome over a six-month period
- Correction: Diverse radiofrequency sensitivity and radiofrequency effects of mobile or cordless phone near fields exposure in Drosophila melanogaster
- Predicting the performance of TV series through textual and network analysis: The case of Big Bang Theory
- Risk of temperature, humidity and concentrations of air pollutants on the hospitalization of AECOPD
- Mixed methods grant applications in the health sciences: An analysis of reviewer comments
- Renal abnormalities among children with sickle cell conditions in highly resource-limited setting in Ghana
- Size matters: How reaching and vergence movements are influenced by the familiar size of stereoscopically presented objects
- Willingness to receive institutional and community-based eldercare among the rural elderly in China
- An improved deep learning method for predicting DNA-binding proteins based on contextual features in amino acid sequences
- Beyond executive functions, creativity skills benefit academic outcomes: Insights from Montessori education
- A LAMP assay for the rapid and robust assessment of Wolbachia infection in Aedes aegypti under field and laboratory conditions
- Nonarteritic anterior ischemic optic neuropathy is associated with cerebral small vessel disease
- Fiber-tract localized diffusion coefficients highlight patterns of white matter disruption induced by proximity to glioma
- The fight against polio through the NO-DO newsreels during the Francoism period in Spain
- Ocean sound levels in the northeast Pacific recorded from an autonomous underwater glider
- Cost-consequence analysis of influenza vaccination among the staff of a large teaching hospital in Rome, Italy: A pilot study
- The relationship among the progression of inflammation in umbilical cord, fetal inflammatory response, early-onset neonatal sepsis, and chorioamnionitis
- How medical professional students view older people with dementia: Implications for education and practice
- An enhanced nonparametric EWMA sign control chart using sequential mechanism
- Land use change, carbon stocks and tree species diversity in green spaces of a secondary city in Myanmar, Pyin Oo Lwin
- Is there a difference in women’s experiences of care with medication vs. manual vacuum aspiration abortions? Determinants of person-centered care for abortion services
- Maternal complications in pregnancy and childbirth for women with epilepsy: Time trends in a nationwide cohort
- Adsorption of oxytetracycline on kaolinite
- Interdisciplinary stratified care for low back pain: A qualitative study on the acceptability, potential facilitators and barriers to implementation
- The role of resource transfer in positive, non-additive litter decomposition
- The impact of language on the interpretation of resuscitation clinical care plans by doctors. A mixed methods study
- Quantum dots reveal heterogeneous membrane diffusivity and dynamic surface density polarization of dopamine transporter
- Genomic analysis of Shiga toxin-producing Escherichia coli from patients and asymptomatic food handlers in Japan
- The heavy metals lead and cadmium are cytotoxic to human bone osteoblasts via induction of redox stress
- Anatomical, taxonomic, and phylogenetic reappraisal of a poorly known ghost knifefish, Tembeassu marauna (Ostariophysi: Gymnotiformes), using X-ray microcomputed tomography
- Matrix-assisted laser desorption/ionization time of flight mass spectrometry identification of Vibrio (Listonella) anguillarum isolated from sea bass and sea bream
- Recommendations of older adults on how to use the PROM ‘TOPICS-MDS’ in healthcare conversations: A Delphi study
- The winner takes it all—Competitiveness of single nodes in globalized supply networks
- Hamsters in the city: A study on the behaviour of a population of common hamsters (Cricetus cricetus) in urban environment
- Correction: Liquid biopsies for omics-based analysis in sentinel mussels
- Size matters! Association between journal size and longitudinal variability of the Journal Impact Factor
- Drug resistance and epidemiology characteristics of multidrug-resistant tuberculosis patients in 17 provinces of China
