-
Články
- Vzdělávání
- Časopisy
Top články
Nové číslo
- Témata
- Kongresy
- Videa
- Podcasty
Nové podcasty
Reklama- Kariéra
Doporučené pozice
Reklama- Praxe
Retinoic acid-stimulated ERK1/2 pathway regulates meiotic initiation in cultured fetal germ cells
Authors: Sung-Min Kim aff001; Toshifumi Yokoyama aff001; Dylan Ng aff001; Ferhat Ulu aff001; Yukiko Yamazaki aff001
Authors place of work: Institute for Biogenesis Research, John A. Burns School of Medicine, University of Hawaii, Honolulu, HI, United States of America aff001; Department of Animal Science, Kobe University, Kobe, Hyogo, Japan aff002
Published in the journal: PLoS ONE 14(11)
Category: Research Article
doi: https://doi.org/10.1371/journal.pone.0224628Summary
In murine fetal germ cells, retinoic acid (RA) is an extrinsic cue for meiotic initiation that stimulates transcriptional activation of the Stimulated by retinoic acid gene 8 (Stra8), which is required for entry of germ cells into meiotic prophase I. Canonically, the biological activities of RA are mediated by nuclear RA receptors. Recent studies in somatic cells found that RA noncanonically stimulates intracellular signal transduction pathways to regulate multiple cellular processes. In this study, using a germ cell culture system, we investigated (1) whether RA treatment activates any mitogen-activated protein kinase (MAPK) pathways in fetal germ cells at the time of sex differentiation, and (2) if this is the case, whether the corresponding RA-stimulated signaling pathway regulates Stra8 expression in fetal germ cells and their entry into meiosis. When XX germ cells at embryonic day (E) 12.5 were cultured with RA, the extracellular-signal-regulated kinase (ERK) 1/2 pathway was predominantly activated. MEK1/2 inhibitor (U0126) treatment suppressed the mRNA expressions of RA-induced Stra8 and meiotic marker genes (Rec8, Spo11, Dmc1, and Sycp3) in both XX and XY fetal germ cells. Furthermore, U0126 treatment dramatically reduced STRA8 protein levels and numbers of meiotic cells among cultured XX and XY fetal germ cells even in the presence of RA. Taken together, our results suggest the novel concept that the RA functions by stimulating the ERK1/2 pathway and that this activity is critical for Stra8 expression and meiotic progression in fetal germ cells.
Keywords:
Gene expression – Gonads – Meiosis – signal transduction – Protein expression – Germ cells – Phosphorylation – MAPK signaling cascades
Introduction
Primordial germ cells (PGCs) are the embryonic precursors of oogonia and prospermatogonia in mammals. In mouse fetuses, early-stage PGCs continue to proliferate mitotically and migrate through the somatic tissues to eventually colonize the gonads at approximately embryonic day (E) 10.5. In the gonads, fetal germ cells are induced to undergo sex differentiation depending on the somatic gonadal environment rather than on their sex chromosome constitution. A common feature of female-specific sex differentiation in developing ovaries is entry into meiosis. Thus, in an ovarian environment, XX germ cells immediately enter meiotic prophase I at E12.5–13.5 and proceed to the diplotene stage by E17.5 [1–3]. However, in a testicular environment, XY germ cells at E13.5–15.5 are blocked from initiating meiosis. Thus, XY germ cells give rise to M prospermatogonia, which continues to expand mitotically before entering a mitotically quiescent G0/G1 stage of the cell cycle as T1 prospermatogonia [3,4]. After birth, male germ cells resume mitotic proliferation as T2 prospermatogonia and spermatogonia, and subsequently initiate meiosis at about 8–10 days postpartum (dpp) [3–5].
Although the timing of meiotic entry exhibits distinct differences during oogenesis and spermatogenesis, all-trans retinoic acid (RA) has been widely recognized as a key regulator of entry into meiosis in both male and female germ cells [6–10]. Multiple studies have shown that RA treatment can induce PGCs in E11.5 male genital ridges or isolated XY germ cells at E12.5–14.5 to initiate entry into meiosis [6,7,11–14]. In germ cells of either sex, RA stimulates the expression of Stimulated by retinoic acid (Stra8), a meiotic “gatekeeper” gene by controlling the switch from mitosis to meiosis [7–9,15]. Studies with a Stra8-defecient mouse model demonstrated that Stra8 is required for premeiotic DNA replication and the subsequent events of meiotic prophase in female germ cells [15,16]. In XX germ cells, Stra8 is expressed at E12.5 before these cells enter meiotic prophase I [17]. Previous studies have shown a clear connection between RA and Stra8 expression in fetal germ cells [6,7,13,18]; however, although multiple lines of evidence reinforce the importance of the molecular connection between RA and Stra8, it remains unclear how RA regulates Stra8 expression in germ cells.
In mammalian cells, RA plays multiple key roles in proliferation [19,20], apoptosis [21] and differentiation [22]. Canonically, the biological activity of RA signaling is mediated by nuclear RA receptors (RAR α, β and γ) [23]. In the cytoplasm, RA molecules bind to cellular RA-binding proteins (CRABPs), move to the nucleus, and directly bind to RARs. Nuclear RARs form heterodimers with retinoid X receptors (RXR α, β and γ) to function as ligand-dependent transcriptional regulators. The RAR/RXR heterodimers interact with RA response elements (RAREs) localized in the promoter regions of RA target genes, which, in turn, activates their transcription [24]. This classical RA-signaling mechanism represents the canonical activity of RA.
Stra8 is one of the RA target genes, and its promoter region contains putative RAREs, [9,25–27]. Using a chromatin immunoprecipitation (ChIP) assay, it has been shown that RARs directly bind to the RAREs at the Stra8 promoter region in the postnatal mouse testis [9]. Furthermore, numerous pharmacological approaches have shown successful inhibition of Stra8 expression by RAR antagonists, resulting in subsequent inhibition of initiation of meiosis in fetal germ cells [6,7,11]. These previous studies suggest that the transcriptional expression of RA-induced Stra8 is controlled by the canonical activity of RA mediated via nuclear RARs in germ cells.
Recent studies have reported that RA signaling is also mediated by intracellular signal transduction pathways that do not rely upon binding to the nuclear RARs (noncanonical activity of RA) [28, 29]. In the cytoplasm, RA stimulates signal transduction pathways such as the mitogen-activated protein kinase (MAPK) [29], protein kinase C (PKC) [30] and AKT pathways [31]. Particularly, the MAPK pathways, including the extracellular signal-regulated kinase (ERK) 1/2 and p38 MAPK, are major targets of the noncanonical activity of RA [28,29]. These studies have demonstrated that the noncanonical activity of RA appears to contribute to different mechanisms and kinase cascades in different types of somatic cells [20–22,32–39]. Importantly, the activation of these multiple kinase cascades contributes to the transcriptional activity of RA target genes [37]. In germ cells, recent studies have also suggested that RA-induced meiotic initiation is mediated by intracellular signal transduction pathways [40, 41]. Pellegrini et al. (2008) reported that RA activates Kit phosphorylation and its downstream signaling pathways, PI3K and MAPK, to induce meiotic entry of postnatal mouse spermatogonia [40]. It was also suggested that JNK signaling contributes to meiosis associated gene expression [41]. However, it is still unclear if the biological activity of RA is mediated by any specific signal transduction pathway controlling Stra8 expression in fetal germ cells. In this study, using a germ cell culture system, we investigated (1) whether RA activates any MAPK pathways (ERK1/2, p38 MAPK and JNK) in fetal germ cells, and (2) if this is the case, whether the corresponding RA-stimulated signal pathway(s) regulate(s) Stra8 expression and following entry into meiosis in fetal germ cells. Our results indicate that RA predominantly activates the ERK1/2 pathway to control Stra8 expression and meiotic initiation in fetal germ cells in vitro.
Materials and methods
Mice
Mice carrying a Pou5f1-green fluorescent protein (GFP) transgene (Tg OG2) were generated by microinjecting (CBA/Caj X C57BL/6J) F2 zygotes and expressing germ cell-specific GFP driven by the pou5fl gene promoter/enhancer (a generous gift from Dr. Jeff R. Mann, University of Melbourne, Melbourne, VIC, Australia) [42]. CD-1 female mice (Charles River, San Diego, CA, USA) were mated with Tg OG2 homozygous males to produce (CD-1 X OG2) F1 hybrid fetuses. For all experiments, GFP-positive germ cells were isolated from these F1 fetuses (see below). All experiments involving mice were reviewed and approved in advance by the Institutional Animal Care and Use Committee of the University of Hawaii and all procedures were in accordance with the guidelines recommended by the National Institute of Health.
Media
Gonads were dissected in Hepes-Dulbecco’s Modified Eagle Medium (DMEM; Invitrogen, Carlsbad, CA, USA) supplemented with 15% fetal bovine serum (FBS; Hyclone Laboratories, Logan, UT, USA). For germ cell culture, sorted germ cells were cultured in a basic medium (high-glucose DMEM supplemented with 0.1 mM nonessential amino acids, 0.1 mM 2-merkaptoethanol, 100 IU/ml penicillin, 100 μg/ml streptomycin, 2 mM glutamine and 1 mM sodium pyruvate) supplemented with 15% FBS, with or without 1 μM all-trans RA (Sigma-Aldrich, St. Louis, MO, USA) and/or MEK1/2 inhibitor (U0126; Cayman Chemical Company, Ann Arbor, MI, USA) at 10, 20 or 50 μM. For gonadal culture experiments, the tissues were cultured with a basic medium with or without 50 μM MEK1/2 inhibitor (U0126).
Culture of fetal germ cells
XY and XX germ cells were freshly isolated from male or female gonads, respectively, at E11.5, 12.5, 13.5, 14.5 and 15.5, as described previously [43]. The sexes of E11.5 fetuses were determined by germ cell amplification of genomic DNA for the Sry gene, using specific primers (5’-CTGTGTAGGATCTTCAATCTCT-3’ and 5’-GTGGTGAGAGGCACAAGTTGGC-3’) [44]. Briefly, male and female gonads were dissected in Hepes-DMEM supplemented with 15% FBS and incubated in 0.2% Collagenase (Calbiochem, San Diego, CA, USA) and Accumax (Innovative Cell Technologies, San Diego, CA, USA) for 10 min each at 37°C. After enzymatic treatment, gonads were dissociated with pipetting and filtered through a 30 μm filter (Sysmex America, Lincolnshire, IL, USA) to prepare a single cell suspension. GFP-positive cells were sorted using a FACS Aria system (BD Bioscience, San Jose, CA, USA). After sorting, the purity of GFP-positive cells (the ratio of GFP-positive cells in total cells) was ≥ 95%. Isolated cells were either used as a fresh sample (no culture) or placed on collagen-coated mesh inserts (Corning Life Science, Lowell, MA, USA) to culture for 0.5–72h with or without RA and/or U0126. These cells were subjected to the quantitative polymerase chain reaction (qPCR), Western blot, and immunostaining analyses.
Culture of female gonads
Female gonads with the mesonephros (gonad + meso) were dissected from the E12.5 fetuses. One gonad + meso per pair was used in the control group and the other was used in the 50 μM MEK inhibitor (U0126) treatment group. The gonad + meso tissues (2–4 tissues as one group) were placed on a 2% agar block soaked in the basic medium (control) or in the basic medium with the inhibitor (treatment). After 24 or 48h of culture, the gonads were dissected from the mesonephros and subjected to the enzymatic treatment as shown above. After the treatment, gonads were dissociated with pipetting to make single-cell suspensions. GFP-positive germ cells in the cell suspension were visualized under epi-illumination and morphologically healthy cells with a large nucleus and smooth cytoplasm were manually collected (200 cells per set) by using a glass pipette fitted to an inverted microscope (200x) (Olympus IX71, Center Valley, PA, USA) as described previously [45]. The collected germ cells were subjected to the quantitative gene expression analysis.
Quantitative gene expression analysis
After culturing the germ cells for 24-72h, morphologically healthy germ cells with a large nucleus and smooth cytoplasm were collected manually (200–300 cells per set) with a glass pipette using an inverted microscope (200x) (Olympus IX71). After the gonadal culture, 200 GFP-positive cells per set were isolated for the analysis. The collected germ cells were subjected to cDNA synthesis using the SuperScript III Cells Direct cDNA synthesis kit (Invitrogen). qPCR analysis was performed using a MyiQ Single-Color Real-Time PCR Detection system (Bio-Rad Laboratories, Hercules, CA, USA). Each experiment was repeated three to five times to provide biological replicates, with duplicate samples of each biological replicate were assayed to provide technical replicates. As previously describe [43], the sequences of primers used were as follows (forward and reverse, respectively): for Stra8, 5’–GTTTCCTGCGTGTTCCACAAG–3’ and 5’–CACCCGAGGCTCAAGCTTC–3’; for Rec8, 5’–CTACCTAGCTTGCTTCTTCC–3’ and 5’–GCCTCTAAAAGGTGTCGAA–3’; for DNA meiotic recombinase 1 (Dmc1), 5’–CCCTCTGTGTGACAGCTCAAC–3’ and 5’–GGTCAGCAATGTCCCGAAG–3’; for Synaptonemal complex protein 3 (Sycp3), 5’–GTGCCTGGTGGAAGAAAGCA–3’ and 5’–GGAGCCTTTTCATCAGCAACAT–3’; for Spo11, 5’–CGTGGCCTCTAGTTCTGAGGT–3’ and 5’–GCTCGATCTGTTGTCTATTGTGA–3’; for DNA methyltransferase 3-like (Dnmt3L), 5’–GTGCGGGTACTGAGCCTTTTTAGA–3’ and 5’–CGACATTTGTGACATCTTCCACGTA–3’; for β-actin, 5’–CCTGTATGCCTCTGGTCGTA–3’ and 5’–CCATCTCCTGCTCGAAGTCT–3’; for Mouse Vasa homolog (Mvh), 5’–CTCAAACAGGGTCTGGGAAG–3’ and 5’–TGGTTGATCAGTTCTCGAGT–3’. The results were normalized to levels detected for β-actin gene expression and the levels of transcripts were presented as expression levels relative to control groups, with the latter arbitrarily set as 1.00 as described previously [13,43,46]. The qPCR analysis was repeated independently in triplicate for each experiment.
Western blotting
For Western blot analysis, cell lysates were prepared from 50,000 germ cells incubated for short periods (0.5-2h) or 24-48h with or without RA and/or U0126. Equal amounts of cell lysates were loaded into each lane of a 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel for electrophoresis, and the contents of the subsequent gel were electrotransferred onto polyvinyl difluoride membranes (GE Healthcare, Chicago, IL, USA). The transferred membranes were blocked with 5% non-fat dried milk in 0.1% Tween 20 in phosphate-buffered saline (PBS-T), and then probed with primary antibodies (all purchased from Cell Signaling Technology, Danvers, MA, USA) (S1 Table) against β-ACTIN (1 : 1000), ERK1/2 (1 : 1000), phospho-ERK1/2 (1 : 1000), p38 (1 : 500), phospho-p38 (1 : 500), AKT (1 : 500), phospho-AKT (1 : 500), JNK (1 : 500), or phospho-JNK (1 : 500) overnight at 4°C. The following day, the membranes were rinsed 3x with PBS-T for 10 min each and incubated with an anti-rabbit immunoglobulin G (IgG), horseradish peroxidase-linked secondary antibody (1 : 1000; Cell Signaling Technology) (S1 Table) for 1h at room temperature. The membranes were exposed to X-ray film (GE Healthcare) to visualize the protein bands. The optical densities (O.D.) of the protein bands were quantified by densitometry using ImageJ software (https://imagej.nih.gov/ij/). For ERK1/2, P38, JNK and AKT, the total proteins and phospho-proteins were normalized to the β-ACTIN, and then the phospho/total protein ratios were determined. STRA8 proteins were normalized to the β-ACTIN. The fold changes of normalized phosphor/total and STRA8 proteins were calculated based on this comparison to control levels set as 1.0. The Western blotting analysis was repeated twice.
Immunochemical staining
After 24 or 48h of culture, morphologically healthy germ cells (about 200–400 cells per set) were placed on glass slides and fixed with 4% paraformaldehyde (Sigma-Aldrich) for 15 min at room temperature. After washing, the cells were permeabilized with 0.2% Triton X-100 in PBS for 15 min, then blocked with 5% bovine serum albumin (BSA; Sigma-Aldrich) in PBS for 1h at room temperature. These cells were incubated with primary antibodies overnight at 4°C. Primary antibodies for immunostaining included (S1 Table): rabbit polyclonal anti-STRA8 (1 : 500; Abcam, Cambridge, MA, USA) and mouse polyclonal anti-γH2AX (1 : 500; Abcam). After washing, the cells were incubated with Alexa Fluor 568-conjugated goat anti-rabbit IgG (1 : 500; Thermo Fisher Scientific, Waltham, MA, USA) or Alexa Fluor 568-conjugated goat anti-mouse IgG (1 : 500; Thermo Fisher Scientific) (S1 Table) in 1% BSA in PBS, and subsequently counterstained with Hoechst 33342 (Invitrogen) for 15 min and mounted in 50% (v/v) glycerol in PBS. STRA8-positive and γH2AX-positive cells were detected and imaged using an Axio microscope (Carl Zeiss Microimaging, Göttingen, Germany). In the present study, the immunochemical staining was repeated independently in triplicate for each experiment.
Statistical analysis
Data are represented as the mean ± standard errors of the means (SEM). For comparison of quantitative mRNA expression levels and the fluorescence intensity of STRA8 protein, data were analyzed by a one - or two-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison test for normally distributed data. Chi-square test was used to compare categorical variables for the proportion of STRA8 - and γH2AX-positive cells under different condition. A p-value < 0.05 was considered statistically significant. All statistical analyses were performed using GraphPad Prism software (4.0; GraphPad Software, San Diego, CA, USA).
Results
Stra8 expression in endogenous XX and XY germ cells
After gonadal sex differentiation, Stra8 expression occurs only in XX germ cells where it triggers meiotic initiation [6,7,15]. To confirm the sexually dimorphic patterns of Stra8 transcription in fetal female and male germ cells [17], we first analyzed the levels of Stra8 transcript in freshly isolated endogenous XX and XY germ cells at E11.5–15.5 (Fig 1A, S2 Table). At E11.5, Stra8 expression was rarely detected in either XX or XY germ cells. At E12.5, XX germ cells initiated expression of Stra8 transcripts to a level 3.5x greater than that detected in E11.5 PGCs. At later stages, Stra8 expression in XX germ cells became further enhanced, reaching a peak at E13.5 (14x higher than that in E11.5) (p < 0.001), which was maintained until E14.5 (p < 0.01 vs. E11.5). By E15.5, Stra8 expression had gradually decreased (p < 0.05). In contrast, in endogenous XY germ cells, on the contrary, Stra8 transcription was never activated during this same period of E11.5–15.5 (Fig 1A).
Fig. 1. MAPK and AKT transduction pathways in XX germ cells cultured with RA. (A) The Stra8 transcript levels were analyzed in freshly isolated XX and XY germ cells at E11.5 ~ 15.5. Results were normalized to the β-actin mRNA expression. All expression values were calculated relative to control levels set at 1.0. Data represent the mean ± SEM (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001 vs. E11.5. (B) To determine whether RA activates MAPK (ERK1/2, p38 MAPK and JNK) and AKT pathways, isolated XX germ cells at E12.5 were incubated with 1 μM RA for 0, 0.5, 1 and 2h, then subjected to Western blotting. The fold changes were represented on the top of each band as numerical values that calculated based on the levels of germ cells without culture (0h). RA selectively stimulates the ERK1/2 pathway in XX germ cells
We next asked whether RA noncanonically stimulates any intracellular signal transduction pathways in germ cells. To answer this question, isolated E12.5 XX germ cells were cultured with 1 μM RA for different time periods (0, 0.5, 1 and 2h), and the phosphorylation levels of three mitogen-activated protein kinases (MAPKs: ERK1/2, JNK and p38 MAPK) and AKT pathways were examined using Western blotting (Fig 1B, S15 Table). After 0.5h of RA treatment, ERK1/2 phosphorylation was slightly increased, and its level was gradually upregulated in a time-dependent manner. After 2h of RA treatment, ERK1/2 phosphorylation was drastically enhanced up to 8.1x compared to that in freshly isolated cells without RA treatment (0h). In contrast, RA treatment did not promote any increase of proteins involved in either the p38 MAPK, JNK or AKT pathways in cultured XX germ cells. These results strongly suggest that RA predominantly stimulates ERK1/2, but not other MAPKs or AKT pathways, in XX germ cells at the time of sex differentiation.
STRA8 expression is suppressed by inhibiting ERK1/2 activity in XX germ cells
To determine whether RA-stimulated ERK1/2 activity contributes to Stra8 expression in fetal germ cells, we used U0126, a MEK1/2 inhibitor which blocks phosphorylation of ERK1/2 [47]. Isolated XX germ cells were treated with U0126 at different concentrations (0, 10, 20 and 50 μM) for 24h, followed by examination of Stra8 transcript levels (Fig 2A, S3 Table). In the presence of U0126, Stra8 transcript levels were effectively suppressed in a dose-dependent manner (p < 0.05–0.01), suggesting an interaction between ERK1/2 phosphorylation and Stra8 transcription in fetal germ cells. We also confirmed that U0126 at 50 μM effectively suppressed ERK1/2 phosphorylation in XX germ cells (S1 Fig, S15 Table). To further test this hypothesis, isolated E12.5 XX germ cells were cultured with or without 1 μM RA and/or 50 μM U0126 (Fig 2B). These four conditions (RA-/U0126-, RA+/U0126-, RA+/U0126+, RA-/U0126+) were termed control, RA, RA+U0126 and U0126, respectively, and were used for the following experiments. In each case, after 24h of culture, cells were subjected to Western blotting (Fig 2B, S15 Table). In the control condition (RA-/U0126-), both STRA8 expression and ERK1/2 phosphorylation were quite low. In the presence of RA (RA+/U0126-), STRA8 expression was markedly enhanced in cultured XX germ cells (34x higher than the control). At the same time, ERK1/2 activity was obviously upregulated by RA treatment (17x higher than the control). In contrast, RA-stimulated ERK1/2 phosphorylation was strongly suppressed under the RA+U0126 condition (RA+/U0126+) (1.5x higher than the control). Interestingly, RA-stimulated STRA8 expression was also dramatically decreased to 7x higher than the control in the presence of U0126. These data strongly suggest that RA-stimulated ERK1/2 activity directly or indirectly regulates STRA8 protein expression in XX germ cells.
Fig. 2. The effect of ERK1/2 signaling activity on Stra8 expression in XX germ cells. (A) To determine the relationship between the ERK1/2 pathway and Stra8 expression, E12.5 XX germ cells were cultured with the MEK inhibitor (U0126) at different concentrations (0, 10, 20, and 50 μM) for 24h. After culture, samples were subjected to qPCR. Results were normalized to the β-actin transcript expression. All expression values were calculated relative to control levels set at 1.0. Data represent the mean ± SEM (n = 3). ** p < 0.01, *** p < 0.001 vs. control. (B) To determine the relationship between the RA-stimulated ERK1/2 pathway and STRA8 protein expression, XX germ cells were cultured under the four different conditions (control, 1 μM RA, RA+50 μM U0126, U0126) for 24h. After culture, the cells were subjected to Western blotting to quantify the ERK1/2 phosphorylation and STRA8 protein expression levels. The fold changes of these proteins were represented on the top of each band as numerical values that calculated relative to the control set as 1.0. Transcription levels of Stra8 and meiotic marker genes in XX germ cells
We examined the effect of ERK1/2 activity on meiotic initiation in XX germ cells. E12.5 XX gonads with the mesonephros were cultured with or without 50 μM U0126 for 24 or 48h. After culture, the gonads were dissociated into singe-cell suspensions to collect GFP-positive germ cells. These cells were subjected to the qPCR analysis for Stra8 and four meiotic marker genes (Rec8, Spo11, Dmc1, and Sycp3) (Fig 3A, S4 Table). In the control germ cells, Stra8 expression after 48h of culture was upregulated to 1.6x higher than that at 24h culture. At the same time, the transcript levels of all meiotic marker genes were entirely promoted (1.7–6.0x) after 48h of culture compared to those after 24h of culture. In the presence of U0126, Stra8 transcript levels after 24 or 48h of culture were slightly but consistently decreased compared with those in the controls, respectively (p > 0.05). Importantly, U0126 treatment in the XX gonads also suppressed the transcript levels of the four meiotic markers after 24h of culture (Fig 3A). In particular after 48h of culture, all meiotic marker expressions were significantly suppressed compared to the controls in the gonadal germ cells (p < 0.05–0.001). To test the influence of U0126 on the cell viability, we also analyzed the expression of mouse Vasa homologue (Mvh) transcripts as a control germ cell marker [48]. Mvh expression levels were very similar between the control and U0126 conditions both at 24 (relative expression average 1.00 vs. 1.12) or 48h (1.63 vs. 1.38), and found no statistical differences (p > 0.05) (S2A Fig, S12 Table). Taken together, these results suggested that ERK1/2 activity plays a role in entry of XX germ cells into meiosis. To further test a direct effect of U0126 on the germ cells, we next completely neglected the influence of the mesonephros and gonadal somatic cells. Isolated E12.5 XX germ cells were cultured under four conditions (control, RA, RA+U0126, and U0126). After 24 or 48h of culture, morphologically healthy cells (200–300 cells per set) were collected to analyze the transcript levels of Stra8 and two meiotic marker genes (Rec8 and Spo11) (Fig 3B, S5 Table). In XX germ cells after 24h of culture, U0126 treatment significantly diminished Stra8 expression compared to the control (p < 0.05). In contrast, RA treatment significantly upregulated Stra8 transcript level to 3.5x higher than the control (p < 0.001). Under the RA+U0126 condition, RA-stimulated Stra8 expression was significantly suppressed (to approximately 25% of that under the RA condition) (p < 0.001). After 48h of culture, U0126 significantly suppressed Stra8 expression compared to the control condition (p < 0.05). In the presence of RA, Stra8 expression level was further increased to 8x higher than the control at 24h (p < 0.001). However, U0126 treatment significantly suppressed RA-induced Stra8 expression to the control level at 48h (p < 0.001). Meiotic marker gene expressions were also dramatically affected by U0126 treatment (Fig 3B). After 24h of culture, both Rec8 and Spo11 expression levels were slightly increased in the presence of RA (p > 0.05), but these expressions were suppressed by U0126 treatment (Rec8, p < 0.05; Spo11, p > 0.05). After 48h of culture, RA treatment significantly enhanced Rec8 and Spo11 expression levels (4.1x and 19.4x higher than the controls, respectively) (p < 0.01). Importantly, U0126 treatment significantly decreased RA-induced meiotic marker expressions to lower than their controls (p < 0.001). Under the U0126 condition, both gene expression levels were also diminished compared with those in the controls (p > 0.05). In XX germ cells at 24h, the Mvh expression levels under the four culture conditions were very similar (1.00, 0.90, 0.93, 0.77, respectively) regardless with or without U0126 treatment (p > 0.05) (S2B Fig, S13 Table). At 48h, the average expression levels in the control (2.06) and RA (1.92) conditions were higher compared to those in RA+U0126 (0.84) and U0126 (0.70) conditions. Importantly, there were no significant differences among four conditions at 48h (p > 0.05), and U0126 treated groups (RA+U0126, U0126) at 48h have maintained the similar expression levels as those at 24h (S2B Fig, S13 Table). In conclusion, these results strongly suggest that RA-stimulated ERK1/2 activity directly regulates transcription of the Stra8 and meiotic marker genes in XX germ cells.
Fig. 3. The effect of RA-stimulated ERK1/2 activity on the expressions of Stra8 and meiotic marker genes in XX germ cells. (A) Female gonads at E12.5 were cultured with 50 μM U0126 (U0126) or without treatment (control) for 24 or 48h. After culture, germ cells were collected to analysis the transcript expressions of Stra8 and meiotic markers (Rec8, Spo11, Dmc1 and Sycp3). Results were normalized to the β-actin transcript expression. All expression values were calculated relative to control levels set at 1.0. Data represent the mean ± SEM (n = 3). * p < 0.05, ** p < 0.01, *** p < 0.001 vs. control. (B) Sorted XX germ cells at E12.5 were cultured under four different conditions (control, RA, RA+U0126, U0126) for 24 and 48h. After culture, the cells were subjected to qPCR analysis for Stra8 and meiotic markers (Rec8 and Spo11). Each gene expressions were normalized to the β-actin expression. All expression values were calculated relative to control levels set at 1.0. Data represent the mean ± SEM (n = 4). * p < 0.05, ** p < 0.01, *** p < 0.001 vs. control; # p < 0.05, ### p < 0.001 vs. RA. Meiotic initiation is suppressed by inhibiting ERK1/2 activity in XX germ cells
To confirm the effect of the RA-stimulated ERK1/2 pathway on STRA8 protein expression, E12.5 XX germ cells were cultured under the four culture conditions for 24h. After culture, XX germ cells (200–300 cells per sample) were immunostained with antibody against STRA8 (Fig 4A). First, we examined the proportion of STRA8-positive cells under the different culture conditions (Fig 4B, S6 Table). In the control, more than half of the cultured germ cells (56.2%) were STRA8-positive. In the presence of RA, the ratio of STRA8-positive cells was similar to the control (58.7%) (p > 0.05). These results suggest that RA treatment does not promote STRA8-negative XX germ cells to become STRA8-positive at E12.5. In contrast, the proportion of STRA8-positive cells (30.0%) was significantly reduced under the RA+U0126 condition compared to that under either the control or RA - treated conditions (p < 0.001). Under the U0126 condition, only 15.5% of the examined XX germ cells were STRA8-positive (p < 0.001). These results indicate that the ERK1/2 pathway contributes to regulation of STRA8 protein expression in cultured XX germ cells. Although RA treatment did not increase the proportion of STRA8-positive XX germ cells (Fig 4B), the fluorescence levels in the positive cells cultured under the RA condition were much stronger compared with those in cells cultured under the other three conditions (Fig 4A). Therefore, we next measured the fluorescence intensity of STRA8 protein expression in positive-cells individually using ImageJ software (National Institutes of Health, Bethesda, MD, USA) (Fig 4C, S7 Table). For this purpose, we evaluated fluorescence intensity in STRA8 positive cells as follows: control, 171 cells; RA, 126 cells; RA+U0126, 80 cells; and U0126, 30 cells. Without RA treatment (control), the mean value of STRA8 fluorescence intensity was 34.63 ± 0.97 (median is inside line of box 27.0). In the presence of RA, the STRA8 fluorescence intensity was significantly enhanced to 67.34 ± 1.17 (median 66.0) in XX germ cells, almost twice that of the control cells (p < 0.001). When ERK1/2 activity was inhibited by U0126 (RA+U0126), RA-stimulated expression of STRA8 was significantly suppressed to 29.43 ± 1.86 (median 27.0; p < 0.001), a level that was significantly lower than that in the control (p < 0.05). Furthermore, the cells in the U0126 condition showed severely diminished STRA8 fluorescence intensity (mean 7.30 ± 1.87; median 0.00) compared with either the control (p < 0.001) or RA-only (p < 0.001) conditions. Taken together, these results suggest that RA-enhanced STRA8 protein levels are controlled by the RA-stimulated EK1/2 pathway.
Fig. 4. Inhibiting ERK1/2 activity suppresses STRA8 protein expression and meiotic initiation in XX germ cells. Isolated XX germ cells at E12.5 were cultured under four different conditions (control, RA, RA+U0126, U0126) for 24h. (A) After culture, germ cells were immunostained with an anti-STRA8 antibody (red) and counterstained with Hoechst33342 (blue). (B) The ratio (%) of STRA8-positive cells in each culture condition was estimated using ImageJ software. *** p < 0.001 vs. control; ### p < 0.001 vs. RA; ††† p < 0.001 vs. RA+U0126. (C) The fluorescent intensity of STRA8 protein expression in each positive cell was quantified using ImageJ software. The results were represented as a box-whisker plot. Each dot represents a single analyzed germ cell. Each box indicates the middle 50% of the data and midline in the box indicates the median. The whiskers extend to the most extreme data point, which is no more than 1.5 times the quartile range. * p < 0.05, *** p < 0.001 vs. control; ### p < 0.001 vs. RA. (D) To examine the entry into meiosis, cultured XX germ cells were stained with an antibody against γH2AX (red) and counterstained with Hoechst33342 (blue). (E) The ratio (%) of γH2AX-positive cells in each condition was estimated using ImageJ software. *** p < 0.001 vs. control; ### p < 0.001 vs. RA. We next determined the relationship between the ERK1/2 pathway and entry into meiosis. XX germ cells at E12.5 were cultured under the same four different conditions and samples of about 100 cells per group were then placed on glass slides to be subjected to immunostaining with an antibody against γH2AX protein, a biomarker of the meiotic DNA double-strand breaks that occur at the leptotene stage of prophase I in meiosis (Fig 4D) [49]. Similar to the results shown in Fig 4B, the population of γH2AX-positive cells in the control (62.5%) group was not increased even in the presence of RA (66.7%) (Fig 4E, S8 Table), which suggests that RA treatment does not promote entry of XX germ cells into meiosis at E12.5. Interestingly, a previous study also determined that RA treatment does not accelerate the timing of meiotic entry in isolated E12.5 germ cells [18]. In contrast, inhibition of ERK1/2 phosphorylation by U0126 significantly reduced the proportion of γH2AX-positive germ cells in both the RA+U0126 (23.4%) and U0126 (11.3%) conditions compared with those in the control (p < 0.001) and RA conditions (p < 0.001). Thus, STRA8 - and meiotic-positive cell numbers were well correlated under all four conditions (Fig 4B and 4E). Taken together, our results support the conclusion that the RA-mediated ERK1/2 pathway regulates STRA8 protein expression, which, in turn, induces entry of XX germ cells into meiosis.
RA-induced meiotic initiation is suppressed by inhibiting ERK1/2 activity in XY germ cells
We have previously reported that XY germ cells isolated at E13.5 autonomously progress through the male pathway in culture without somatic support [46]. Our previous study also determined that RA treatment directly induces E13.5 XY germ cells to express Stra8 and initiate meiosis [13]. In the present study, we examined whether or not RA-induced STRA8 expression in XY germ cells is regulated by the RA-stimulated ERK1/2 pathway. To determine the relationship between STRA8 expression and ERK1/2 activity, E13.5 XY germ cells were cultured with 1 μM RA for 0, 12, 24 and 48h prior to Western blotting (Fig 5A). As expected, RA treatment gradually induced STRA8 expression in XY germ cells in a time-dependent manner. Interestingly, RA treatment also gradually promoted ERK1/2 activity in proportion to RA-induced STRA8 levels in cultured XY germ cells (Fig 5A, S15 Table).
Fig. 5. The effect of RA-stimulated ERK1/2 activity on the meiotic initiation in XY germ cells. (A) Isolated XY germ cells at E13.5 were cultured with 1μM RA for 0, 12, 24, and 48h, and the ERK1/2 phosphorylation and STRA8 protein expression were then analyzed using Western blotting. (B) Isolated XY germ cells at E13.5 were cultured under four different conditions (control, RA, RA+U0126, U0126). After 48h culture, the cells were subjected to Western blotting to quantify the ERK1/2 phosphorylation and STRA8 protein expression levels. The fold changes of these proteins were represented on the top of each as numerical values that calculated relative to either 0h level (A) or the control (B) set as 1.0. (C) Isolated E13.5 XY germ cells were cultured under four different conditions (control, RA, RA+U0126, U0126) for 48 and 72h. After culture, the cells were subjected to qPCR analysis to determine the transcript levels of Stra8 and meiotic marker genes (Rec8, Spo11, Dmc1 and Sycp3). The expression levels were normalized to β-actin mRNA expression. All expression values were calculated relative to control levels set at 1.0. Data represent the mean ± SEM (n = 3–6). * p < 0.05, ** p < 0.01, *** p < 0.001 vs. control; # p < 0.05, ## p < 0.01, ### p < 0.001 vs. RA. Next, we examined the direct interaction between RA-stimulated ERK1/2 activity and STRA8 expression in XY germ cells. XY germ cells at E13.5 were cultured for 48h under the same four basic conditions shown in Fig 2B (Fig 5B, S15 Table). In the control condition, neither STRA8 expression nor ERK1/2 phosphorylation was observed in XY germ cells. In contrast, RA treatment dramatically activated STRA8 protein expression as well as ERK1/2 phosphorylation in XY germ cells. In the presence of U0126 (RA+U0126), RA-stimulated ERK1/2 phosphorylation was effectively suppressed. At the same time, U0126 treatment significantly decreased the RA-induced STRA8 expression to only 10% of the level observed in the RA condition. These results suggest that the RA-stimulated ERK1/2 pathway also controls the RA-induced STRA8 expression in cultured E13.5 XY germ cells.
We next examined Stra8 and four meiotic marker (Rec8, Spo11, Dmc1, and Sycp3) transcript levels in E13.5 XY germ cells cultured for 48 or 72h under the four different conditions (Fig 5C, S9 Table). After 48h of culture, RA treatment significantly upregulated Stra8 transcription to 5.4x higher than the control (p < 0.001). However, U0126 significantly suppressed RA-induced Stra8 transcript levels (to approximately 50% of that under the RA condition) (p < 0.05). U0126 treatment suppressed Stra8 expression relative compared to the control germ cells (p > 0.05). After 72h of culture, RA treatment maintained a similar Stra8 transcript level to 48h. RA-induced Stra8 expression was also significantly diminished by the U0126 treatment (RA+U0126). In contrast, the expression levels of meiotic marker genes at 48h were only slightly elevated in the presence of RA, and there was no significant difference compared to their controls, respectively (Fig 5C). After 72h of culture, RA treatment significantly enhanced the expression levels of Spo11, Dmc1 and Sycp3,compared to their controls (30.6x, 7.2x and 2.3x, respectively) (p < 0.05–0.001). Importantly, U0126 treatment dramatically suppressed all marker gene expressions induced by RA compared to the controls (p < 0.01–0.001). On the contrary, Mvh expression under the four culture conditions was very similar at 48h (p > 0.05) (S3 Fig, S14 Table). At 72h, the average expression levels were a little more varied (1.18, 1.61, 0.85, and 0.68, respectively). Although one significant difference was detected between RA and U0126 conditions (p < 0.05), there were no any other statistical differences between each condition in cultured XY germ cells (p > 0.05) (S3 Fig, S14 Table). These data strongly support that RA-stimulated ERK1/2 activity plays a role in regulating the transcription of Stra8 and meiotic marker genes in XY germ cells.