- A model-based framework for chronic hepatitis C prevalence estimation
- Adding rewards to regulation: The impacts of watershed conservation on land cover and household wellbeing in Moyobamba, Peru
- Clinical determinants of social media use in individuals with schizophrenia
- Arsenic and nutrient absorption characteristics and antioxidant response in different leaves of two ryegrass (Lolium perenne) species under arsenic stress
- An evolution of socioeconomic related inequality in teenage pregnancy and childbearing in Malawi
- A single plasmid based CRISPR interference in Synechocystis 6803 – A proof of concept
- Structural vulnerability to narcotics-driven firearm violence: An ethnographic and epidemiological study of Philadelphia’s Puerto Rican inner-city
- Temporal trends in intracerebral hemorrhage: Evidence from the Austrian Stroke Unit Registry
- Prevalence and risk factors for multi-drug resistant Escherichia coli among poultry workers in the Federal Capital Territory, Abuja, Nigeria
- Prediction of disease-related metabolites using bi-random walks
- Clinical use, efficacy, and durability of maraviroc for antiretroviral therapy in routine care: A European survey
- Biomarker discovery in inflammatory bowel diseases using network-based feature selection
- The Cinderella Complex: Word embeddings reveal gender stereotypes in movies and books
- Exoproteome profiling of Trypanosoma cruzi during amastigogenesis early stages
- Reproducible phenotype alteration due to prolonged cooling of the pupae of Polyommatus icarus butterflies
- Nutritional treatment with an immune-modulating enteral formula alleviates 5-fluorouracil-induced adverse effects in rats
- Pharmacy-based predictors of non-adherence, non-persistence and reinitiation of antihypertensive drugs among patients on oral diabetes drugs in the Netherlands
- Systematic review of the accuracy of plasma preparation tubes for HIV viral load testing
- Circadian clock regulates the shape and content of dendritic spines in mouse barrel cortex
- “Anybody can make kids; it takes a real man to look after your kids”: Aboriginal men’s discourse on parenting
- Correction: A 1D computer model of the arterial circulation in horses: An important resource for studying global interactions between heart and vessels under normal and pathological conditions
- Maternal interpregnancy weight change and premature birth: Findings from an English population-based cohort study
- Correction: Identifying performance benchmarks and determinants for reproductive performance and calf survival using a longitudinal field study of cow-calf herds in western Canada
- Prognostic value of the model for end-stage liver disease excluding INR score (MELD-XI) in patients with adult congenital heart disease
- Treatment of Urethral Pain Syndrome (UPS) in Sweden
- Migration and political polarization in the U.S.: An analysis of the county-level migration network
- Epidemiology and complications of late-onset sepsis: an Italian area-based study
- The relationship between women’s experience of intimate partner violence and other socio-demographic factors, and under-5 children’s health in South Africa
- Association between trunk and gluteus muscle size and long jump performance
- Multimorbidity and complex multimorbidity in Brazilian rural workers
- Correction: Interspecific Phylogenic Relationships within Genus Melilotus Based on Nuclear and Chloroplast DNA
- Insulin-like growth factor (IGF)-II- mediated fibrosis in pathogenic lung conditions
- Wolf diet and prey selection in the South-Eastern Carpathian Mountains, Romania
- In vitro activity of aryl-thiazole derivatives against Schistosoma mansoni schistosomula and adult worms
- Sample size issues in multilevel logistic regression models
- Seed germination ecology of Ageratum houstonianum: A major invasive weed in Nepal
- Experiences of lifestyle change among women with gestational diabetes mellitus (GDM): A behavioural diagnosis using the COM-B model in a low-income setting
- Pharmacologic management of HCV treatment in patients with HCV monoinfection vs. HIV/HCV coinfection: Does coinfection really matter?