The RA-stimulated ERK1/2 pathway regulates STRA8 expression and meiotic initiation in XY germ cells
We further tested whether the RA-stimulated ERK1/2 pathway regulates STRA8 protein expression and entry into meiosis in E13.5 XY germ cells (Fig 6). Sorted XY germ cells were cultured for 48h under the same basic four conditions. Samples of about 300–400 XY germ cells were collected and placed on glass slides to be subjected to immunostaining with antibody against STRA8 protein (Fig 6A) to obtain the numbers of STRA8-positive cells (Fig 6B, S10 Table). Without RA treatment (control), XY germ cells never became STRA8-positive in culture (0%) (Fig 6A and 6B). In the presence of RA, 73.6% of the tested XY germ cells strongly expressed STRA8 (p < 0.001). However, U0126 treatment significantly suppressed RA-induced STRA8 expression and only 18.7% of analyzed XY germ cells were STRA8-positive (p < 0.001) (Fig 6A and 6B). Further, STRA8-positive cells were rarely observed in the presence of U0126 only (2.7%, p > 0.05 vs. control). These data confirm that the RA-stimulated ERK1/2 pathway regulates RA-stimulated STRA8 expression in E13.5 XY germ cells in culture.
Fig. 6. Inhibiting ERK1/2 activity suppresses RA-induced STRA8 protein expression and meiotic initiation in XY germ cells. Isolated XY germ cells at E13.5 were cultured under four conditions (control, RA, RA+U0126, U0126) for 48h. (A) The cultured cells were immunostained with the anti-STRA8 antibody and counterstained with Hoechst33342 (blue). (B) The ratio (%) of STRA8-positive cells was estimated in each condition. *** p < 0.001 vs. control; ### p < 0.001 vs. RA. (C) The cultured germ cells were immunostained with the anti-γH2AX antibody (red) and counterstained with Hoechst33342 (blue). (D) The ratio (%) of γH2AX-positive cells was estimated in each condition. *** p < 0.001 vs. control; ### p < 0.001 vs. RA. To determine if the RA-stimulated ERK1/2 pathway impacts meiotic initiation in XY germ cells, E13.5 XY germ cells were cultured under the same four conditions. After culture, samples of 200–300 XY germ cells were collected and immunostained with γH2AX antibody (Fig 6C) to determine the number of cells that had entered meiosis (Fig 6D, S11 Table). Interestingly, the expression patterns of γH2AX appeared to correlate with those of STRA8 in cultured XY germ cells (Fig 6B and 6D). Without RA, γH2AX-positive cells were rarely detected in the control and U0126 treatment conditions (2.1% and 3.1%, respectively). In the presence of RA, about 40% of the germ cells entered meiosis (p < 0.001). Under U0126 treatment, most of the RA-induced meiotic cells suppressed γH2AX expression, and only 5.7% entered meiosis (p < 0.001). Taken together, our results clearly demonstrate that the RA-stimulated ERK1/2 pathway plays a critical role in regulating STRA8 expression and entry into meiosis in cultured E13.5 XY germ cells.
Discussion
Recent studies in somatic cells have proposed that RA noncanonically activates intracellular signal transduction pathways to regulate transcription of RA target genes [37,50,51]. In this study, we examined 1) whether RA noncanonically activates any MAPK pathways in fetal germ cells, and 2) if this is the case, whether the RA-stimulated signaling pathway regulates Stra8 expression and entry into meiosis in fetal germ cells. We found that RA treatment selectively stimulates the ERK1/2 pathway in XX germ cells at E12.5. We further demonstrated that RA-induced Stra8 expression (at both the mRNA and protein levels) and several meiotic marker expressions were significantly suppressed by inhibiting the RA-stimulated ERK1/2 pathway in cultured germ cells, regardless of their sexual phenotype. Our findings suggest a new concept that Stra8 expression may be controlled not only by the canonical activity of RA via nuclear RARs, but also by the noncanonical activity of RA via the ERK1/2 pathway in fetal germ cells.
Our initial interest was whether the noncanonical route of RA activity originally evidenced by somatic cell studies is also utilized in fetal germ cells for meiotic initiation or not. Interestingly, treatment with RA predominantly enhanced the ERK1/2 pathway, but not the p38 MAPK, JNK or AKT pathways in E12.5 XX germ cells in culture. Recent studies in the somatic cells have revealed a novel biological activity of RA via signal transduction pathways, suggesting that RA induces the selective activation of multiple signal transduction pathways [28,29]. In particular, the RA-induced ERK1/2 activation has been most widely reported in various cell types [21,22,32,35,39,52–55], including postnatal mouse spermatogonia [40]. In embryonic stem (ES) cell-derived embryoid bodies (EBs), RA treatment induces differentiation into various cell lineages including adipogenesis, neurogenesis and myogenesis. Bost et al. (2002) reported that the ERK inhibitor treatment suppressed adipocyte differentiation, but did not affect other lineage differentiation in the EBs [39]. This study suggests that the RA-stimulated ERK pathway selectively induces adipocyte differentiation in ES cells [39]. In the nervous system, RA is known as a potent regulator to induce neurite outgrowth and neuronal differentiation. In a rat derived A126-1B2 cells, e.g., RA treatment activates c-fos gene expressions to induce neuronal differentiation [56]. A previous study suggested that the RA-stimulated ERK1/2 pathway controls these gene expressions to induce neural differentiation [32]. In A126-1B2 cells, RA treatment activated both the ERK1/2 signaling and cAMP-response element-binding protein (CREB), a transcription factor which regulates the transcription of genes including c-fos and c-jun [32]. It was suggested that the RA-stimulated ERK1/2 pathway controls neuronal differentiation through CREB activation because U0126 treatment abolished RA-induced CREB phosphorylation [32]. In the human leukemia HL-60 cell line, RA-stimulated ERK2 signaling directs myeloid differentiation [55]. Importantly, RA selectively stimulates ERK but not other MAPK pathways (JNK/SAPK or p38) for myeloid differentiation [22]. Our present study also demonstrated that RA selectively stimulates the ERK1/2, but not other MAPK or AKT pathways in fetal germ cells. Taken together, these previous studies and our result strongly suggest that RA noncanonically stimulates the ERK1/2 pathways to regulate a large spectrum of cellular activities and functions, including entry of germ cells into meiosis.
We found that the ERK phosphorylation inhibitor (U0126) effectively suppressed RA-induced Stra8 expression (both at the mRNA and protein levels) in E12.5 XX germ cells and E13.5 XY germ cells in culture. Thus, our results are consistent with the novel idea that the RA-stimulated ERK1/2 pathway contributes to Stra8 expression in fetal germ cells. Using postnatal mouse spermatogonia, Pellegrini et al. (2008) determined that both RA and Kit Ligand (KL) increased the mRNA expression of Stra8 and Dmc1 [40]. By inhibiting Kit signaling activity, the meiotic cell number was decreased, suggesting Kit dependent downstream pathways (MARK, PI3K) contribute to meiotic initiation. Actually, either MEK inhibitor (U0126) or PI3K inhibitor (LY294002) treatment for 48h suppressed RA-induced meiosis in the postnatal male germ cells [40]. Although they did not analyze the direct relationship between MAPK and Stra8 expression, their study strongly supports the idea that noncanonical activity of RA controls meiotic initiation. Very recently, it was reported that inactivation of Wdr62, which encodes a scaffold protein in the JNK signaling pathway, caused meiotic initiation defects in mice [41]. The fetal gonads treated with a JNK inhibitor suppressed Stra8 and meiotic marker expressions, suggesting Wdr62 is involved in RA-induced meiotic initiation via activating JNK pathway [41]. This is another example that the intracellular signaling pathways contribute to meiotic initiation in the germ cells. Previous evidence has shown that the RA bound RAR/RXR heterodimer canonically binds to RAREs to regulate RA target gene expression [23,57]. As a typical RA target gene, murine Stra8 contains two putative RAREs (DR2 and IR5) within a 400 bp promoter region upstream from the transcription start site [26]. In the prepubertal mouse testis, a luciferase reporter assay showed that the 400 bp promoter region is sufficient to direct Stra8 transcriptional expression [52]. Using a ChIP assay, Raverdeau et al. (2012) have detected direct binding of all RAR isotypes to the RARE (DR2) in the Stra8 promoter region in the postnatal testes at 8 dpp [9]. These results suggest that RA-induced Stra8 expression is canonically mediated by nuclear RARs in germ cells. In the fetal ovary at E13.5, in contrast, a similar ChIP study reported that the binding affinity of RARs (α, β, γ) to RAREs in the Stra8 promoter is either very low or not detectable [27]. However, RAR antagonists successfully suppressed the transcriptional activity of Stra8 and meiotic initiation in isolated germ cells and gonadal germ cells in vitro [6,7,11,43]. Based on these studies, it seems that the biological activity of RA is mediated by nuclear RARs in fetal germ cells. Importantly, our new findings suggest an alternate route of RA signaling mediated by the ERK pathway to control Stra8 expression. Actually, previous studies in somatic cells have suggested that expression of RA target genes is regulated by RA-stimulated signal transduction cascades. Thus, in both mouse embryonic fibroblasts and human breast cancer cells, RA treatment activates the p38 MAPK pathway to enhance transcription of Cyp26A1, one of the RA target genes [37]. In embryonic fibroblasts, the RA-stimulated p38 MAPK pathway regulates transcription of another RA target gene, RARβ2, which may be involved in epigenetic events, such as chromatin modification and remodeling [37]. The molecular mechanism of the RA-stimulated signal transduction cascades in regulating transcription of the target genes remains unclear. In general, phosphorylated ERK1/2 is translocated into the nucleus to stimulate multiple downstream target molecules [21,32,34,35,58–60]. Therefore, one idea is that RA-stimulated kinase signaling might be crucial for the fine tuning of the appropriate physiological activity of their target genes. For example, activated ERK1/2 signaling phosphorylates mitogen - and stress-activated protein kinase 1 (MSK1), which can phosphorylate several nuclear proteins [58–60]. Specifically, activated MSK1 phosphorylates histone H3 at Ser28 residues, which eventually dissociates the polycomb repressive complexes (PRCs) to predispose a transcriptionally active state [51,61]. PRCs are involved in gene silencing through histone posttranslational modifications [62,63]. Therefore, it appears that the RA-stimulated ERK1/2 pathway may play an important role in epigenetic regulation of gene expression. Recently Yokobayashi et al. (2013) revealed that PRC1, one of the PRCs, controls the timing of Stra8 transcriptional activation in female gonads [64]. In PRC1-deficient germ cells, Stra8 transcription was prematurely activated at E11.5, and meiotic-related genes were expressed earlier than usual. These authors speculated that PRC1 maintains repression of Stra8 and early meiosis programs until RA signaling has reached a certain threshold in female gonads [64]. In conclusion, Stra8 expression appears to be epigenetically regulated via histone modifications and chromatin accessibility, which may be associated with the function of RA-induced signal transduction cascades.
Using our germ cell culture system, we identified that RA stimulates the ERK1/2 activity via a noncanonical pathway in both XX and XY germ cells. Furthermore, we demonstrated that the RA-stimulated ERK1/2 pathway contributes to Stra8 expression at both the mRNA and protein levels, resulting in regulating entry into meiosis. Thus, we propose the novel concept that RA signaling functions via an alternate signal transduction cascade to control Stra8 expression and meiosis, independent of the canonical pathway mediated by nuclear RARs (Fig 7). Although details of the molecular features of this proposed alternate RA-stimulated ERK1/2 pathway remain unclear, it is possible that crosstalk between the canonical and noncanonical activities of RA impact the transcriptional regulation of Stra8 to induce entry into meiosis.
Fig. 7. RA noncanonically activates the ERK1/2 pathway to regulate Stra8 expression and meiotic initiation in fetal germ cells. In general, RA canonically binds to nuclear RARs to control the transcriptional expression of RA target genes. Based on our results, we propose a novel concept that RA signaling also functions via an alternate signal transduction cascade in the cytoplasm, independent of the canonical pathway mediated by nuclear RARs, to control meiosis. In isolated XX and XY germ cells, external RA noncanonically stimulates the ERK1/2 signal transduction pathway in the cytoplasm. The phosphorylated ERK1/2 moves to the nucleus and contributes to Stra8 expression to stimulate meiotic initiation. Although the details of the molecular features of this proposed alternate RA-stimulated ERK1/2 pathway remain unclear, it is possible that crosstalk between the canonical and noncanonical activities of RA impact the transcriptional regulation of Stra8 to induce entry into meiosis. Supporting information
S1 Table [pdf]
Antibodies information used for Western blotting and immunochemical staining.S2 Table [pdf]
The raw data for qPCR of .S3 Table [pdf]
The raw data for qPCR of .S4 Table [pdf]
The raw data for qPCR of .S5 Table [pdf]
The raw data for qPCR of .S6 Table [pdf]
The raw data for qPCR of .S7 Table [pdf]
The raw data for qPCR of .S8 Table [pdf]
The raw data for qPCR of .S9 Table [pdf]
The raw data for qPCR of .S10 Table [pdf]
The raw data for qPCR of .S11 Table [pdf]
The raw data for qPCR of .S12 Table [pdf]
The raw data for qPCR of .S13 Table [pdf]
The raw data for qPCR of .S14 Table [pdf]
The raw data for qPCR of .S15 Table [pdf]
O.D. values for Western blot (Figs , , and ).S1 Fig [u0126]
The effect of U0126 on the ERK1/2 phosphorylation in XX germ cells.S2 Fig [a]
The effect of RA-stimulated ERK1/2 activity on the expressions of in XX germ cells.S3 Fig [pdf]
The effect of RA-stimulated ERK1/2 activity on the expressions of in XY germ cells.
Zdroje
1. Borum K (1961) Oogenesis in the mouse. A study of the meiotic prophase. Exp Cell Res 24 : 495–507. doi: 10.1016/0014-4827(61)90449-9 13871511
2. Monk M, McLaren A (1981) X-chromosome activity in foetal germ cells of the mouse. J Embryol Exp Morphol 63 : 75–84. 7310296
3. Hilscher B, Hilscher W, Bulthoff-Ohnolz B, Kramer U, Birke A, Pelzer H, et al. (1974) Kinetics of gametogenesis. I. Comparative histological and autoradiographic studies of oocytes and transitional prospermatogonia during oogenesis and prespermatogenesis. Cell Tissue Res 154 : 443–470. doi: 10.1007/bf00219667 4442109
4. McCarrey JR (2013) Toward a more precise and informative nomenclature describing fetal and neonatal male germ cells in rodents. Biol Reprod 89 : 47. doi: 10.1095/biolreprod.113.110502 23843236
5. Griswold MD, Hogarth CA, Bowles J, Koopman P (2012) Initiating meiosis: the case for retinoic acid. Biol Reprod 86 : 35. doi: 10.1095/biolreprod.111.096610 22075477
6. Bowles J, Knight D, Smith C, Wilhelm D, Richman J, Mamiya S, et al. (2006) Retinoid signaling determines germ cell fate in mice. Science 312 : 596–600. doi: 10.1126/science.1125691 16574820
7. Koubova J, Menke DB, Zhou Q, Capel B, Griswold MD, Page DC (2006) Retinoic acid regulates sex-specific timing of meiotic initiation in mice. Proc Natl Acad Sci U S A 103 : 2474–2479. doi: 10.1073/pnas.0510813103 16461896
8. Anderson EL, Baltus AE, Roepers-Gajadien HL, Hassold TJ, de Rooij DG, van Pelt AM, et al. (2008) Stra8 and its inducer, retinoic acid, regulate meiotic initiation in both spermatogenesis and oogenesis in mice. Proc Natl Acad Sci U S A 105 : 14976–14980. doi: 10.1073/pnas.0807297105 18799751
9. Raverdeau M, Gely-Pernot A, Feret B, Dennefeld C, Benoit G, Davidson I, et al. (2012) Retinoic acid induces Sertoli cell paracrine signals for spermatogonia differentiation but cell autonomously drives spermatocyte meiosis. Proc Natl Acad Sci U S A 109 : 16582–16587. doi: 10.1073/pnas.1214936109 23012458
10. Bowles J, Feng CW, Miles K, Ineson J, Spiller C, Koopman P (2016) ALDH1A1 provides a source of meiosis-inducing retinoic acid in mouse fetal ovaries. Nat Commun 7 : 10845. doi: 10.1038/ncomms10845 26892828
11. Bowles J, Feng CW, Spiller C, Davidson TL, Jackson A, Koopman P (2010) FGF9 suppresses meiosis and promotes male germ cell fate in mice. Dev Cell 19 : 440–449. doi: 10.1016/j.devcel.2010.08.010 20833365
12. MacLean G, Li H, Metzger D, Chambon P, Petkovich M (2007) Apoptotic extinction of germ cells in testes of Cyp26b1 knockout mice. Endocrinology 148 : 4560–4567. doi: 10.1210/en.2007-0492 17584971
13. Ohta K, Lin Y, Hogg N, Yamamoto M, Yamazaki Y (2010) Direct effects of retinoic acid on entry of fetal male germ cells into meiosis in mice. Biol Reprod 83 : 1056–1063. doi: 10.1095/biolreprod.110.085787 20826729
14. Trautmann E, Guerquin MJ, Duquenne C, Lahaye JB, Habert R, Livera G (2008) Retinoic acid prevents germ cell mitotic arrest in mouse fetal testes. Cell Cycle 7 : 656–664. doi: 10.4161/cc.7.5.5482 18256537
15. Baltus AE, Menke DB, Hu YC, Goodheart ML, Carpenter AE, de Rooij DG, et al. (2006) In germ cells of mouse embryonic ovaries, the decision to enter meiosis precedes premeiotic DNA replication. Nat Genet 38 : 1430–1434. doi: 10.1038/ng1919 17115059
16. Dokshin GA, Baltus AE, Eppig JJ, Page DC (2013) Oocyte differentiation is genetically dissociable from meiosis in mice. Nat Genet 45 : 877–883. doi: 10.1038/ng.2672 23770609
17. Menke DB, Koubova J, Page DC (2003) Sexual differentiation of germ cells in XX mouse gonads occurs in an anterior-to-posterior wave. Dev Biol 262 : 303–312. doi: 10.1016/s0012-1606(03)00391-9 14550793
18. Tedesco M, Desimio MG, Klinger FG, De Felici M, Farini D (2013) Minimal concentrations of retinoic acid induce stimulation by retinoic acid 8 and promote entry into meiosis in isolated pregonadal and gonadal mouse primordial germ cells. Biol Reprod 88 : 145. doi: 10.1095/biolreprod.112.106526 23636811
19. Engedal N, Gjevik T, Blomhoff R, Blomhoff HK (2006) All-trans retinoic acid stimulates IL-2-mediated proliferation of human T lymphocytes: early induction of cyclin D3. J Immunol 177 : 2851–2861. doi: 10.4049/jimmunol.177.5.2851 16920920
20. Zanotto-Filho A, Schroder R, Moreira JC (2008) Differential effects of retinol and retinoic acid on cell proliferation: a role for reactive species and redox-dependent mechanisms in retinol supplementation. Free Radic Res 42 : 778–788. doi: 10.1080/10715760802385702 18785048
21. Zanotto-Filho A, Cammarota M, Gelain DP, Oliveira RB, Delgado-Canedo A, Dalmolin RJ, et al. (2008) Retinoic acid induces apoptosis by a non-classical mechanism of ERK1/2 activation. Toxicol In Vitro 22 : 1205–1212. doi: 10.1016/j.tiv.2008.04.001 18474417
22. Yen A, Roberson MS, Varvayanis S (1999) Retinoic acid selectively activates the ERK2 but not JNK/SAPK or p38 MAP kinases when inducing myeloid differentiation. In Vitro Cell Dev Biol Anim 35 : 527–532. doi: 10.1007/s11626-999-0063-z 10548434
23. Germain P, Chambon P, Eichele G, Evans RM, Lazar MA, Leid M, et al. (2006) International Union of Pharmacology. LX. Retinoic acid receptors. Pharmacol Rev 58 : 712–725. doi: 10.1124/pr.58.4.4 17132850
24. di Masi A, Leboffe L, De Marinis E, Pagano F, Cicconi L, Rochette-Egly C, et al. (2015) Retinoic acid receptors: from molecular mechanisms to cancer therapy. Mol Aspects Med 41 : 1–115. doi: 10.1016/j.mam.2014.12.003 25543955
25. Mahony S, Mazzoni EO, McCuine S, Young RA, Wichterle H, Gifford DK (2011) Ligand-dependent dynamics of retinoic acid receptor binding during early neurogenesis. Genome Biol 12: R2. doi: 10.1186/gb-2011-12-1-r2 21232103
26. Giuili G, Tomljenovic A, Labrecque N, Oulad-Abdelghani M, Rassoulzadegan M, Cuzin F (2002) Murine spermatogonial stem cells: targeted transgene expression and purification in an active state. EMBO Rep 3 : 753–759. doi: 10.1093/embo-reports/kvf149 12151334
27. Kumar S, Chatzi C, Brade T, Cunningham TJ, Zhao X, Duester G (2011) Sex-specific timing of meiotic initiation is regulated by Cyp26b1 independent of retinoic acid signalling. Nat Commun 2 : 151. doi: 10.1038/ncomms1136 21224842
28. Rochette-Egly C (2015) Retinoic acid signaling and mouse embryonic stem cell differentiation: Cross talk between genomic and non-genomic effects of RA. Biochim Biophys Acta 1851 : 66–75. doi: 10.1016/j.bbalip.2014.04.003 24768681
29. Al Tanoury Z, Piskunov A, Rochette-Egly C (2013) Vitamin A and retinoid signaling: genomic and nongenomic effects. J Lipid Res 54 : 1761–1775. doi: 10.1194/jlr.R030833 23440512
30. Altucci L, Rossin A, Hirsch O, Nebbioso A, Vitoux D, Wilhelm E, et al. (2005) Rexinoid-triggered differentiation and tumor-selective apoptosis of acute myeloid leukemia by protein kinase A-mediated desubordination of retinoid X receptor. Cancer Res 65 : 8754–8765. doi: 10.1158/0008-5472.CAN-04-3569 16204045
31. Lopez-Carballo G, Moreno L, Masia S, Perez P, Barettino D (2002) Activation of the phosphatidylinositol 3-kinase/Akt signaling pathway by retinoic acid is required for neural differentiation of SH-SY5Y human neuroblastoma cells. J Biol Chem 277 : 25297–25304. doi: 10.1074/jbc.M201869200 12000752
32. Canon E, Cosgaya JM, Scsucova S, Aranda A (2004) Rapid effects of retinoic acid on CREB and ERK phosphorylation in neuronal cells. Mol Biol Cell 15 : 5583–5592. doi: 10.1091/mbc.E04-05-0439 15371543
33. Chen N, Napoli JL (2008) All-trans-retinoic acid stimulates translation and induces spine formation in hippocampal neurons through a membrane-associated RARalpha. FASEB J 22 : 236–245. doi: 10.1096/fj.07-8739com 17712061
34. Persaud SD, Lin YW, Wu CY, Kagechika H, Wei LN (2013) Cellular retinoic acid binding protein I mediates rapid non-canonical activation of ERK1/2 by all-trans retinoic acid. Cell Signal 25 : 19–25. doi: 10.1016/j.cellsig.2012.09.002 22982089
35. Gupta P, Ho PC, Huq MM, Ha SG, Park SW, Khan AA, et al. (2008) Retinoic acid-stimulated sequential phosphorylation, PML recruitment, and SUMOylation of nuclear receptor TR2 to suppress Oct4 expression. Proc Natl Acad Sci U S A 105 : 11424–11429. doi: 10.1073/pnas.0710561105 18682553
36. Alsayed Y, Uddin S, Mahmud N, Lekmine F, Kalvakolanu DV, Minucci S, et al. (2001) Activation of Rac1 and the p38 mitogen-activated protein kinase pathway in response to all-trans-retinoic acid. J Biol Chem 276 : 4012–4019. doi: 10.1074/jbc.M007431200 11060298
37. Bruck N, Vitoux D, Ferry C, Duong V, Bauer A, de The H, et al. (2009) A coordinated phosphorylation cascade initiated by p38MAPK/MSK1 directs RARalpha to target promoters. EMBO J 28 : 34–47. doi: 10.1038/emboj.2008.256 19078967
38. Gianni M, Bauer A, Garattini E, Chambon P, Rochette-Egly C (2002) Phosphorylation by p38MAPK and recruitment of SUG-1 are required for RA-induced RAR gamma degradation and transactivation. EMBO J 21 : 3760–3769. doi: 10.1093/emboj/cdf374 12110588
39. Bost F, Caron L, Marchetti I, Dani C, Le Marchand-Brustel Y, Binetruy B (2002) Retinoic acid activation of the ERK pathway is required for embryonic stem cell commitment into the adipocyte lineage. Biochem J 361 : 621–627. doi: 10.1042/0264-6021 : 3610621 11802792
40. Pellegrini M, Filipponi D, Gori M, Barrios F, Lolicato F, Grimaldi P, et al. (2008) ATRA and KL promote differentiation toward the meiotic program of male germ cells. Cell Cycle 7 : 3878–3888. doi: 10.4161/cc.7.24.7262 19098446
41. Zhou Y, Qin Y, Qin Y, Xu B, Guo T, Ke H, et al. (2018) Wdr62 is involved in female meiotic initiation via activating JNK signaling and associated with POI in humans. PLoS Genet 14: e1007463. doi: 10.1371/journal.pgen.1007463 30102701
42. Szabo PE, Hubner K, Scholer H, Mann JR (2002) Allele-specific expression of imprinted genes in mouse migratory primordial germ cells. Mech Dev 115 : 157–160. doi: 10.1016/s0925-4773(02)00087-4 12049782
43. Ohta K, Yamamoto M, Lin Y, Hogg N, Akiyama H, Behringer RR, et al. (2012) Male differentiation of germ cells induced by embryonic age-specific Sertoli cells in mice. Biol Reprod 86 : 112. doi: 10.1095/biolreprod.111.095943 22262692
44. Chuma S, Nakatsuji N (2001) Autonomous transition into meiosis of mouse fetal germ cells in vitro and its inhibition by gp130-mediated signaling. Dev Biol 229 : 468–479. doi: 10.1006/dbio.2000.9989 11203703
45. Yamazaki Y, Low EW, Marikawa Y, Iwahashi K, Bartolomei MS, McCarrey JR, et al. (2005) Adult mice cloned from migrating primordial germ cells. Proc Natl Acad Sci U S A 102 : 11361–11366. doi: 10.1073/pnas.0504943102 16055553
46. Iwahashi K, Yoshioka H, Low EW, McCarrey JR, Yanagimachi R, Yamazaki Y (2007) Autonomous regulation of sex-specific developmental programming in mouse fetal germ cells. Biol Reprod 77 : 697–706. doi: 10.1095/biolreprod.107.062851 17615405
47. Favata MF, Horiuchi KY, Manos EJ, Daulerio AJ, Stradley DA, Feeser WS, et al. (1998) Identification of a novel inhibitor of mitogen-activated protein kinase kinase. J Biol Chem 273 : 18623–18632. doi: 10.1074/jbc.273.29.18623 9660836
48. Toyooka Y, Tsunekawa N, Takahashi Y, Matsui Y, Satoh M, Noce T (2000) Expression and intracellular localization of mouse Vasa-homologue protein during germ cell development. Mech Dev 93 : 139–149. doi: 10.1016/s0925-4773(00)00283-5 10781947
49. Hunter N, Borner GV, Lichten M, Kleckner N (2001) Gamma-H2AX illuminates meiosis. Nat Genet 27 : 236–238. doi: 10.1038/85781 11242097
50. Gianni M, Parrella E, Raska I Jr., Gaillard E, Nigro EA, Gaudon C, et al. (2006) P38MAPK-dependent phosphorylation and degradation of SRC-3/AIB1 and RARalpha-mediated transcription. EMBO J 25 : 739–751. doi: 10.1038/sj.emboj.7600981 16456540
51. Gehani SS, Agrawal-Singh S, Dietrich N, Christophersen NS, Helin K, Hansen K (2010) Polycomb group protein displacement and gene activation through MSK-dependent H3K27me3S28 phosphorylation. Mol Cell 39 : 886–900. doi: 10.1016/j.molcel.2010.08.020 20864036
52. Cheung YT, Lau WK, Yu MS, Lai CS, Yeung SC, So KF, et al. (2009) Effects of all-trans-retinoic acid on human SH-SY5Y neuroblastoma as in vitro model in neurotoxicity research. Neurotoxicology 30 : 127–135. doi: 10.1016/j.neuro.2008.11.001 19056420
53. Masia S, Alvarez S, de Lera AR, Barettino D (2007) Rapid, nongenomic actions of retinoic acid on phosphatidylinositol-3-kinase signaling pathway mediated by the retinoic acid receptor. Mol Endocrinol 21 : 2391–2402. doi: 10.1210/me.2007-0062 17595318
54. Stavridis MP, Collins BJ, Storey KG (2010) Retinoic acid orchestrates fibroblast growth factor signalling to drive embryonic stem cell differentiation. Development 137 : 881–890. doi: 10.1242/dev.043117 20179094
55. Yen A, Roberson MS, Varvayanis S, Lee AT (1998) Retinoic acid induced mitogen-activated protein (MAP)/extracellular signal-regulated kinase (ERK) kinase-dependent MAP kinase activation needed to elicit HL-60 cell differentiation and growth arrest. Cancer Res 58 : 3163–3172. 9679985
56. Scheibe RJ, Ginty DD, Wagner JA (1991) Retinoic acid stimulates the differentiation of PC12 cells that are deficient in cAMP-dependent protein kinase. J Cell Biol 113 : 1173–1182. doi: 10.1083/jcb.113.5.1173 1645738
57. Chambon P (1996) A decade of molecular biology of retinoic acid receptors. FASEB J 10 : 940–954. 8801176
58. Kefaloyianni E, Gaitanaki C, Beis I (2006) ERK1/2 and p38-MAPK signalling pathways, through MSK1, are involved in NF-kappaB transactivation during oxidative stress in skeletal myoblasts. Cell Signal 18 : 2238–2251. doi: 10.1016/j.cellsig.2006.05.004 16806820
59. McCoy CE, Campbell DG, Deak M, Bloomberg GB, Arthur JS (2005) MSK1 activity is controlled by multiple phosphorylation sites. Biochem J 387 : 507–517. doi: 10.1042/BJ20041501 15568999
60. Deak M, Clifton AD, Lucocq LM, Alessi DR (1998) Mitogen - and stress-activated protein kinase-1 (MSK1) is directly activated by MAPK and SAPK2/p38, and may mediate activation of CREB. EMBO J 17 : 4426–4441. doi: 10.1093/emboj/17.15.4426 9687510
61. Lau PN, Cheung P (2011) Histone code pathway involving H3 S28 phosphorylation and K27 acetylation activates transcription and antagonizes polycomb silencing. Proc Natl Acad Sci U S A 108 : 2801–2806. doi: 10.1073/pnas.1012798108 21282660
62. Aranda S, Mas G, Di Croce L (2015) Regulation of gene transcription by Polycomb proteins. Sci Adv 1: e1500737. doi: 10.1126/sciadv.1500737 26665172
63. Simon JA, Kingston RE (2013) Occupying chromatin: Polycomb mechanisms for getting to genomic targets, stopping transcriptional traffic, and staying put. Mol Cell 49 : 808–824. doi: 10.1016/j.molcel.2013.02.013 23473600
64. Yokobayashi S, Liang CY, Kohler H, Nestorov P, Liu Z, Vidal M, et al. (2013) PRC1 coordinates timing of sexual differentiation of female primordial germ cells. Nature 495 : 236–240. doi: 10.1038/nature11918 23486062
Článek High heat tolerance in plants from the Andean highlands: Implications for paramos in a warmer worldČlánek Hidden noise in immunologic parameters might explain rapid progression in early-onset periodontitisČlánek Population preferences for breast cancer screening policies: Discrete choice experiment in BelarusČlánek Molecular characterisation of genital human papillomavirus among women in Southwestern, NigeriaČlánek Whole body periodic acceleration in normal and reduced mucociliary clearance of conscious sheepČlánek A study of psychological pain in substance use disorder and its relationship to treatment outcomeČlánek Addiction of mesenchymal phenotypes on the FGF/FGFR axis in oral squamous cell carcinoma cellsČlánek A digital collection of rare and endangered lemurs and other primates from the Duke Lemur CenterČlánek Protocol development for discovery of angiogenesis inhibitors via automated methods using zebrafishČlánek Temporal weights in loudness: Investigation of the effects of background noise and sound levelČlánek Isolation and identification of an isoflavone reducing bacterium from feces from a pregnant horseČlánek The bacterial community in potato is recruited from soil and partly inherited across generationsČlánek Infective endocarditis and diabetes mellitus: Results from a single-center study from 1994 to 2017Článek The trajectory of patterns of light and sedentary physical activity among females, ages 14-23Článek Estimation of maize evapotraspiration under drought stress - A case study of Huaibei Plain, ChinaČlánek Honey bee microbiome associated with different hive and sample types over a honey production seasonČlánek Incidence of colorectal cancer in Eritrea: Data from the National Health Laboratory, 2011-2017Článek Dispersion of Legionella bacteria in atmosphere: A practical source location estimation methodČlánek Factors influencing bird-building collisions in the downtown area of a major North American cityČlánek Decreased retinal thickness in patients with Alzheimer’s disease is correlated with disease severityČlánek Moving system with action sport cameras: 3D kinematics of the walking and running in a large volumeČlánek Impacts of risk and competition on the profitability of banks: Empirical evidence from PakistanČlánek Tributyltin chloride (TBT) induces RXRA down-regulation and lipid accumulation in human liver cellsČlánek Differences in clinical features of cluster headache between drinkers and nondrinkers in JapanČlánek Polo-like kinase 1 (Plk1) inhibition synergizes with taxanes in triple negative breast cancerČlánek Genome-wide SNP analyses reveal population structure of Portunus pelagicus along Vietnam coastlineČlánek Manipulating the odds: The effects of Machiavellianism and construal level on cheating behaviorČlánek Primary care in five European countries: A citizens’ perspective on the quality of care for childrenČlánek Overcoming platinum resistance in ovarian cancer by targeting pregnancy-associated plasma protein-AČlánek Capacity of the medullary cavity of tibia and femur for intra-bone marrow transplantation in miceČlánek Phylogenetic revision of Gymnotidae (Teleostei: Gymnotiformes), with descriptions of six subgeneraČlánek Identification of a novel monocytic phenotype in Classic Hodgkin Lymphoma tumor microenvironmentČlánek Binding and dynamics of melatonin at the interface of phosphatidylcholine-cholesterol membranesČlánek Gender disparities in scientific production: A nationwide assessment among physicians in PeruČlánek Study on the damage characteristics of gas-bearing shale under different unloading stress pathsČlánek Association of clinical factors with survival outcomes in laryngeal squamous cell carcinoma (LSCC)Článek Appropriate management of acute gastroenteritis in Australian children: A population-based studyČlánek More than just availability: Who has access and who administers take-home naloxone in Baltimore, MDČlánek Protein synthesis rates of muscle, tendon, ligament, cartilage, and bone tissue in vivo in humansČlánek Gene expression microarray public dataset reanalysis in chronic obstructive pulmonary diseaseČlánek Utility of the new cobas HCV test for viral load monitoring during direct-acting antiviral therapyČlánek Minimal effects of oyster aquaculture on local water quality: Examples from southern Chesapeake BayČlánek Finding phrases: On the role of co-verbal facial information in learning word order in infancyČlánek Yeasts affect tolerance of Drosophila melanogaster to food substrate with high NaCl concentrationČlánek The effect of climate change on cholera disease: The road ahead using artificial neural networkČlánek Adaptive fuzzy flow rate control considering multifractal traffic modeling and 5G communicationsČlánek UM171 induces a homeostatic inflammatory-detoxification response supporting human HSC self-renewalČlánek The ZJU index is a powerful surrogate marker for NAFLD in severely obese North American womenČlánek Vaccine cold chain in general practices: A prospective study in 75 refrigerators (Keep Cool study)Článek Artificial insemination with fresh, liquid stored and frozen thawed semen in dromedary camelsČlánek Mammary microbiome of lactating organic dairy cows varies by time, tissue site, and infection statusČlánek An outbreak of tuberculosis in a middle school in Henan, China: Epidemiology and risk factorsČlánek Impact of UVC-sustained recirculating air filtration on airborne bacteria and dust in a pig facilityČlánek Pre-clinical medical student reflections on implicit bias: Implications for learning and teachingČlánek Foxtail millet (Setaria italica (L.) P. Beauv) CIPKs are responsive to ABA and abiotic stressesČlánek Calreticulin regulates vascular endothelial growth factor-A mRNA stability in gastric cancer cellsČlánek The association between haemoglobin levels in the first 20 weeks of pregnancy and pregnancy outcomesČlánek Factors associated with persistently high-cost health care utilization for musculoskeletal painČlánek Why men with a low-risk prostate cancer select and stay on active surveillance: A qualitative studyČlánek Imported severe malaria and risk factors for intensive care: A single-centre retrospective analysisČlánek Effectiveness of telerehabilitation in the management of adults with stroke: A systematic reviewČlánek Evaluation of neutral oral contrast agents for assessment of the small bowel at abdominal staging CTČlánek Determinants of mortality among patients with drug-resistant tuberculosis in northern NigeriaČlánek Effects of tetracycline on myocardial infarct size in obese rats with chemically-induced colitisČlánek Patient-level cost of home- and facility-based child pneumonia treatment in Suba Sub County, KenyaČlánek TAP: A static analysis model for PHP vulnerabilities based on token and deep learning technologyČlánek Time trends between 2002 and 2017 in correlates of self-reported sitting time in European adultsČlánek Establishment of the experimental procedure for prediction of conjugation capacity in mutant UGT1A1Článek The performance of practitioners conducting facial comparisons on images of children across ageČlánek Risk of temperature, humidity and concentrations of air pollutants on the hospitalization of AECOPDČlánek Willingness to receive institutional and community-based eldercare among the rural elderly in ChinaČlánek Nonarteritic anterior ischemic optic neuropathy is associated with cerebral small vessel diseaseČlánek An evolution of socioeconomic related inequality in teenage pregnancy and childbearing in MalawiČlánek Migration and political polarization in the U.S.: An analysis of the county-level migration networkČlánek Retraction: Placental expression of CD100, CD72 and CD45 is dysregulated in human miscarriageČlánek Oxygen delivery, oxygen consumption and decreased kidney function after cardiopulmonary bypassČlánek Location, location, location: Close ties among older continuing care retirement community residentsČlánek Metabolic costs of spontaneous swimming in Sprattus sprattus L., at different water temperaturesČlánek Multiple innate antibacterial immune defense elements are correlated in diverse ungulate speciesČlánek First evidence of hepatitis E virus infection in a small mammal (yellow-necked mouse) from CroatiaČlánek Semantic computational analysis of anticoagulation use in atrial fibrillation from real world dataČlánek A mathematical model of honey bee colony dynamics to predict the effect of pollen on colony failureČlánek Socioeconomic determinants of cancer screening utilisation in Latin America: A systematic reviewČlánek Towards successful business process improvement – An extension of change acceleration process modelČlánek Correction: Intensive longitudinal modelling predicts diurnal activity of salivary alpha-amylaseČlánek HHIP overexpression inhibits the proliferation, migration and invasion of non-small cell lung cancerČlánek Influence of season and social context on male giant panda (Ailuropoda melanoleuca) vocal behaviourČlánek Development of an intravaginal ring for the topical delivery of Aurora kinase A inhibitor, MLN8237
Článek vyšel v časopisePLOS One
Nejčtenější tento týden
2019 Číslo 11- Psilocybin je v Česku od 1. ledna 2026 schválený. Co to znamená v praxi?