- The association between cigarette smoking and serum thyroid stimulating hormone, thyroid peroxidase antibodies and thyroglobulin antibodies levels in Chinese residents: A cross-sectional study in 10 cities
- Mouse movement measures enhance the stop-signal task in adult ADHD assessment
- Ecosystem functioning in urban grasslands: The role of biodiversity, plant invasions and urbanization
- Correction: KETOS: Clinical decision support and machine learning as a service – A training and deployment platform based on Docker, OMOP-CDM, and FHIR Web Services
- Does craniofacial morphology affect third molars impaction? Results from a population-based study in northeastern Germany
- Hyperconnectivity during screen-based stories listening is associated with lower narrative comprehension in preschool children exposed to screens vs dialogic reading: An EEG study
- Weight loss is associated with improved quality of life among rural women completers of a web-based lifestyle intervention
- Long-term high-grain diet altered the ruminal pH, fermentation, and composition and functions of the rumen bacterial community, leading to enhanced lactic acid production in Japanese Black beef cattle during fattening
- Beyond detoxification: Pleiotropic functions of multiple glutathione S-transferase isoforms protect mice against a toxic electrophile
- Golgi reassembly and stacking protein 65 downregulation is required for the anti-cancer effect of dihydromyricetin on human ovarian cancer cells
- SSR marker development in Clerodendrum trichotomum using transcriptome sequencing
- Risk factors for the carriage of Streptococcus infantarius subspecies infantarius isolated from African fermented dairy products
- Development of an intervention tool for precision oral self-care: Personalized and evidence-based practice for patients with periodontal disease
- Personal values in adolescence and psychological distress in adults: A cross-sectional study based on a retrospective recall
- Overactive bladder and bladder pain syndrome/interstitial cystitis in primary Sjögren’s syndrome patients: A nationwide population-based study
- Clinical utility of combined preimplantation genetic testing methods in couples at risk of passing on beta thalassemia/hemoglobin E disease: A retrospective review from a single center
- Hip stress distribution - Predictor of dislocation in hip arthroplasties. A retrospective study of 149 arthroplasties
- Mortality, morbidity, and cardiac surgery in Injection Drug Use (IDU)-associated versus non-IDU infective endocarditis: The need to expand substance use disorder treatment and harm reduction services
- Pup mortality in New Zealand sea lions (Phocarctos hookeri) at Enderby Island, Auckland Islands, 2013-18
- In vitro endothelial cell migration from limbal edge-modified Quarter-DMEK grafts
- Liquid Chromatography/Mass Spectrometry based serum metabolomics study on recurrent abortion women with antiphospholipid syndrome
- Gut carriage of antimicrobial resistance genes among young children in urban Maputo, Mozambique: Associations with enteric pathogen carriage and environmental risk factors
- Prepubertal nutrition alters Leydig cell functional capacity and timing of puberty
- Reliability of the Swedish version of the Evidence-Based Practice Attitude Scale assessing physiotherapist’s attitudes to implementation of evidence-based practice
- Mitochondrial alarmins are tissue mediators of ventilator-induced lung injury and ARDS
- Complete Chloroplast Genomes of Vachellia nilotica and Senegalia senegal: Comparative Genomics and Phylogenomic Placement in a New Generic System
- Retraction: Over-Expression of Superoxide Dismutase Ameliorates Cr(VI) Induced Adverse Effects via Modulating Cellular Immune System of Drosophila melanogaster
- Effect of pre-season training phase on anthropometric, hormonal and fitness parameters in young soccer players
- Exosomes from conditioned media of bone marrow-derived mesenchymal stem cells promote bone regeneration by enhancing angiogenesis
- Outcome of patients with heart failure after transcatheter aortic valve implantation
- Fatty acid profile of Romanian’s common bean (Phaseolus vulgaris L.) lipid fractions and their complexation ability by β-cyclodextrin
- Appropriate empirical antibiotic therapy and mortality: Conflicting data explained by residual confounding
- Treatment of corneal endothelial damage in a rabbit model with a bioengineered graft using human decellularized corneal lamina and cultured human corneal endothelium
- Telbivudine on IgG-associated hypergammaglobulinemia and TGF-β1 hyperactivity in hepatitis B virus-related liver cirrhosis
- Correction: Axial variation of deoxyhemoglobin density as a source of the low-frequency time lag structure in blood oxygenation level-dependent signals
- Correction: Mobile health-based physical activity intervention for individuals with spinal cord injury in the community: A pilot study
- Retraction: Placental expression of CD100, CD72 and CD45 is dysregulated in human miscarriage
- Correction: Use of IoT sensing and occupant surveys for determining the resilience of buildings to forest fire generated PM2.5
- Correction: The modulation of facial mimicry by attachment tendencies and their underlying affiliation motives in 3-year-olds: An EMG study
- Correction: Cognitive impairment in multiple sclerosis: An exploratory analysis of environmental and lifestyle risk factors
- Discovering novel disease comorbidities using electronic medical records
- Glutathione contributes to efficient post-Golgi trafficking of incoming HPV16 genome
- Epidemiology and antimicrobial resistance of methicillin-resistant Staphylococcus aureus isolates colonizing pigs with different exposure to antibiotics
- Social information use in adolescents: The impact of adults, peers and household composition
- Public practices on antibiotic use: A cross-sectional study among Qatar University students and their family members
- Effects of Topper Training on psychosocial problems, self-esteem, and peer victimisation in Dutch children: A randomised trial
- Comparative studies of two generations of NanoString nCounter System
- General practitioners’ perceptions of delayed antibiotic prescription for respiratory tract infections: A phenomenographic study
- Can altered magnetic field affect the foraging behaviour of ants?