- AUDIO: (Jak) je možné prodloužit si život?
- Alergie na antibiotika u žen s infekcemi močových cest − poznatky z průřezové studie z USA
- Koordinátoři onkologické péče zkrátí pacientům cestu systémem. Jak to bude fungovat v praxi?
- 4× stručně ke zpřesnění diagnostiky civilizačních chorob – „jednohubky“ z klinického výzkumu 2026/5
-
Všechny články tohoto čísla
- Wild Steps in a semi-wild setting? Habitat selection and behavior of European bison reintroduced to an enclosure in an anthropogenic landscape
- The effect of facial expression on contrast sensitivity: A behavioural investigation and extension of Hedger, Adams & Garner (2015)
- Non-communicable diseases risk factors and their determinants: A cross-sectional state-wide STEPS survey, Haryana, North India
- Genotype-matched Newcastle disease virus vaccine confers improved protection against genotype XII challenge: The importance of cytoplasmic tails in viral replication and vaccine design
- Combined transcriptomics and proteomics forecast analysis for potential genes regulating the Columbian plumage color in chickens
- Persistence of traditional and emergence of new structural drivers and factors for the HIV epidemic in rural Uganda; A qualitative study
- Competency assessment of the medical interns and nurses and documenting prevailing practices to provide family planning services in teaching hospitals in three states of India
- Choice of birth place among antenatal clinic attendees in rural mission hospitals in Ebonyi State, South-East Nigeria
- Dual pathway for metabolic engineering of Escherichia coli to produce the highly valuable hydroxytyrosol
- Genetic and genomic analyses underpin the feasibility of concomitant genetic improvement of milk yield and mastitis resistance in dairy sheep
- Long-term exposure to daily ethanol injections in DBA/2J and Swiss mice: Lessons for the interpretation of ethanol sensitization
- Taxonomic and functional anuran beta diversity of a subtropical metacommunity respond differentially to environmental and spatial predictors
- A simple way to improve a conventional A/O-MBR for high simultaneous carbon and nutrient removal from synthetic municipal wastewater
- Knowledge and awareness of cervical cancer in Southwestern Ethiopia is lacking: A descriptive analysis
- Flat electrode contacts for vagus nerve stimulation
- Circulating Th17.1 cells as candidate for the prediction of therapeutic response to abatacept in patients with rheumatoid arthritis: An exploratory research
- Prevalence and socioeconomic determinants of development delay among children in Ceará, Brazil: A population-based study
- Characterizing macroinvertebrate community composition and abundance in freshwater tidal wetlands of the Sacramento-San Joaquin Delta
- A randomized controlled trial comparing isosorbide dinitrate-oxytocin versus misoprostol-oxytocin at management of foetal intrauterine death
- Hello, is that me you are looking for? A re-examination of the role of the DMN in social and self relevant aspects of off-task thought
- Lactobacillus rhamnosus Lcr35 as an effective treatment for preventing Candida albicans infection in the invertebrate model Caenorhabditis elegans: First mechanistic insights
- Use of latent class analysis to identify multimorbidity patterns and associated factors in Korean adults aged 50 years and older
- A study of psychological pain in substance use disorder and its relationship to treatment outcome
- Effects of artificially introduced Enterococcus faecalis strains in experimental necrotizing enterocolitis
- Treatment-seeking for vaginal fistula in sub-Saharan Africa
- Dissemination and stakeholder engagement practices among dissemination & implementation scientists: Results from an online survey
- Comparative analysis of the accelerated aged seed transcriptome profiles of two maize chromosome segment substitution lines
- Transactional sex among men who have sex with men participating in the CohMSM prospective cohort study in West Africa
- Addiction of mesenchymal phenotypes on the FGF/FGFR axis in oral squamous cell carcinoma cells
- Left parietal tACS at alpha frequency induces a shift of visuospatial attention
- Microtranscriptome analysis of sugarcane cultivars in response to aluminum stress
- The role of alien species on plant-floral visitor network structure in invaded communities
- Predictive factors for unfavourable treatment in MDR-TB and XDR-TB patients in Rio de Janeiro State, Brazil, 2000-2016
- Agricultural impacts on streams near Nitrate Vulnerable Zones: A case study in the Ebro basin, Northern Spain
- Development of a multi-locus typing scheme for an Enterobacteriaceae linear plasmid that mediates inter-species transfer of flagella
- The roles of MRI-based prostate volume and associated zone-adjusted prostate-specific antigen concentrations in predicting prostate cancer and high-risk prostate cancer
- Re-modeling of foliar membrane lipids in a seagrass allows for growth in phosphorus-deplete conditions
- Effect of sampling frequency on fractal fluctuations during treadmill walking
- Effect of calcium intake and the dietary cation-anion difference during early lactation on the bone mobilization dynamics throughout lactation in dairy cows
- Facilitators and barriers to linkage to HIV care and treatment among female sex workers in a community-based HIV prevention intervention in Tanzania: A qualitative study
- Tuberculosis treatment outcome: The case of women in Ethiopia and China, ten-years retrospective cohort study
- Protein:Protein interactions in the cytoplasmic membrane apparently influencing sugar transport and phosphorylation activities of the e. coli phosphotransferase system
- A digital collection of rare and endangered lemurs and other primates from the Duke Lemur Center
- Computational fluid dynamics simulation of changes in the morphology and airflow dynamics of the upper airways in OSAHS patients after treatment with oral appliances
- Resistome metagenomics from plate to farm: The resistome and microbial composition during food waste feeding and composting on a Vermont poultry farm
- Lower limb chronic edema management program: Perspectives of disengaged patients on challenges, enablers and barriers to program attendance and adherence
- Discovery of powdery mildew resistance gene candidates from Aegilops biuncialis chromosome 2Mb based on transcriptome sequencing
- Modelling vegetation understory cover using LiDAR metrics
- Assessing the impact of the “one-child policy” in China: A synthetic control approach
- CRISPR-Cas9 modified bacteriophage for treatment of Staphylococcus aureus induced osteomyelitis and soft tissue infection
- Forecasting type-specific seasonal influenza after 26 weeks in the United States using influenza activities in other countries
- Chronic exercise modulates the cellular immunity and its cannabinoid receptors expression
- Characterization of the diverse plasmid pool harbored by the blaNDM-1-containing Acinetobacter bereziniae HPC229 clinical strain
- What does mitogenomics tell us about the evolutionary history of the Drosophila buzzatii cluster (repleta group)?
- A cell-based evaluation of a non-essential amino acid formulation as a non-bioactive control for activation and stimulation of muscle protein synthesis using ex vivo human serum
- Conjugated linoleic acid as a novel insecticide targeting the agricultural pest Leptinotarsa decemlineata
- Relationship between pattern electroretinogram and optic disc morphology in glaucoma
- Depicting changes in land surface cover at Al-Hassa oasis of Saudi Arabia using remote sensing and GIS techniques
- Land snail dispersal, abundance and diversity on green roofs
- Fanconi-BRCA pathway mutations in childhood T-cell acute lymphoblastic leukemia
- Mesenchymal Stem/ Stromal Cells metabolomic and bioactive factors profiles: A comparative analysis on the umbilical cord and dental pulp derived Stem/ Stromal Cells secretome
- The association between caesarean section delivery and later life obesity in 21-24 year olds in an Urban South African birth cohort
- Diagnosis and treatment of acute respiratory illness in children under five in primary care in low-, middle-, and high-income countries: A descriptive FRESH AIR study
- Quality control of cervical cytology using a 3-type HPV mRNA test increases screening program sensitivity of cervical intraepithelial neoplasia grade 2+ in young Norwegian women—A cohort study
- Toxicity and sublethal effects of two plant allelochemicals on the demographical traits of cotton aphid, Aphis gossypii Glover (Hemiptera: Aphididae)
- Protocol development for discovery of angiogenesis inhibitors via automated methods using zebrafish
- Friends with malefit. The effects of keeping dogs and cats, sustaining animal-related injuries and Toxoplasma infection on health and quality of life
- Trueness of digital intraoral impression in reproducing multiple implant position
- Comparison of drug safety data obtained from the monitoring system, literature, and social media: An empirical proof from a Chinese patent medicine
- Norm values and psychometric properties of the short version of the Trier Inventory for Chronic Stress (TICS) in a representative German sample
- Maternal health and birth outcomes in a South African birth cohort study
- Structural characterization of scorpion peptides and their bactericidal activity against clinical isolates of multidrug-resistant bacteria
- Molecular evolution of genes encoding allergen proteins in the peanuts genus Arachis: Structural and functional implications
- Structural characterization of the saxitoxin-targeting APTSTX1 aptamer using optical tweezers and molecular dynamics simulations
- Residential household yard care practices along urban-exurban gradients in six climatically-diverse U.S. metropolitan areas
- Formal comment on “Assessing the impact of the ‘one-child policy’ in China: A synthetic control approach”
- Evaluation of a global spring wheat panel for stripe rust: Resistance loci validation and novel resources identification
- “Big men” in the office: The gender-specific influence of weight upon persuasiveness
- Modification of everyday activities and its association with self-awareness in cognitively diverse older adults
- The effect of bivalve filtration on eDNA-based detection of aquatic organisms
- Selective culture enrichment and sequencing of feces to enhance detection of antimicrobial resistance genes in third-generation cephalosporin resistant Enterobacteriaceae
- Development and validation of rapid environmental DNA (eDNA) detection methods for bog turtle (Glyptemys muhlenbergii)
- Average and time-specific maternal prenatal inflammatory biomarkers and the risk of labor epidural associated fever
- Preference-based measure of health-related quality of life and its determinants in sickle cell disease in Nigeria
- Factors influencing participation dynamics in research for development interventions with multi-stakeholder platforms: A metric approach to studying stakeholder participation
- Contextual variation in young children’s acquisition of social-emotional skills
- Prokaryotic and eukaryotic microbiomes associated with blooms of the ichthyotoxic dinoflagellate Cochlodinium (Margalefidinium) polykrikoides in New York, USA, estuaries
- Reconciling the statistics of spectral reflectance and colour
- Temporal weights in loudness: Investigation of the effects of background noise and sound level
- A global assessment of street-network sprawl
- Correction: KRIT1 Regulates the Homeostasis of Intracellular Reactive Oxygen Species
- Mindfulness-Based Blood Pressure Reduction (MB-BP): Stage 1 single-arm clinical trial
- Measurement of abortion safety using community-based surveys: Findings from three countries
- Behavioral response of naïve and non-naïve deer to wolf urine
- SNARE proteins rescue impaired autophagic flux in Down syndrome
- Negative impact of gestational diabetes mellitus on progress of pelvic floor muscle electromyography activity: Cohort study
- Change in left inferior frontal connectivity with less unexpected harmonic cadence by musical expertise
- Structural mechanism for regulation of DNA binding of BpsR, a Bordetella regulator of biofilm formation, by 6-hydroxynicotinic acid
- How does open innovation lead competitive advantage? A dynamic capability view perspective
- Bull efficiency using dairy genetic traits
- Improved cortical boundary registration for locally distorted fMRI scans
- Extractive single document summarization using binary differential evolution: Optimization of different sentence quality measures
- Measuring the tilt and slant of Chinese handwriting in primary school students: A computerized approach
- Isolation and identification of an isoflavone reducing bacterium from feces from a pregnant horse
- Sugar labeling: How numerical information of sugar content influences healthiness and tastiness expectations
- Optimally adjusted last cluster for prediction based on balancing the bias and variance by bootstrapping
- Quantifying normal and parkinsonian gait features from home movies: Practical application of a deep learning–based 2D pose estimator
- Heterogeneity of porcine bone marrow-derived dendritic cells induced by GM-CSF
- Can visual interpretation of NucliSens graphs reduce the need for repeat viral load testing?
- Manganese levels in infant formula and young child nutritional beverages in the United States and France: Comparison to breast milk and regulations
- Association between metabolic body composition status and risk for impaired renal function: A cross-sectional study
- Toddler skills predict moderate-to-late preterm born children’s cognition and behaviour at 6 years of age
- The bacterial community in potato is recruited from soil and partly inherited across generations
- Infective endocarditis and diabetes mellitus: Results from a single-center study from 1994 to 2017
- Patient satisfaction with HIV services in Vietnam: Status, service models and association with treatment outcome
- Ion concentration polarization (ICP) of proteins at silicon micropillar nanogaps
- The trajectory of patterns of light and sedentary physical activity among females, ages 14-23
- Coadministration of kla peptide with HPRP-A1 to enhance anticancer activity
- Measuring the complexity of directed graphs: A polynomial-based approach
- Estimation of maize evapotraspiration under drought stress - A case study of Huaibei Plain, China
- Publication rates in animal research. Extent and characteristics of published and non-published animal studies followed up at two German university medical centres
- Developmental conservation of microRNA gene localization at the nuclear periphery
- Exploring critical factors of the perceived usefulness of blended learning for higher education students
- Anti-Alzheimer potential, metabolomic profiling and molecular docking of green synthesized silver nanoparticles of Lampranthus coccineus and Malephora lutea aqueous extracts
- Protective effect of Platymiscium floribundum Vog. in tree extract on periodontitis inflammation in rats
- Direct transport vs secondary transfer to level I trauma centers in a French exclusive trauma system: Impact on mortality and determinants of triage on road-traffic victims
- Honey bee microbiome associated with different hive and sample types over a honey production season
- Bacterial communities in the rhizosphere, phyllosphere and endosphere of tomato plants
- Sildenafil citrate long-term treatment effects on cardiovascular reactivity in a SHR experimental model of metabolic syndrome
- Postoperative delirium after lung resection for primary lung cancer: Risk factors, risk scoring system, and prognosis
- The CSF-1-receptor inhibitor, JNJ-40346527 (PRV-6527), reduced inflammatory macrophage recruitment to the intestinal mucosa and suppressed murine T cell mediated colitis
- Using Er:YAG laser to remove lithium disilicate crowns from zirconia implant abutments: An in vitro study
- Antibacterial efficacy of cold atmospheric plasma against Enterococcus faecalis planktonic cultures and biofilms in vitro
- Mechanisms of African swine fever virus pathogenesis and immune evasion inferred from gene expression changes in infected swine macrophages
- Application of ensemble methods to analyse the decline of organochlorine pesticides in relation to the interactions between age, gender and time
- Mitogenomic diversity in Sacred Ibis Mummies sheds light on early Egyptian practices
- Automated detection of a nonperfusion area caused by retinal vein occlusion in optical coherence tomography angiography images using deep learning
- Characterisation of a novel SCCmec VI element harbouring fusC in an emerging Staphylococcus aureus strain from the Arabian Gulf region
- Inducible UCP1 silencing: A lentiviral RNA-interference approach to quantify the contribution of beige fat to energy homeostasis
- iCrotoK-PseAAC: Identify lysine crotonylation sites by blending position relative statistical features according to the Chou’s 5-step rule
- Emerging practices supporting diabetes self-management among food insecure adults and families: A scoping review
- Does aneurysm side influence the infarction side and patients´ outcome after subarachnoid hemorrhage?
- Raising the bar: Recovery ambition for species at risk in Canada and the US
- Management of locally advanced non-small cell lung cancer in the modern era: A national Italian survey on diagnosis, treatment and multidisciplinary approach
- Foraging strategies are maintained despite workforce reduction: A multidisciplinary survey on the pollen collected by a social pollinator
- Incidence of colorectal cancer in Eritrea: Data from the National Health Laboratory, 2011-2017
- Integrated analysis of miRNA landscape and cellular networking pathways in stage-specific prostate cancer
- Evaluation of the reactogenicity, adjuvanticity and antigenicity of LT(R192G) and LT(R192G/L211A) by intradermal immunization in mice
- Role of rhesus macaque IFITM3(2) in simian immunodeficiency virus infection of macaques
- Variation in the LRR region of Pi54 protein alters its interaction with the AvrPi54 protein revealed by in silico analysis
- Evolutionarily conserved susceptibility of the mitochondrial respiratory chain to SDHI pesticides and its consequence on the impact of SDHIs on human cultured cells
- Statistical determination of synergy based on Bliss definition of drugs independence
- The association between sleep problems and academic performance in primary school-aged children: Findings from a Norwegian longitudinal population-based study
- Estimating the national cost burden of in-hospital needlestick injuries among healthcare workers in Japan
- Assessing reliability of intra-tumor heterogeneity estimates from single sample whole exome sequencing data
- Dispersion of Legionella bacteria in atmosphere: A practical source location estimation method
- Integrative proteomic and phosphoproteomic profiling of prostate cell lines
- Treatment paths for localised prostate cancer in Italy: The results of a multidisciplinary, observational, prospective study (Pros-IT CNR)
- Why are undergraduate emerging adults anxious and avoidant in their romantic relationships? The role of family relationships
- Barriers to implementation of emergency obstetric and neonatal care in rural Pakistan
- Testosterone supplementation improves insulin responsiveness in HFD fed male T2DM mice and potentiates insulin signaling in the skeletal muscle and C2C12 myocyte cell line
- Ang-(1-7)/ MAS1 receptor axis inhibits allergic airway inflammation via blockade of Src-mediated EGFR transactivation in a murine model of asthma
- Factors influencing bird-building collisions in the downtown area of a major North American city
- Collembola laterally move biochar particles
- Decreased retinal thickness in patients with Alzheimer’s disease is correlated with disease severity
- Moving system with action sport cameras: 3D kinematics of the walking and running in a large volume
- Factors influencing subclinical atherosclerosis in patients with biopsy-proven nonalcoholic fatty liver disease
- Boundary violations and adolescent drinking: Observational evidence that symbolic boundaries moderate social influence
- Inadequate conflict of interest policies at most French teaching hospitals: A survey and website analysis
- A new resolution function to evaluate tree shape statistics
- Thermostat wars? The roles of gender and thermal comfort negotiations in household energy use behavior
- Patients undergoing surgery for lumbar spinal stenosis experience unique courses of pain and disability: A group-based trajectory analysis
- Lifetime prevalence of intimate partner violence against women in an urban Brazilian city: A cross-sectional survey
- The factors associated with being left-behind children in China: Multilevel analysis with nationally representative data
- High heat tolerance in plants from the Andean highlands: Implications for paramos in a warmer world
- Quantifying pediatric patient need for second- and third-line HIV treatment: A tool for decision-making in resource-limited settings
- Discovery of actionable genetic alterations with targeted panel sequencing in children with relapsed or refractory solid tumors
- Iodine status of non-pregnant women and availability of food vehicles for fortification with iodine in a remote community in Gulf province, Papua New Guinea
- Fibre and extracellular matrix contributions to passive forces in human skeletal muscles: An experimental based constitutive law for numerical modelling of the passive element in the classical Hill-type three element model
- The status of imported Barremian-Bedoulian flint in north-eastern Iberia during the Middle Neolithic. Insights from the variscite mines of Gavà (Barcelona)
- Psychology of personal data donation
- Radiocarbon dating and cultural dynamics across Mongolia’s early pastoral transition
- MARGO (Massively Automated Real-time GUI for Object-tracking), a platform for high-throughput ethology
- Visual detection of time-varying signals: Opposing biases and their timescales
- Results from a World Health Organization pilot of the Basic Emergency Care Course in Sub Saharan Africa
- Scientists’ opinions and attitudes towards citizens’ understanding of science and their role in public engagement activities
- Dacentrurine stegosaurs (Dinosauria): A new specimen of Miragaia longicollum from the Late Jurassic of Portugal resolves taxonomical validity and shows the occurrence of the clade in North America
- Integrated pan-cancer gene expression and drug sensitivity analysis reveals SLFN11 mRNA as a solid tumor biomarker predictive of sensitivity to DNA-damaging chemotherapy
- Does membrane feeding compromise the quality of Aedes aegypti mosquitoes?