- Parasitic infections and medical expenses according to Health Insurance Review Assessment claims data in South Korea, 2011–2018
- A prospective observational study of on-treatment plasma homocysteine levels as a biomarker of toxicity, depression and vitamin supplementation lead-in time pre pemetrexed, in patients with non-small cell lung cancer and malignant mesothelioma
- A strategy to identify protein-N-myristoylation-dependent phosphorylation reactions of cellular proteins by using Phos-tag SDS-PAGE
- Expression profile of sonic hedgehog signaling-related molecules in basal cell carcinoma
- Seasonal alternation of the ontogenetic development of the moon jellyfish Aurelia coerulea in Maizuru Bay, Japan
- Reliability of measurement of active trunk movement in wheelchair basketball players
- Chinese SLE Treatment and Research group (CSTAR) registry: Clinical significance of thrombocytopenia in Chinese patients with systemic lupus erythematosus
- Does source credibility matter for point-of-decision prompts? A quasi-experimental field study to increase stair use
- Male-pattern baldness and incident coronary heart disease and risk factors in the Heinz Nixdorf Recall Study
- Quality and utilization patterns of maternity waiting homes at referral facilities in rural Zambia: A mixed-methods multiple case analysis of intervention and standard of care sites
- Determining an optimal pool size for testing beef herds for Johne’s disease in Australia
- Correction: Change in larval fish assemblage in a USA east coast estuary estimated from twenty-six years of fixed weekly sampling
- APOE-knockout in rabbits causes loss of cells in nucleus pulposus and enhances the levels of inflammatory catabolic cytokines damaging the intervertebral disc matrix
- Testing Species Assignments in Extant Terebratulide Brachiopods: A Three-dimensional Geometric Morphometric Analysis of Long-Looped Brachidia
- A daily diary study on maladaptive daydreaming, mind wandering, and sleep disturbances: Examining within-person and between-persons relations
- Improved chemotherapy modeling with RAG-based immune deficient mice
- Effect of tracheal antimicrobial peptide on the development of Mannheimia haemolytica pneumonia in cattle
- The internal realities of individuals with type 2 diabetes – a functional framework of self-management practices via Grounded Theory approach
- Role of platelet parameters in early detection and prediction of severity of preeclampsia: A comparative cross-sectional study at Ayder comprehensive specialized and Mekelle general hospitals, Mekelle, Tigray, Ethiopia
- eIF4E and 4EBP1 are prognostic markers of head and neck squamous cell carcinoma recurrence after definitive surgery and adjuvant radiotherapy
- Smoking and other determinants of bone turnover
- Oxygen delivery, oxygen consumption and decreased kidney function after cardiopulmonary bypass
- School engagement of children in early grades: Psychometric, and gender comparisons
- Correction: A review of the elusive bicolored iris Snouted Treefrogs (Anura: Hylidae:Scinax uruguayus group)
- Perceived attractiveness of Czech faces across 10 cultures: Associations with sexual shape dimorphism, averageness, fluctuating asymmetry, and eye color
- Discovery of stable and prognostic CT-based radiomic features independent of contrast administration and dimensionality in oesophageal cancer
- Correction: Population-based dementia prediction model using Korean public health examination data: A cohort study
- Location, location, location: Close ties among older continuing care retirement community residents
- Correction: ISED: Constructing a high-resolution elevation road dataset from massive, low-quality in-situ observations derived from geosocial fitness tracking data
- Correction: Use of validated objective methods of locomotion characteristics and weight distribution for evaluating the efficacy of ketoprofen for alleviating pain in cows with limb pathologies
- Monitoring fine root growth to identify optimal fertilization timing in a forest plantation: A case study in Northeast Vietnam
- Metabolic costs of spontaneous swimming in Sprattus sprattus L., at different water temperatures
- Enterovirus 71 vaccine acceptance among parents of children < 5 years old and their knowledge of hand, foot and mouth disease, Chongqing, China, 2017
- Correction: Transcriptome profiling of mouse brain and lung under Dip2a regulation using RNA-sequencing
- Genetic diversity and antiretroviral resistance-associated mutation profile of treated and naive HIV-1 infected patients from the Northwest and Southwest regions of Cameroon
- Maximum parsimony interpretation of chromatin capture experiments
- Multiple innate antibacterial immune defense elements are correlated in diverse ungulate species
- Incidence and characteristics of ventricular tachycardia in patients after percutaneous coronary revascularization of chronic total occlusions
- Estimating measures of latent variables from m-alternative forced choice responses
- Clade F AAVHSCs cross the blood brain barrier and transduce the central nervous system in addition to peripheral tissues following intravenous administration in nonhuman primates
- First evidence of hepatitis E virus infection in a small mammal (yellow-necked mouse) from Croatia
- The inhibitory effects of polypyrrole on the biofilm formation of Streptococcus mutans
- Self-reported adverse drug effects and associated factors among H. pylori infected patients on standard triple therapy: Prospective follow up study
- Upregulation of ERK phosphorylation in rat dorsal root ganglion neurons contributes to oxaliplatin-induced chronic neuropathic pain
- Characterization of the relationship between neutron production and thermal load on a target material in an accelerator-based boron neutron capture therapy system employing a solid-state Li target
- Remote heart rate monitoring - Assessment of the Facereader rPPg by Noldus
- Seroprevalence of rubella virus antibodies among pregnant women in the Center and South-West regions of Cameroon
- Effectiveness of steam sterilization of reusable medical devices in primary and secondary care public hospitals in Nepal and factors associated with ineffective sterilization: A nation-wide cross-sectional study
- Relevance of HTLV-1 proviral load in asymptomatic and symptomatic patients living in endemic and non-endemic areas of Argentina
- Ritualized aggressive behavior reveals distinct social structures in native and introduced range tawny crazy ants
- The value of kinetic glomerular filtration rate estimation on medication dosing in acute kidney injury
- Screening and characterization of long noncoding RNAs involved in the albinism of Ananas comosus var. bracteatus leaves
- Visual attention to emotional faces in adolescents with social anxiety disorder receiving cognitive behavioral therapy
- A Q fever outbreak associated to courier transport of pets
- Antibodies against measles and rubella virus among different age groups in Thailand: A population-based serological survey
- Molecular diet analysis of Anguilliformes leptocephalus larvae collected in the western North Pacific
- Correction: The relationship between context, structure, and processes with outcomes of 6 regional diabetes networks in Europe
- Correction: The C-reactive protein/albumin ratio as an independent predictor of mortality in patients with severe sepsis or septic shock treated with early goal-directed therapy
- Interleukin 21 (IL-21) regulates chronic allograft vasculopathy (CAV) in murine heart allograft rejection
- Semantic computational analysis of anticoagulation use in atrial fibrillation from real world data
- The implementation of HTA in medicine pricing and reimbursement policies in Indonesia: Insights from multiple stakeholders
- International experiences during United States ophthalmology residency training: Current structure of international experiences and perspectives of faculty mentors at United States training institutions
- Questionable utility of digoxin in left-ventricular assist device recipients: A multicenter, retrospective analysis
- Genotyping and outcomes of presumptive second line ART failure cases switched to third line or maintained on second line ART in Mumbai, India
- A mathematical model of honey bee colony dynamics to predict the effect of pollen on colony failure
- Airway microbiome composition correlates with lung function and arterial stiffness in an age-dependent manner
- An odorant receptor from Anopheles gambiae that demonstrates enantioselectivity to the plant volatile, linalool
- Factors associated with full immunization of children 12–23 months of age in Ethiopia: A multilevel analysis using 2016 Ethiopia Demographic and Health Survey
- Additional evidence that the rat renal interstitium contracts in vivo