- Morphology, phylogeny, and taxonomy of two species of colonial volvocine green algae from Lake Victoria, Tanzania
- Metabolomics profiles associated with HbA1c levels in patients with type 2 diabetes
- Exploring local realities: Perceptions and experiences of healthcare workers on the management and control of drug-resistant tuberculosis in Addis Ababa, Ethiopia
- Sex differences in the treatment and outcome of emergency general surgery
- Comorbidities and costs in HIV patients: A retrospective claims database analysis in Germany
- Barriers to integration of bioinformatics into undergraduate life sciences education: A national study of US life sciences faculty uncover significant barriers to integrating bioinformatics into undergraduate instruction
- Local unemployment changes the springboard effect of low pay: Evidence from England
- A comparison of body composition assessment methods in climbers: Which is better?
- Comparison of an in-house ‘home-brew’ and commercial ViroSeq integrase genotyping assays on HIV-1 subtype C samples
- Elucidating genetic variability and population structure in Venturia inaequalis associated with apple scab diseaseusing SSR markers
- Clustering via hypergraph modularity
- Indomethacin enhances anti-tumor efficacy of a MUC1 peptide vaccine against breast cancer in MUC1 transgenic mice
- Multistage fuzzy comprehensive evaluation of landslide hazards based on a cloud model
- Inducible microRNA-200c decreases motility of breast cancer cells and reduces filamin A
- Pharmacological signatures of the reduced incidence and the progression of cognitive decline in ageing populations suggest the protective role of beneficial polypharmacy
- Continuous influenza virus production in a tubular bioreactor system provides stable titers and avoids the “von Magnus effect”
- Complex interaction networks of cytokines after transarterial chemotherapy in patients with hepatocellular carcinoma
- Gender essentialism in transgender and cisgender children
- Insertional mutagenesis in the zoonotic pathogen Chlamydia caviae
- Being there: A scoping review of grief support training in medical education
- Does the psychological profile influence the position of promising young futsal players?
- Effect of self-rated health status on functioning difficulties among older adults in Ghana: Coarsened exact matching method of analysis of the World Health Organization’s study on global AGEing and adult health, Wave 2
- Olfactory screening of Parkinson’s Disease patients and healthy subjects in China and Germany: A study of cross-cultural adaptation of the Sniffin’ Sticks 12-identification test
- Molecular evolution of cytochrome C oxidase-I protein of insects living in Saudi Arabia
- Correlates of leisure-time sedentary behavior among 181,793 adolescents aged 12-15 years from 66 low- and middle-income countries
- Cost-effectiveness analysis of Mucosal Leishmaniasis diagnosis with PCR-based vs parasitological tests in Colombia
- Spatiotemporal analysis of historical records (2001–2012) on dengue fever in Vietnam and development of a statistical model for forecasting risk
- Resilience assessment of Puerto Rico’s coral reefs to inform reef management
- Effect of community based health education on knowledge and attitude towards iron and folic acid supplementation among pregnant women in Kiambu County, Kenya: A quasi experimental study
- Implementation and effectiveness of non-specialist mediated interventions for children with Autism Spectrum Disorder: A systematic review and meta-analysis
- A tailored cognitive behavioral program for juvenile justice-referred females at risk of substance use and delinquency: A pilot quasi-experimental trial
- Impact of adjusted kidney volume measured in the bench surgery on one-year renal function in kidney transplantation
- Machine learning algorithm validation with a limited sample size
- The magnitude of suicidal ideation, attempts and associated factors of HIV positive youth attending ART follow ups at St. Paul’s hospital Millennium Medical College and St. Peter’s specialized hospital, Addis Ababa, Ethiopia, 2018
- The nonlinear effect of financial and fiscal policies on poverty alleviation in China—An empirical analysis of Chinese 382 impoverished counties with PSTR models
- Impacts of risk and competition on the profitability of banks: Empirical evidence from Pakistan
- Molecular characterization of lung adenocarcinoma from Korean patients using next generation sequencing
- An expansin-like protein expands forage cell walls and synergistically increases hydrolysis, digestibility and fermentation of livestock feeds by fibrolytic enzymes
- Joint image compression and encryption based on sparse Bayesian learning and bit-level 3D Arnold cat maps
- Urticating setae of tarantulas (Araneae: Theraphosidae): Morphology, revision of typology and terminology and implications for taxonomy
- Live observation of the oviposition process in Daphnia magna
- On the accuracy of displacement-based wave intensity analysis: Effect of vessel wall viscoelasticity and nonlinearity
- Nodosilinea signiensis sp. nov. (Leptolyngbyaceae, Synechococcales), a new terrestrial cyanobacterium isolated from mats collected on Signy Island, South Orkney Islands, Antarctica
- A 3’ UTR SNP rs885863, a cis-eQTL for the circadian gene VIPR2 and lincRNA 689, is associated with opioid addiction
- Characterizing the Randot Preschool stereotest: Testability, norms, reliability, specificity and sensitivity in children aged 2-11 years
- Tributyltin chloride (TBT) induces RXRA down-regulation and lipid accumulation in human liver cells
- Amazon climatic factors driving terpene composition of Iryanthera polyneura Ducke in terra-firme forest: A statistical approach
- Differences in clinical features of cluster headache between drinkers and nondrinkers in Japan
- Distribution of macular ganglion cell layer thickness in foveal hypoplasia: A new diagnostic criterion for ocular albinism
- Polo-like kinase 1 (Plk1) inhibition synergizes with taxanes in triple negative breast cancer
- Effect of mechanochemical activation of natural phosphorite structure as well as phosphorus solubility
- Automated content analysis across six languages
- A deep learning reconstruction framework for X-ray computed tomography with incomplete data
- Integrating interconception care in preventive child health care services: The Healthy Pregnancy 4 All program
- The prognostic significance of tumor-infiltrating lymphocytes assessment with hematoxylin and eosin sections in resected primary lung adenocarcinoma
- Effectiveness of novel fabrics to resist punctures and lacerations from white shark (Carcharodon carcharias): Implications to reduce injuries from shark bites
- Bacillus Calmette-Guérin (BCG) therapy lowers the incidence of Alzheimer’s disease in bladder cancer patients
- Serial block-face scanning electron microscopy reveals neuronal-epithelial cell fusion in the mouse cornea
- Salt or fish (or salted fish)? The Bronze Age specialised sites along the Tyrrhenian coast of Central Italy: New insights from Caprolace settlement
- Pragmatic language dysfunction in systemic lupus erythematosus patients: Results from a single center Italian study
- Association between cerebral atrophy and osteoporotic vertebral compression fractures
- Latitudinal gradient of cyanobacterial diversity in tidal flats
- Gene expression based survival prediction for cancer patients—A topic modeling approach
- Understanding allergic multimorbidity within the non-eosinophilic interactome
- The association between psychological distress and angina pectoris: A population-based study
- Comparative analysis on Facebook post interaction using DNN, ELM and LSTM
- Cerebellum-mediated trainability of eye and head movements for dynamic gazing
- Psychological and physiological effects of applying self-control to the mobile phone
- Omecamtiv mecarbil lowers the contractile deficit in a mouse model of nebulin-based nemaline myopathy
- Genome-wide SNP analyses reveal population structure of Portunus pelagicus along Vietnam coastline
- Modulating transcription through development of semi-synthetic yeast core promoters
- Left-handed metamaterial bandpass filter for GPS, Earth Exploration-Satellite and WiMAX frequency sensing applications
- Cost-effectiveness analysis of PSA-based mass screening: Evidence from a randomised controlled trial combined with register data
- A good tennis player does not lose matches. The effects of valence congruency in processing stance-argument pairs
- Validation of the group tasks uncertainty model (MITAG) in a German sample
- Parent psychological wellbeing in a single-family room versus an open bay neonatal intensive care unit
- Optimizing the procedure of grain nutrient predictions in barley via hyperspectral imaging
- In-situ time resolved spectrographic measurement using an additively manufactured metallic micro-fluidic analysis platform
- Race disparity in blood sphingolipidomics associated with lupus cardiovascular comorbidity
- Characterization of the placental transcriptome through mid to late gestation in the mare
- Indirect violence exposure and mental health symptoms among an urban public-school population: Prevalence and correlates
- Diagnostic ability of multifocal electroretinogram in early multiple sclerosis using a new signal analysis method
- Predictors of never having a mammogram among Chinese, Vietnamese, and Korean immigrant women in the U.S.
- The impact of hepatic steatosis on portal hypertension
- How do and could clinical guidelines support patient-centred care for women: Content analysis of guidelines
- Study of the epidemiological behavior of malaria in the Darien Region, Panama. 2015–2017
- School-based obesity prevention for busy low-income families—Organisational and personal barriers and facilitators to implementation
- Neighborhood crime, disorder and substance use in the Caribbean context: Jamaica National Drug Use Prevalence Survey 2016
- Genomic comparison of diverse Salmonella serovars isolated from swine
- Significance of the lobe-specific emphysema index to predict prolonged air leak after anatomical segmentectomy
- Modeling of inter-organizational coordination dynamics in resilience planning of infrastructure systems: A multilayer network simulation framework
- Manipulating the odds: The effects of Machiavellianism and construal level on cheating behavior
- Early recognition of anorexia through patient-generated assessment predicts survival in patients with oesophagogastric cancer
- Identifying publications in questionable journals in the context of performance-based research funding
- ITGAM is a risk factor to systemic lupus erythematosus and possibly a protection factor to rheumatoid arthritis in patients from Mexico
- Nurses’ and patients’ experiences and preferences of the ankle-brachial pressure index and multi-site photoplethysmography for the diagnosis of peripheral arterial disease: A qualitative study
- Cluster tendency assessment in neuronal spike data
- Voluntary medical male circumcision for HIV prevention among adolescents in Kenya: Unintended consequences of pursuing service-delivery targets
- Primary care in five European countries: A citizens’ perspective on the quality of care for children
- High Order Profile Expansion to tackle the new user problem on recommender systems
- Psychometric properties of the Korean version of the Health Literacy on Social Determinants of Health Questionnaire (K-HL-SDHQ)
- Flood hazard mapping and assessment in data-scarce Nyaungdon area, Myanmar
- Methods for the identification of farm escapees in feral mink (Neovison vison) populations
- Transcriptional analysis of amino acid, metal ion, vitamin and carbohydrate uptake in butanol-producing Clostridium beijerinckii NRRL B-598
- Long-term vancomycin use had low risk of ototoxicity
- Overcoming platinum resistance in ovarian cancer by targeting pregnancy-associated plasma protein-A
- Exploration of muscle loss and metabolic state during prolonged critical illness: Implications for intervention?
- Pan-caspase inhibitor F573 mitigates liver ischemia reperfusion injury in a murine model
- Efficacy of interleukin 10 gene hydrofection in pig liver vascular isolated ‘in vivo’ by surgical procedure with interest in liver transplantation
- Molecular characteristics of segment 5, a unique fragment encoding two partially overlapping ORFs in the genome of rice black-streaked dwarf virus
- Early economic evaluation of MRI-guided laser interstitial thermal therapy (MRgLITT) and epilepsy surgery for mesial temporal lobe epilepsy
- GLADS: A gel-less approach for detection of STMS markers in wheat and rice
- Anterior tooth-use behaviors among early modern humans and Neandertals
- Incidence patterns of orofacial clefts in purebred dogs
- Capacity of the medullary cavity of tibia and femur for intra-bone marrow transplantation in mice
- Association of thoracic spine deformity and cardiovascular disease in a mouse model for Marfan syndrome
- Predicting atrial fibrillation in primary care using machine learning
- M3VR—A multi-stage, multi-resolution, and multi-volumes-of-interest volume registration method applied to 3D endovaginal ultrasound
- A developmental trajectory supporting the evaluation and achievement of competencies: Articulating the Mastery Rubric for the nurse practitioner (MR-NP) program curriculum
- Mobile medication manager application to improve adherence with immunosuppressive therapy in renal transplant recipients: A randomized controlled trial
- Default Mode Network structural alterations in Kocher-Monro trajectory white matter transection: A 3 and 7 tesla simulation modeling approach
- Phylogenetic revision of Gymnotidae (Teleostei: Gymnotiformes), with descriptions of six subgenera
- Population genetic analysis of 36 Y-chromosomal STRs yields comprehensive insights into the forensic features and phylogenetic relationship of Chinese Tai-Kadai-speaking Bouyei
- Prevention of suicidal behaviour: Results of a controlled community-based intervention study in four European countries
- An assessment of khat consumption habit and its linkage to household economies and work culture: The case of Harar city
- Fixation of genetic variation and optimization of gene expression: The speed of evolution in isolated lizard populations undergoing Reverse Island Syndrome
- One simple claudication question as first step in Peripheral Arterial Disease (PAD) screening: A meta-analysis of the association with reduced Ankle Brachial Index (ABI) in 27,945 subjects
- Direct cost of health care for individuals with community associated Clostridium difficile infections: A population-based cohort study
- Association between serum homocysteine level and cognitive function in middle-aged type 2 diabetes mellitus patients
- A qualitative research synthesis of contextual factors contributing to female overweight and obesity over the life course in sub-Saharan Africa
- Insight into the relationship between aryl-hydrocarbon receptor and β-catenin in human colon cancer cells
- Hidden noise in immunologic parameters might explain rapid progression in early-onset periodontitis
- The role of stigma in the acceptance and disclosure of HIV among recently diagnosed men who have sex with men in Australia: A qualitative study
- Detection of Schistosoma japonicum and Oncomelania hupensis quadrasi environmental DNA and its potential utility to schistosomiasis japonica surveillance in the Philippines
- Does age influence the quality of life in children with atopic dermatitis?