- Factors affecting acceptance of at-birth point of care HIV testing among providers and parents in Kenya: A qualitative study
- Removal efficiency of central vacuum system and protective masks to suspended particles from dental treatment
- Psychological well-being and distress in patients with generalized anxiety disorder: The roles of positive and negative functioning
- Conventional rotator cuff versus all-suture anchors—A biomechanical study focusing on the insertion angle in an unlimited cyclic model
- Are viral-infections associated with Ménière’s Disease? A systematic review and meta-analysis of molecular-markers of viral-infection in case-controlled observational studies of MD
- An evaluation of genetic causes and environmental risks for bilateral optic atrophy
- Comparative vector competence of the Afrotropical soft tick Ornithodoros moubata and Palearctic species, O. erraticus and O. verrucosus, for African swine fever virus strains circulating in Eurasia
- Effects of the solubility of yeast cell wall preparations on their potential prebiotic properties in dogs
- Carbogen gas-challenge BOLD fMRI in assessment of liver hypoxia after portal microcapsules implantation
- Socioeconomic determinants of cancer screening utilisation in Latin America: A systematic review
- Development of an easy-to-use questionnaire assessing critical care nursing competence in Japan: A cross-sectional study
- Towards successful business process improvement – An extension of change acceleration process model
- Correction: Dietary polyphenols as a safe and novel intervention for modulating pain associated with intervertebral disc degeneration in an in-vivo rat model
- Correction: Phylogenetic analysis of hepatitis C virus among HIV/ HCV co-infected patients in Nigeria
- Correction: Relationship between self-disclosure to first acquaintances and subjective well-being in people with schizophrenia spectrum disorders living in the community
- Impact of ATM rs1801516 on late skin reactions of radiotherapy for breast cancer: Evidences from a cohort study and a trial sequential meta-analysis
- Involvement of human and canine MRP1 and MRP4 in benzylpenicillin transport
- Soil organic matter rather than ectomycorrhizal diversity is related to urban tree health
- Clinical risk assessment in early pregnancy for preeclampsia in nulliparous women: A population based cohort study
- The relation between circulating levels of vitamin D and parathyroid hormone in children and adolescents with overweight or obesity: Quest for a threshold
- Behavioural evidence for segments as subordinate units in Chinese spoken word production: The form-preparation paradigm revisited
- Correction: Measuring the impact of an interdisciplinary learning project on nursing, architecture and landscape design students’ empathy
- Analysis of the characteristics of chemotherapy-resistant renal cell carcinomas based on global transcriptional analysis of their tissues and cell lines
- The characteristics and treatment patterns of patients with Parkinson’s disease in the United States and United Kingdom: A retrospective cohort study
- Sex differences in youth elite swimming
- Unconventional SCCmec types and low prevalence of the Panton-Valentine Leukocidin exotoxin in South African blood culture Staphylococcus aureus surveillance isolates, 2013-2016
- Prosocial perceptions of taxation predict support for taxes
- Correction: Clonality analysis of pulmonary tumors by genome-wide copy number profiling
- Improved oxygenation following methylprednisolone therapy and survival in paediatric acute respiratory distress syndrome
- Normative values for relative schoolbag weight in primary school children aged 6-14 from Czech Republic: A pilot study
- Correction: Intensive longitudinal modelling predicts diurnal activity of salivary alpha-amylase
- Correction: SNV discovery and functional candidate gene identification for milk composition based on whole genome resequencing of Holstein bulls with extremely high and low breeding values
- Monoclonal antibody anti-PBP2a protects mice against MRSA (methicillin-resistant Staphylococcus aureus) infections
- Diurnal variations of amplitude of accommodation in different age groups
- HHIP overexpression inhibits the proliferation, migration and invasion of non-small cell lung cancer
- Infusion of HIV-1 Nef-expressing astrocytes into the rat hippocampus induces enteropathy and interstitial pneumonitis and increases blood–brain-barrier permeability
- Correlation analysis of cold-related gene expression with physiological and biochemical indicators under cold stress in oil palm
- Student engagement and wellbeing over time at a higher education institution
- Gender-based differences in platelet function and platelet reactivity to P2Y12 inhibitors
- Influence of season and social context on male giant panda (Ailuropoda melanoleuca) vocal behaviour
- Development of an intravaginal ring for the topical delivery of Aurora kinase A inhibitor, MLN8237
- Differential phosphorylation determines the repressor and activator potencies of GLI1 proteins and their efficiency in modulating the HPV life cycle
- Polymorphisms of FDPS, LRP5, SOST and VKORC1 genes and their relation with osteoporosis in postmenopausal Romanian women
- Depression increases the risk of rotator cuff tear and rotator cuff repair surgery: A nationwide population-based study
- Interleukin-38 interacts with destrin/actin-depolymerizing factor in human keratinocytes
- Correction: Fast, quantitative, murine cardiac 19F MRI/MRS of PFCE-labeled progenitor stem cells and macrophages at 9.4T
- Persistent post-discharge opioid prescribing after traumatic brain injury requiring intensive care unit admission: A cross-sectional study with longitudinal outcome
- Genome-wide histone modification profiling of inner cell mass and trophectoderm of bovine blastocysts by RAT-ChIP
- Aerobic exercise increases post-exercise exogenous protein oxidation in healthy young males
- Selection for tandem stop codons in ciliate species with reassigned stop codons
- Research ethics in inter- and multi-disciplinary teams: Differences in disciplinary interpretations
- Correction: Analyzing data from the digital healthcare exchange platform for surveillance of antibiotic prescriptions in primary care in urban Kenya: A mixed-methods study
- Correction: People making deontological judgments in the Trapdoor dilemma are perceived to be more prosocial in economic games than they actually are
- LFRET, a novel rapid assay for anti-tissue transglutaminase antibody detection
- Effects of isotemporal substitution of sedentary behavior with light-intensity or moderate-to-vigorous physical activity on cardiometabolic markers in male adolescents
- Topical estrogen application to wounds promotes delayed cutaneous wound healing in 80-week-old female mice
- Correction: An international randomised placebo-controlled trial of a four-component combination pill (“polypill”) in people with raised cardiovascular risk
- Correction: Evaluation of lung toxicity risk with computed tomography ventilation image for thoracic cancer patients
- Retraction: Pathological Roles of Interleukin-22 in the Development of Recurrent Hepatitis C after Liver Transplantation
- Correction: Elevational Distribution and Ecology of Small Mammals on Tanzania's Second Highest Mountain
- Correction: Decreased breast cancer-specific mortality risk in patients with a history of thyroid cancer
- Correction: Fecal microbiota dysbiosis in macaques and humans within a shared environment
- Correction: The center of pressure and ankle muscle co-contraction in response to anterior-posterior perturbations
- PLOS One
- Archiv čísel
- Aktuální číslo
- Informace o časopisu
Nejčtenější v tomto čísle- A daily diary study on maladaptive daydreaming, mind wandering, and sleep disturbances: Examining within-person and between-persons relations
- Pathways to conspiracy: The social and linguistic precursors of involvement in Reddit’s conspiracy theory forum
- A 3’ UTR SNP rs885863, a cis-eQTL for the circadian gene VIPR2 and lincRNA 689, is associated with opioid addiction
- A substitution mutation in a conserved domain of mammalian acetate-dependent acetyl CoA synthetase 2 results in destabilized protein and impaired HIF-2 signaling
Kurzy
Zvyšte si kvalifikaci online z pohodlí domova
Revma Focus: Spondyloartritidy
nový kurz
Autoři: doc. MUDr. Norbert Pauk, Ph.D.
Autoři: prof. MUDr. Vladimír Palička, CSc., Dr.h.c., doc. MUDr. Václav Vyskočil, Ph.D., MUDr. Petr Kasalický, CSc., MUDr. Jan Rosa, Ing. Pavel Havlík, Ing. Jan Adam, Hana Hejnová, DiS., Jana Křenková
Autoři: MUDr. Irena Krčmová, CSc.
Všechny kurzyPřihlášení#ADS_BOTTOM_SCRIPTS#Zapomenuté hesloZadejte e-mailovou adresu, se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.
- Vzdělávání