- Questioning the lasting effect of galvanic vestibular stimulation on postural control
- Identification of a novel monocytic phenotype in Classic Hodgkin Lymphoma tumor microenvironment
- Characterization of 20 complete plastomes from the tribe Laureae (Lauraceae) and distribution of small inversions
- Binding and dynamics of melatonin at the interface of phosphatidylcholine-cholesterol membranes
- Recent climate-driven ecological change across a continent as perceived through local ecological knowledge
- Nonalcoholic fatty liver disease is an early predictor of metabolic diseases in a metabolically healthy population
- Occurrence and multilocus genotyping of Giardia duodenalis from post-weaned dairy calves in Sichuan province, China
- Retinoic acid-stimulated ERK1/2 pathway regulates meiotic initiation in cultured fetal germ cells
- Gender disparities in scientific production: A nationwide assessment among physicians in Peru
- Effect of F1 and F2 generations on genetic variability and working steps of doubled haploid production in maize
- Mitochondrial dysfunction in rheumatoid arthritis: A comprehensive analysis by integrating gene expression, protein-protein interactions and gene ontology data
- A caspase-6-cleaved fragment of Glial Fibrillary Acidic Protein as a potential serological biomarker of CNS injury after cardiac arrest
- A handy method to remove bacterial contamination from fungal cultures
- The self-care profiles and its determinants among adults with hypertension in primary health care clinics in Selangor, Malaysia
- The mutational landscape of quinolone resistance in Escherichia coli
- Exploring the influence of self-perceptions on the relationship between motor competence and identity in adolescents
- Study on the damage characteristics of gas-bearing shale under different unloading stress paths
- EPILAT-IRA Study: A contribution to the understanding of the epidemiology of acute kidney injury in Latin America
- 16S rDNA droplet digital PCR for monitoring bacterial DNAemia in bloodstream infections
- Three-dimensional (3D) brain microphysiological system for organophosphates and neurochemical agent toxicity screening
- Diversity of endocervical microbiota associated with genital Chlamydia trachomatis infection and infertility among women visiting obstetrics and gynecology clinics in Malaysia
- Health impact of hepatic-venous-occlusive disease in a small town in Ethiopia—Case study from Tahtay koraro district in Tigray region, 2017
- Development of a novel automatable fabrication method based on electrospinning co electrospraying for rotator cuff augmentation patches
- Development of a quantitative PCR assay for the detection and enumeration of a potentially ciguatoxin-producing dinoflagellate, Gambierdiscus lapillus (Gonyaulacales, Dinophyceae)
- Association of clinical factors with survival outcomes in laryngeal squamous cell carcinoma (LSCC)
- Seasonal oyster harvesting recorded in a Late Archaic period shell ring
- Population preferences for breast cancer screening policies: Discrete choice experiment in Belarus
- Respiratory health and inflammatory markers - Exposure to respirable dust and quartz and chemical binders in Swedish iron foundries
- Trends and predictors of mother-to-child transmission of HIV in an era of protocol changes: Findings from two large health facilities in North East Nigeria
- Elevated Ki-67 (MIB-1) expression as an independent predictor for unfavorable pathologic outcomes and biochemical recurrence after radical prostatectomy in patients with localized prostate cancer: A propensity score matched study
- Genome-wide identification and gene expression analysis of SOS family genes in tuber mustard (Brassica juncea var. tumida)
- Carvedilol improves glucose tolerance and insulin sensitivity in treatment of adrenergic overdrive in high fat diet-induced obesity in mice
- Institutional differences in USMLE Step 1 and 2 CK performance: Cross-sectional study of 89 US allopathic medical schools
- Molecular epidemiological characteristics of dengue virus carried by 34 patients in Guangzhou in 2018
- Heteroplasmy in the complete chicken mitochondrial genome
- Candida blood stream infections observed between 2011 and 2016 in a large Italian University Hospital: A time-based retrospective analysis on epidemiology, biofilm production, antifungal agents consumption and drug-susceptibility
- Sixty years since the creation of Lake Kariba: Thermal and oxygen dynamics in the riverine and lacustrine sub-basins
- Association of uric acid in serum and urine with subclinical renal damage: Hanzhong Adolescent Hypertension Study
- Appropriate management of acute gastroenteritis in Australian children: A population-based study
- The plasma metabolome of women in early pregnancy differs from that of non-pregnant women
- Effectiveness of four types of neuraminidase inhibitors approved in Japan for the treatment of influenza
- More than just availability: Who has access and who administers take-home naloxone in Baltimore, MD
- Evaluating the cross-cultural validity of the Dutch version of the Social Exclusion Index for Health Surveys (SEI-HS): A mixed methods study
- Diminuendo al bottom—Clarifying the semantics of music notation by re-modeling
- Structural analysis of the manganese transport regulator MntR from Bacillus halodurans in apo and manganese bound forms
- Serum uromodulin is associated with the severity of clinicopathological findings in ANCA-associated glomerulonephritis
- Male support for cervical cancer screening and treatment in rural Ghana
- ADAPTS: Automated deconvolution augmentation of profiles for tissue specific cells
- Comparison of shape quantification methods for genomic prediction, and genome-wide association study of sorghum seed morphology
- An attempt to identify the issues underlying the lack of consistent conceptualisations in the field of student mathematics-related beliefs
- Video abstracts and plain language summaries are more effective than graphical abstracts and published abstracts
- Trophic structure of the macrofauna associated to deep-vents of the southern Gulf of California: Pescadero Basin and Pescadero Transform Fault
- Incomplete insertion of pedicle screws in a standard construct reduces the fatigue life: A biomechanical analysis
- Cost savings associated with timely treatment of botulism with botulism antitoxin heptavalent product
- Effects of light and nitrogen availability on photosynthetic efficiency and fatty acid content of three original benthic diatom strains
- Early signal detection of adverse events following influenza vaccination using proportional reporting ratio, Victoria, Australia
- Bioinformatic analysis of a novel Echinococcus granulosus nuclear receptor with two DNA binding domains
- Genome-wide identification and characterization, phylogenetic comparison and expression profiles of SPL transcription factor family in B. juncea (Cruciferae)
- Hypoxia inhibits TNF-α-induced TSLP expression in keratinocytes
- Conceptualising alcohol consumption in relation to long-term health conditions: Exploring risk in interviewee accounts of drinking and taking medications
- Elevated interleukin-25 and its association to Th2 cytokines in systemic lupus erythematosus with lupus nephritis
- Thrombocytopenia and thrombocytosis are associated with different outcome in atrial fibrillation patients on anticoagulant therapy
- Involvement of extracellular vesicles in the macrophage-tumor cell communication in head and neck squamous cell carcinoma
- Comparison of Humphrey Field Analyzer and imo visual field test results in patients with glaucoma and pseudo-fixation loss
- Out-of-pocket expenditure and catastrophic health expenditure for hospitalization due to injuries in public sector hospitals in North India
- Concurrent validity and discriminative ability of Dutch performance-based motor tests in 5 to 6 years old children
- Cumulative viral load as a predictor of CD4+ T-cell response to antiretroviral therapy using Bayesian statistical models
- Can General Practitioners manage mental disorders in primary care? A partially randomised, pragmatic, cluster trial
- Self-serving incentives impair collective decisions by increasing conformity
- Mutation and immune profiling of metaplastic breast cancer: Correlation with survival
- The clinicopathological significance of Thrombospondin-4 expression in the tumor microenvironment of gastric cancer
- Propofol-based total intravenous anesthesia did not improve survival compared to desflurane anesthesia in breast cancer surgery
- Association between ossification of the posterior longitudinal ligament and ossification of the nuchal ligament in the cervical spine
- Effects of Debaryomyces hansenii treatment on intestinal mucosa microecology in mice with antibiotic-associated diarrhea
- Molecular validation of clinical Pantoea isolates identified by MALDI-TOF
- A novel wheat lodging resistance evaluation method and device based on the thrust force of the stalks
- Evolution of high tooth replacement rates in theropod dinosaurs
- Outpatient facility-based order variation in combined imaging
- Ethnic-racial identity affirmation: Validation in Aboriginal Australian children
- Non-intubated anesthesia in patients undergoing video-assisted thoracoscopic surgery: A systematic review and meta-analysis
- Tissue-type plasminogen activator selectively inhibits multiple toll-like receptors in CSF-1-differentiated macrophages
- Changes of serum pentraxin-3 and hypersensitive CRP levels during pregnancy and their relationship with gestational diabetes mellitus
- Synergistic immuno-modulatory activity in human macrophages of a medicinal mushroom formulation consisting of Reishi, Shiitake and Maitake
- Investigating reindeer pastoralism and exploitation of high mountain zones in northern Mongolia through ice patch archaeology
- Diversity pattern of Plasmodium knowlesi merozoite surface protein 4 (MSP4) in natural population of Malaysia
- Protein synthesis rates of muscle, tendon, ligament, cartilage, and bone tissue in vivo in humans
- “What gets measured better gets done better”: The landscape of validation of global maternal and newborn health indicators through key informant interviews
- Contactless monitoring of heart and respiratory rate in anesthetized pigs using infrared thermography
- Molecular characterisation of genital human papillomavirus among women in Southwestern, Nigeria
- The impact of “male clinics” on health-seeking behaviors of adult men in rural Kenya
- Gene expression microarray public dataset reanalysis in chronic obstructive pulmonary disease
- Utility of the new cobas HCV test for viral load monitoring during direct-acting antiviral therapy
- Impact of negative tuberculin skin test on growth among disadvantaged Bangladeshi children
- Streptococcal phosphotransferase system imports unsaturated hyaluronan disaccharide derived from host extracellular matrices
- Maternal diet modulates placental nutrient transporter gene expression in a mouse model of diabetic pregnancy
- Effects of an incremental theory of personality intervention on the reciprocity between bullying and cyberbullying victimization and perpetration in adolescents
- The clot thickens: Autologous and allogeneic fibrin sealants are mechanically equivalent in an ex vivo model of cartilage repair
- Reproducibility, stability, and accuracy of microbial profiles by fecal sample collection method in three distinct populations
- Cooperation with autonomous machines through culture and emotion
- Variation in hybridogenetic hybrid emergence between populations of water frogs from the Pelophylax esculentus complex
- Breast cancer in Tanzanian, black American, and white American women: An assessment of prognostic and predictive features, including tumor infiltrating lymphocytes
- Intramolecular tautomerization of the quercetin molecule due to the proton transfer: QM computational study
- A global overview of cassava genetic diversity
- Whole body periodic acceleration in normal and reduced mucociliary clearance of conscious sheep
- Identifying resurrection genes through the differentially expressed genes between Selaginella tamariscina (Beauv.) spring and Selaginella moellendorffii Hieron under drought stress
- Impact of hemodialysis on the concentrations of sodium and potassium during infusion of sodium thiosulfate using an In Vitro hemodialysis model
- Minimal effects of oyster aquaculture on local water quality: Examples from southern Chesapeake Bay
- Suboptimal infant and young child feeding practices in rural Boucle du Mouhoun, Burkina Faso: Findings from a cross-sectional population-based survey
- High salinity tolerance of invasive blue catfish suggests potential for further range expansion in the Chesapeake Bay region
- From waste to food: Optimising the breakdown of oil palm waste to provide substrate for insects farmed as animal feed
- Quantitative assessment of interstitial lung disease in Sjögren’s syndrome
- Comparative efficacy of tenofovir and entecavir in nucleos(t)ide analogue-naive chronic hepatitis B: A systematic review and meta-analysis
- Reference ranges for ultrasonographic renal dimensions as functions of age and body indices: A retrospective observational study in Taiwan
- Finding phrases: On the role of co-verbal facial information in learning word order in infancy
- Mathematical modeling reveals the factors involved in the phenomena of cancer stem cells stabilization
- Effects of forest management and roe deer impact on a mountain forest development in the Italian Apennines: A modelling approach using LANDIS-II
- Evaluation of comprehensive improvement for mild and moderate soil salinization in arid zone
- Efficacy, acceptability and feasibility of daily text-messaging in promoting glycaemic control and other clinical outcomes in a low-resource setting of South Africa: A randomised controlled trial
- Magnitude and associated factors of postpartum depression among women in Nekemte town, East Wollega zone, west Ethiopia, 2019: A community-based study
- Comparison of continuous wave and cold lateral condensation filling techniques in 3D printed simulated C-shape canals instrumented with Reciproc Blue or Hyflex EDM
- Effect of caffeine on neuromuscular function following eccentric-based exercise
- AtUBL5 regulates growth and development through pre-mRNA splicing in Arabidopsis thaliana
- The gut microbiome of freshwater Unionidae mussels is determined by host species and is selectively retained from filtered seston
- Alcohol consumption and survival after breast cancer diagnosis in Japanese women: A prospective patient cohort study
- Selection of reference genes for normalization of cranberry (Vaccinium macrocarpon Ait.) gene expression under different experimental conditions
- The household economic costs associated with depression symptoms: A cross-sectional household study conducted in the North West province of South Africa
- Increased cell size, structural complexity and migration of cancer cells acquiring fibroblast organelles by cell-projection pumping
- Acute low- compared to high-load resistance training to failure results in greater energy expenditure during exercise in healthy young men
- Impact of body mass index and metabolically unhealthy status on mortality in the Japanese general population: The JMS cohort study
- Characterization of two thermophilic cellulases from Talaromyces leycettanus JCM12802 and their synergistic action on cellulose hydrolysis
- Ecohydrology of urban trees under passive and active irrigation in a semiarid city
- Cyclosporine A eyedrops with self-nanoemulsifying drug delivery systems have improved physicochemical properties and efficacy against dry eye disease in a murine dry eye model
- LFastqC: A lossless non-reference-based FASTQ compressor
- Highly accurate prediction of flammability limits of chemical compounds using novel integrated hybrid models
- Nonsteroidal anti-inflammatory drugs and acetaminophen ameliorate muscular mechanical hyperalgesia developed after lengthening contractions via cyclooxygenase-2 independent mechanisms in rats
- A popular Indian clove-based mosquito repellent is less effective against Culex quinquefasciatus and Aedes aegypti than DEET
- Yeasts affect tolerance of Drosophila melanogaster to food substrate with high NaCl concentration
- The effect of climate change on cholera disease: The road ahead using artificial neural network
- Grit (effortful persistence) can be measured with a short scale, shows little variation across socio-demographic subgroups, and is associated with career success and career engagement
- Micro-dislodgement during transcatheter aortic valve implantation with a contemporary self-expandable prosthesis
- Improving the antimicrobial efficacy against resistant Staphylococcus aureus by a combined use of conjugated oligoelectrolytes
- Kin discrimination and outer membrane exchange in Myxococcus xanthus: Experimental analysis of a natural population
- Inflammatory cell infiltrates, hypoxia, vascularization, pentraxin 3 and osteoprotegerin in abdominal aortic aneurysms – A quantitative histological study
- Effects of virtual reality rehabilitation training on gait and balance in patients with Parkinson's disease: A systematic review
- Serum miR-33a is associated with steatosis and inflammation in patients with non-alcoholic fatty liver disease after liver transplantation
- Association between housing tenure and self-rated health in Japan: Findings from a nationwide cross-sectional survey
- Investigation of biochemical and physiological parameters of the newborn Saiga antelope (Saiga tatarica) in Gansu Province, China
- One-year follow-up of changes in refraction and aberrations induced by corneal incision
- Evaluation of upper limb superficial venous percussion as a sign of anatomical location and venous permeability. A comparative study of superficial venous percussion to ultrasound findings on non-renal patients and on chronic kidney disease patients
- An assessment of the Dutch experience with health insurers acting as healthcare advisors
- Perception of potential harm and benefits of HIV vaccine trial participation: A qualitative study from urban Tanzania
- Veterans with Gulf War Illness exhibit distinct respiratory patterns during maximal cardiopulmonary exercise
- Deep brain stimulation restores the glutamatergic and GABAergic synaptic transmission and plasticity to normal levels in kindled rats
- Metformin strongly affects transcriptome of peripheral blood cells in healthy individuals
- Cranberry extracts promote growth of Bacteroidaceae and decrease abundance of Enterobacteriaceae in a human gut simulator model
- Long-term retention on antiretroviral therapy among infants, children, adolescents and adults in Malawi: A cohort study
- Histochemical quantification of collagen content in articular cartilage
- Optogenetically transduced human ES cell-derived neural progenitors and their neuronal progenies: Phenotypic characterization and responses to optical stimulation
- Ion torrent high throughput mitochondrial genome sequencing (HTMGS)
- Outpatient antibiotic prescription rate and pattern in the private sector in India: Evidence from medical audit data
- Acute Influenza A virus outbreak in an enzootic infected sow herd: Impact on viral dynamics, genetic and antigenic variability and effect of maternally derived antibodies and vaccination
- Prevalence and correlates of low serum calcium in late pregnancy: A cross sectional study in the Nkongsamba Regional Hospital; Littoral Region of Cameroon
- Home-cage monitoring ascertains signatures of ictal and interictal behavior in mouse models of generalized seizures
- CRISPR/Cas9 gene editing in the West Nile Virus vector, Culex quinquefasciatus Say
- Genetic susceptibility to angiotensin-converting enzyme-inhibitor induced angioedema: A systematic review and evaluation of methodological approaches
- Proton pump inhibitor use increases the risk of peritonitis in peritoneal dialysis patients
- Comparative distribution of extended-spectrum beta-lactamase–producing Escherichia coli from urine infections and environmental waters
- Sex differences in thigh muscle volumes, sprint performance and mechanical properties in national-level sprinters
- Maternal serum and cord blood leptin concentrations at delivery
- Winter nitrification in ice-covered lakes
- Intolerance of uncertainty fuels depressive symptoms through rumination: Cross-sectional and longitudinal studies
- Monitoring exercise-induced muscle damage indicators and myoelectric activity during two weeks of knee extensor exercise training in young and old men
- Can adoption of pollution prevention techniques reduce pollution substitution?
- The association between self-efficacy and self-management behaviors among Chinese patients with type 2 diabetes
- Poly-arginine-18 peptides do not exacerbate bleeding, or improve functional outcomes following collagenase-induced intracerebral hemorrhage in the rat
- Affective disorders in the elderly in different European countries: Results from the MentDis_ICF65+ study
- Evaluation of forearm vascular resistance during orthostatic stress: Velocity is proportional to flow and size doesn’t matter
- Proton pencil minibeam irradiation of an in-vivo mouse ear model spares healthy tissue dependent on beam size
- Maternal stress in Shank3ex4-9 mice increases pup-directed care and alters brain white matter in male offspring
- Aspartate aminotransferase-to-platelet ratio index (APRI): A potential marker for diagnosis in patients at risk of severe malaria caused by Plasmodium vivax
- Exploiting open source 3D printer architecture for laboratory robotics to automate high-throughput time-lapse imaging for analytical microbiology
- Long non-coding RNAs and latent HIV – A search for novel targets for latency reversal
- Clinical characteristics of neonatal fulminant necrotizing enterocolitis in a tertiary Children's hospital in the last 10 years
- Effects of neuromuscular electrical stimulation training on muscle size in collegiate track and field athletes
- Adaptive fuzzy flow rate control considering multifractal traffic modeling and 5G communications
- Evaluation of four commercial tests for detecting ceftiofur in waste milk bulk tank samples
- A smart tele-cytology point-of-care platform for oral cancer screening
- Vasopressin SNP pain factors and stress in sickle cell disease
- Carbonate production of Micronesian reefs suppressed by thermal anomalies and Acanthaster as sea-level rises
- Microbial metabolisms in an abyssal ferromanganese crust from the Takuyo-Daigo Seamount as revealed by metagenomics
- Incidence of chronic kidney disease hospitalisations and mortality in Espírito Santo between 1996 to 2017
- The impact of short-term machine perfusion on the risk of cancer recurrence after rat liver transplantation with donors after circulatory death
- Proteomic profiling of the thrombin-activated canine platelet secretome (CAPS)
- Blood metal levels and serum testosterone concentrations in male and female children and adolescents: NHANES 2011–2012
- The effects of prolonged single night session of videogaming on sleep and declarative memory
- Diversity, distribution and dynamics of large trees across an old-growth lowland tropical rain forest landscape
- Mapping developmental QTL for plant height in soybean [Glycine max (L.) Merr.] using a four-way recombinant inbred line population
- Vaginal ring acceptability and related preferences among women in low- and middle-income countries: A systematic review and narrative synthesis
- UM171 induces a homeostatic inflammatory-detoxification response supporting human HSC self-renewal
- Positive selection and precipitation effects on the mitochondrial NADH dehydrogenase subunit 6 gene in brown hares (Lepus europaeus) under a phylogeographic perspective
- Evaluation of Minimum Inhibitory Concentrations for 154 Mycoplasma synoviae isolates from Italy collected during 2012-2017
- Enhancement of antibiotics antimicrobial activity due to the silver nanoparticles impact on the cell membrane
- Correction: Smoking, alcohol use disorder and tuberculosis treatment outcomes: A dual co-morbidity burden that cannot be ignored
- Correction: Effect of corruption on perceived difficulties in healthcare access in sub-Saharan Africa
- Knowledge-based best of breed approach for automated detection of clinical events based on German free text digital hospital discharge letters
- Importance of thorough tissue and cellular level characterization of targeted drugs in the evaluation of pharmacodynamic effects
- Integrated value-chain and risk assessment of Pig-Related Zoonoses in Ghana
- Failed sperm retrieval from severely oligospermic or non-obstructive azoospermic patients on oocyte retrieval day: Emergent oocyte cryopreservation is a feasible strategy
- Cassava yield traits predicted by genomic selection methods
- Verification of hub genes in the expression profile of aortic dissection
- Pig farmers’ willingness to pay for management strategies to reduce aggression between pigs
- Metabolomic response of Euglena gracilis and its bleached mutant strain to light
- Diagnostic value of ASVS for insulinoma localization: A systematic review and meta-analysis
- Newly educated care managers’ experiences of providing care for persons with stress-related mental disorders in the clinical primary care context
- Real-time telemetry monitoring of oxygen in the central complex of freely-walking Gromphadorhina portentosa
- Qualification programmes for immigrant health professionals: A systematic review
- An analytical model to minimize the latency in healthcare internet-of-things in fog computing environment
- Grain filling of early-season rice cultivars grown under mechanical transplanting
- Intercalation of small molecules into DNA in chromatin is primarily controlled by superhelical constraint
- Correlative evidence for co-regulation of phosphorus and carbon exchanges with symbiotic fungus in the arbuscular mycorrhizal Medicago truncatula
- How to design a dose-finding study on combined agents: Choice of design and development of R functions
- Altered expression of Notch1 in Alzheimer's disease
- The ZJU index is a powerful surrogate marker for NAFLD in severely obese North American women
- Trunk velocity-dependent Light Touch reduces postural sway during standing
- Evaluation of cytological diagnostic accuracy for canine splenic neoplasms: An investigation in 78 cases using STARD guidelines
- Trade-offs in motivating volunteer effort: Experimental evidence on voluntary contributions to science
- Does caching strategy vary with microclimate in endangered Mt. Graham red squirrels?
- Assessment of energy expenditure during high intensity cycling and running using a heart rate and activity monitor in young active adults
- Evaluating rectal swab collection method for gut microbiome analysis in the common marmoset (Callithrix jacchus)
- Implementation of a screening, brief intervention and referral to treatment programme for risky substance use in South African emergency centres: A mixed methods evaluation study
- Can the CalproQuest predict a positive Calprotectin test? A prospective diagnostic study
- The calcium sensor OsCBL1 modulates nitrate signaling to regulate seedling growth in rice
- Acceptability of and treatment preferences for recurrent bacterial vaginosis—Topical lactic acid gel or oral metronidazole antibiotic: Qualitative findings from the VITA trial
- Mathematical determination of the HIV-1 matrix shell structure and its impact on the biology of HIV-1
- Contingent negative variation during a modified cueing task in simulated driving
- CAMDI interacts with the human memory-associated protein KIBRA and regulates AMPAR cell surface expression and cognition
- Effect of feeding patterns on growth and nutritional status of children aged 0-24 months: A Chinese cohort study
- A fecal sequel: Testing the limits of a genetic assay for bat species identification
- Measuring the impact of chronic conditions and associated multimorbidity on health-related quality of life in the general population in Hong Kong SAR, China: A cross-sectional study
- Short and long-term clinical effectiveness and cost-effectiveness of a late-phase community-based balance and gait exercise program following hip fracture. The EVA-Hip Randomised Controlled Trial
- Vaccine cold chain in general practices: A prospective study in 75 refrigerators (Keep Cool study)
- Brazilian norms for the Bank of Standardized Stimuli (BOSS)
- Distinct varieties of aesthetic chills in response to multimedia
- Interaction between apolipoprotein E genotype and hypertension on cognitive function in older women in the Nurses’ Health Study
- Correction: Resistance profile of the HIV-1 maturation inhibitor GSK3532795 in vitro and in a clinical study
- New formulation of the Gompertz equation to describe the kinetics of untreated tumors
- Development of visual perception of others’ actions: Children’s judgment of lifted weight
- Retrospective comparative analysis of intraocular lens calculation formulas after hyperopic refractive surgery
- Human vitreous concentrations of citicoline following topical application of citicoline 2% ophthalmic solution
- Development and validation of exhaled breath condensate microRNAs to identify and endotype asthma in children
- Arthroscopic release for frozen shoulder: Does the timing of intervention and diabetes affect outcome?
- Risk factors affecting dairy cattle protective grouping behavior, commonly known as bunching, against Stomoxys calcitrans (L.) on California dairies
- Acceleration of chemical shift encoding-based water fat MRI for liver proton density fat fraction and T2* mapping using compressed sensing
- Characterisation and microbial community analysis of lipid utilising microorganisms for biogas formation
- Sexuality in male partners of women with fibromyalgia syndrome: A qualitative study
- Exploring optimization strategies for improving explicit water models: Rigid n-point model and polarizable model based on Drude oscillator
- Artificial insemination with fresh, liquid stored and frozen thawed semen in dromedary camels
- Moving into an urban drug scene among people who use drugs in Vancouver, Canada: Latent class growth analysis
- Numerical study on the start and unstart phenomena in a scramjet inlet-isolator model
- Effects of dietary supplementation with apple peel powder on the growth, blood and liver parameters, and transcriptome of genetically improved farmed tilapia (GIFT, Oreochromis niloticus)
- Urban growth simulation in different scenarios using the SLEUTH model: A case study of Hefei, East China
- Chronic bronchitis without airflow obstruction, asthma and rhinitis are differently associated with cardiovascular risk factors and diseases
- Factors associated with medication adherence among people with diabetes mellitus in poor urban areas of Cambodia: A cross-sectional study
- Mammary microbiome of lactating organic dairy cows varies by time, tissue site, and infection status
- Force field generalization and the internal representation of motor learning
- Polyphenism of visual and chemical secondary sexually-selected wing traits in the butterfly Bicyclus anynana: How different is the intermediate phenotype?
- Minimal genetic differentiation of the malaria vector Nyssorhynchus darlingi associated with forest cover level in Amazonian Brazil
- The impact of leisure activities on older adults’ cognitive function, physical function, and mental health
- scafSLICR: A MATLAB-based slicing algorithm to enable 3D-printing of tissue engineering scaffolds with heterogeneous porous microarchitecture
- Association of serum leptin and adiponectin concentrations with echocardiographic parameters and pathophysiological states in patients with cardiovascular disease receiving cardiovascular surgery
- Operation of cognitive memory inhibition in adults with Down syndrome: Effects of maintenance load and material
- Influences on surgical antimicrobial prophylaxis decision making by surgical craft groups, anaesthetists, pharmacists and nurses in public and private hospitals
- Post-treatment Lyme disease symptoms score: Developing a new tool for research
- Expression of Concern: The Role of the RACK1 Ortholog Cpc2p in Modulating Pheromone-Induced Cell Cycle Arrest in Fission Yeast
- Equine bronchial fibroblasts enhance proliferation and differentiation of primary equine bronchial epithelial cells co-cultured under air-liquid interface
- Investigating cooperation with robotic peers
- Synthesis, purification and crystallization of a putative critical bulge of HAR1 RNA
- Prosthetic push-off power in trans-tibial amputee level ground walking: A systematic review
- A case study of the use of verbal reports for talent identification purposes in soccer: A Messi affair!
- Transgenerational deep sequencing revealed hypermethylation of hippocampal mGluR1 gene with altered mRNA expression of mGluR5 and mGluR3 associated with behavioral changes in Sprague Dawley rats with history of prolonged febrile seizure
- Obesity is associated with an impaired survival in lymphoma patients undergoing autologous stem cell transplantation
- Periodontal disease: Repercussions in pregnant woman and newborn health—A cohort study
- Origins of Chinese reindeer (Rangifer tarandus) based on mitochondrial DNA analyses
- Regional, racial, gender, and tumor biology disparities in breast cancer survival rates in Africa: A systematic review and meta-analysis
- How effective are films in inducing positive and negative emotional states? A meta-analysis
- 3D nanostructural characterisation of grain boundaries in atom probe data utilising machine learning methods
- An outbreak of tuberculosis in a middle school in Henan, China: Epidemiology and risk factors
- Initial clinical radiological findings and staging to predict prognosis of primary hepatic angiosarcoma: A retrospective analysis
- A new early Eocene deperetellid tapiroid illuminates the origin of Deperetellidae and the pattern of premolar molarization in Perissodactyla
- Longevity and marginal bone loss of narrow-diameter implants supporting single crowns: A systematic review
- Impact of UVC-sustained recirculating air filtration on airborne bacteria and dust in a pig facility
- Cold-related Florida manatee mortality in relation to air and water temperatures
- Conceptual fluency in inductive reasoning
- Clinical outcomes and treatment patterns among Medicare patients with nonvalvular atrial fibrillation (NVAF) and chronic kidney disease
- Improvements in the learnability of smartphone haptic interfaces for visually impaired users
- Role of the malic enzyme in metabolism of the halotolerant methanotroph Methylotuvimicrobium alcaliphilum 20Z
- Cyclic loading test study on a new cast-in-situ insulated sandwich concrete wall
- Natural compounds as angiogenic enzyme thymidine phosphorylase inhibitors: In vitro biochemical inhibition, mechanistic, and in silico modeling studies
- Analysis of virulence potential of Escherichia coli O145 isolated from cattle feces and hide samples based on whole genome sequencing
- Pre-clinical medical student reflections on implicit bias: Implications for learning and teaching
- Prognostic significance of non-sustained ventricular tachycardia on stored electrograms in pacemaker recipients
- Determinants of preterm birth among mothers who gave birth at public hospitals in the Amhara region, Ethiopia: A case-control study
- Real-world evidence of the effectiveness of ombitasvir-paritaprevir/r ± dasabuvir ± ribavirin in patients monoinfected with chronic hepatitis C or coinfected with human immunodeficiency virus-1 in Spain
- Unique transcriptomic landscapes identified in idiopathic spontaneous and infection related preterm births compared to normal term births
- Restrained expansion of the recall germinal center response as biomarker of protection for influenza vaccination in mice
- Arabidopsis TRM5 encodes a nuclear-localised bifunctional tRNA guanine and inosine-N1-methyltransferase that is important for growth
- Achievement of weight loss in patients with overweight during dietetic treatment in primary health care
- Autophagy deficiency exacerbates colitis through excessive oxidative stress and MAPK signaling pathway activation
- The impacts of parity on lung function data (LFD) of healthy females aged 40 years and more issued from an upper middle income country (Algeria): A comparative study
- Reorganization of spatial configurations in visual working memory: A matter of set size?
- Unravelling travellers’ route choice behaviour at full-scale urban network by focusing on representative OD pairs in computer experiments
- Evaluating the higher-order structure of the Profile of Emotional Competence (PEC): Confirmatory factor analysis and Bayesian structural equation modeling
- HIV prevalence and correlated factors among male clients of female sex workers in a border region of China
- Next generation sequencing and RNA-seq characterization of adipose tissue in the Nile crocodile (Crocodylus niloticus) in South Africa: Possible mechanism(s) of pathogenesis and pathophysiology of pansteatitis
- Association between advanced maternal age and maternal and neonatal morbidity: A cross-sectional study on a Spanish population
- Ethnic differences in the prevalence, socioeconomic and health related risk factors of knee pain and osteoarthritis symptoms in older Malaysians
- Increasing knowledge of HIV status in a country with high HIV testing coverage: Results from the Botswana Combination Prevention Project
- Friends with benefits: The effects of vegetative shading on plant survival in a green roof environment
- Comparison of the fecal, cecal, and mucus microbiome in male and female mice after TNBS-induced colitis
- Identifying candidate diagnostic markers for early stage of non-small cell lung cancer
- Complex alternative splicing of human Endonuclease V mRNA, but evidence for only a single protein isoform
- Correction: KML001 Induces Apoptosis and Autophagic Cell Death in Prostate Cancer Cells via Oxidative Stress Pathway
- Unique developmental trajectories of risk behaviors in adolescence and associated outcomes in young adulthood
- Enhanced fibrinolysis detection in a natural occurring canine model with intracavitary effusions: Comparison and degree of agreement between thromboelastometry and FDPs, D-dimer and fibrinogen concentrations
- Overexpression of Saussurea involucrata dehydrin gene SiDHN promotes cold and drought tolerance in transgenic tomato plants
- Foxtail millet (Setaria italica (L.) P. Beauv) CIPKs are responsive to ABA and abiotic stresses
- Autonomous drone hunter operating by deep learning and all-onboard computations in GPS-denied environments
- Heterogeneity Diffusion Imaging of gliomas: Initial experience and validation
- Frequency cluster formation and slow oscillations in neural populations with plasticity
- DHP23002 as a next generation oral paclitaxel formulation for pancreatic cancer therapy
- Diagnostic accuracy of SOX11 immunohistochemistry in mantle cell lymphoma: A meta-analysis
- Analytical solution to swing equations in power grids
- Pathways to conspiracy: The social and linguistic precursors of involvement in Reddit’s conspiracy theory forum
- Spatiotemporally random and diverse grid cell spike patterns contribute to the transformation of grid cell to place cell in a neural network model
- Empathic concern and personal distress depend on situational but not dispositional factors
- Who is more susceptible to job stressors and resources? Sensory-processing sensitivity as a personal resource and vulnerability factor
- Cost-effectiveness of integrating postpartum antiretroviral therapy and infant care into maternal & child health services in South Africa
- A substitution mutation in a conserved domain of mammalian acetate-dependent acetyl CoA synthetase 2 results in destabilized protein and impaired HIF-2 signaling
- One step at a time: Physical activity is linked to positive interpretations of ambiguity
- Calreticulin regulates vascular endothelial growth factor-A mRNA stability in gastric cancer cells
- Evaluation of various methods of selection of B. subtilis strains capable of secreting surface-active compounds
- Association between US Pharmacopeia (USP) monograph standards, generic entry and prescription drug costs
- Molecular characterisation of the synovial fluid microbiome in rheumatoid arthritis patients and healthy control subjects
- On sorption hysteresis in wood: Separating hysteresis in cell wall water and capillary water in the full moisture range
- Inbreeding, Allee effects and stochasticity might be sufficient to account for Neanderthal extinction
- Reliability and construct validity of the stepping-forward affordance perception test for fall risk assessment in community-dwelling older adults
- Socioeconomic determinants of nutritional status among ‘Baiga’ tribal children In Balaghat district of Madhya Pradesh: A qualitative study
- Study on characteristics of fire plume in building facade window under lateral blow
- ‘When you talk to someone in a bad way or always put her under pressure, it is actually worse than beating her’: Conceptions and experiences of emotional intimate partner violence in Rwanda and South Africa
- Effects of 6-mercaptopurine in pressure overload induced right heart failure
- The association between haemoglobin levels in the first 20 weeks of pregnancy and pregnancy outcomes
- Implementation and evaluation of an antimicrobial stewardship programme in companion animal clinics: A stepped-wedge design intervention study
- Factors associated with persistently high-cost health care utilization for musculoskeletal pain
- Nitrogen and chlorophyll status determination in durum wheat as influenced by fertilization and soil management: Preliminary results
- Effect of repeated in vivo microCT imaging on the properties of the mouse tibia
- Coupling environment and physiology to predict effects of climate change on the taxonomic and functional diversity of fish assemblages in the Murray-Darling Basin, Australia
- Hematology and plasma biochemistries in the Blanding’s turtle (Emydoidea blandingii) in Lake County, Illinois
- CRISPR-Cas influences the acquisition of antibiotic resistance in Klebsiella pneumoniae
- Phosphorylation-dependent activity-based conformational changes in P21-activated kinase family members and screening of novel ATP competitive inhibitors
- Antidepressant prescriptions, discontinuation, depression and perinatal outcomes, including breastfeeding: A population cohort analysis
- Why men with a low-risk prostate cancer select and stay on active surveillance: A qualitative study
- Imported severe malaria and risk factors for intensive care: A single-centre retrospective analysis
- Combined treatment (image-guided thrombectomy and endovascular therapy with open femoral access) for acute lower limb ischemia: Clinical efficacy and outcomes
- Low-latency single channel real-time neural spike sorting system based on template matching
- Quantifying the scale effect in geospatial big data using semi-variograms
- Paper-and-pencil versus computerized administration mode: Comparison of data quality and risk behavior prevalence estimates in the European school Survey Project on Alcohol and other Drugs (ESPAD)
- Regression adjusted colocalisation colour mapping (RACC): A novel biological visual analysis method for qualitative colocalisation analysis of 3D fluorescence micrographs
- Ostrich eggshell bead diameter in the Holocene: Regional variation with the spread of herding in eastern and southern Africa
- Spatial and temporal variations in female size at maturity of a Southern Rock Lobster (Jasus edwardsii) population: A likely response to climate change
- Inactive USP14 and inactive UCHL5 cause accumulation of distinct ubiquitinated proteins in mammalian cells
- Training rhesus macaques to take daily oral antiretroviral therapy for preclinical evaluation of HIV prevention and treatment strategies
- Left ventricular structural and functional changes in Friedreich ataxia – Relationship with body size, sex, age and genetic severity
- Magnitude and factors associated with anemia among pregnant women attending antenatal care in Bench Maji, Keffa and Sheka zones of public hospitals, Southwest, Ethiopia, 2018: A cross -sectional study
- Effectiveness of telerehabilitation in the management of adults with stroke: A systematic review
- Hydrogen sulphide-induced hypometabolism in human-sized porcine kidneys
- Correction: Comparison of the molecular properties of retinitis pigmentosa P23H and N15S amino acid replacements in rhodopsin
- Retraction: Regulation of gastric smooth muscle contraction via Ca2+-dependent and Ca2+-independent actin polymerization
- Evaluation of neutral oral contrast agents for assessment of the small bowel at abdominal staging CT
- Blood type and breed-associated differences in cell marker expression on equine bone marrow-derived mesenchymal stem cells including major histocompatibility complex class II antigen expression
- Induced abortion and future use of IVF treatment; A nationwide register study
- Psychosocial determinants of sustained maternal functional impairment: Longitudinal findings from a pregnancy-birth cohort study in rural Pakistan
- Measurement of finger joint angle using stretchable carbon nanotube strain sensor
- Determinants of mortality among patients with drug-resistant tuberculosis in northern Nigeria
- Drugs modulating stochastic gene expression affect the erythroid differentiation process
- Efficacy of UB0316, a multi-strain probiotic formulation in patients with type 2 diabetes mellitus: A double blind, randomized, placebo controlled study
- Prognostic value of des-γ-carboxy prothrombin in patients with hepatocellular carcinoma treated with transarterial chemotherapy: A systematic review and meta-analysis
- Avermectin induces the oxidative stress, genotoxicity, and immunological responses in the Chinese Mitten Crab, Eriocheir sinensis
- Antibiotic use in mandarin production (Citrus reticulata Blanco) in major mandarin-producing areas in Thailand: A survey assessment
- Application of CPI cutoff value based on parentage testing of duos and trios typed by four autosomal kits
- Correction: Good and Bad in the Hands of Politicians: Spontaneous Gestures during Positive and Negative Speech
- Adolescents with worse levels of oral health literacy have more cavitated carious lesions
- Effective methods for the inactivation of Francisella tularensis
- Detection of early-stage Alzheimer’s pathology using blood-based autoantibody biomarkers in elderly hip fracture repair patients
- Correlation between internal pudendal artery stenosis and erectile dysfunction in patients with suspected coronary artery disease
- Analysis of HER2 genomic binding in breast cancer cells identifies a global role in direct gene regulation
- Population productivity of shovelnose rays: Inferring the potential for recovery
- Correction: Long-term clinical outcomes in a cohort of patients with solitary plasmacytoma treated in the modern era
- Effects of tetracycline on myocardial infarct size in obese rats with chemically-induced colitis
- Mineral absorption is an enriched pathway in a brain region of restless legs syndrome patients with reduced MEIS1 expression
- Changes in weight and body composition across five years at university: A prospective observational study
- Adeno-associated virus-mediated expression of human butyrylcholinesterase to treat organophosphate poisoning
- Effects of insulin signaling on mouse taste cell proliferation
- Patient-level cost of home- and facility-based child pneumonia treatment in Suba Sub County, Kenya
- TAP: A static analysis model for PHP vulnerabilities based on token and deep learning technology
- Cost-effectiveness of QuantiFERON-TB Gold In-Tube versus tuberculin skin test for diagnosis and treatment of Latent Tuberculosis Infection in primary health care workers in Brazil
- Multifaceted intervention for the prevention and management of musculoskeletal pain in nursing staff: Results of a cluster randomized controlled trial
- Changes over time in creatinine clearance and comparison of emergent adverse events for HIV-positive adults receiving standard doses (300 mg/day) of lamivudine-containing antiretroviral therapy with baseline creatinine clearance of 30–49 vs ≥50 mL/min
- Population dynamics of foxes during restricted-area culling in Britain: Advancing understanding through state-space modelling of culling records
- Impacts of experimental advisory exit speed sign on traffic speeds for freeway exit ramp
- In-hospital outcomes and 30-day readmission rates among ischemic and hemorrhagic stroke patients with delirium
- Monitoring quality indicators for the Xpert MTB/RIF molecular assay in Ethiopia
- Delivering genes across the blood-brain barrier: LY6A, a novel cellular receptor for AAV-PHP.B capsids
- Correction: Using remote sensing to detect whale strandings in remote areas: The case of sei whales mass mortality in Chilean Patagonia
- Comparison of the inoculum size effects of antibiotics on IMP-6 β-lactamase-producing Enterobacteriaceae co-harboring plasmid-mediated quinolone resistance genes
- Contrast-enhanced computed tomography findings of canine primary renal tumors including renal cell carcinoma, lymphoma, and hemangiosarcoma
- Non-invasive in vivo imaging of UCP1 expression in live mice via near-infrared fluorescent protein iRFP720
- Overexpression of pink1 or parkin in indirect flight muscles promotes mitochondrial proteostasis and extends lifespan in Drosophila melanogaster
- Fiber stiffness, pore size and adhesion control migratory phenotype of MDA-MB-231 cells in collagen gels
- Comparison of two experimental ARDS models in pigs using electrical impedance tomography
- Are primary school children attending full-day school still engaged in sports clubs?
- Stroke risks in women with dysmenorrhea by age and stroke subtype
- Changes in patterns of mortality rates and years of life lost due to firearms in the United States, 1999 to 2016: A joinpoint analysis
- In vitro modeling of Batrachochytrium dendrobatidis infection of the amphibian skin
- Development and validation of LC-MS/MS method for imatinib and norimatinib monitoring by finger-prick DBS in gastrointestinal stromal tumor patients
- Correction: Habitat disturbance and the organization of bacterial communities in Neotropical hematophagous arthropods
- Characterisation of early metazoan secretion through associated signal peptidase complex subunits, prohormone convertases and carboxypeptidases of the marine sponge (Amphimedon queenslandica)
- Time trends between 2002 and 2017 in correlates of self-reported sitting time in European adults
- Performance of patient acuity rating by rapid response team nurses for predicting short-term prognosis
- Changes in HbA1c during the first six years after the diagnosis of Type 2 diabetes mellitus predict long-term microvascular outcomes
- Correction: Antimicrobial resistance genotypes and phenotypes of Campylobacter jejuni isolated in Italy from humans, birds from wild and urban habitats, and poultry
- Correction: Mental health and quality of life outcomes in family members of patients with chronic critical illness admitted to the intensive care units of two Brazilian hospitals serving the extremes of the socioeconomic spectrum
- Correction: Establishing an infrastructure for collaboration in primate cognition research
- Correction: The impact of public health insurance on health care utilisation, financial protection and health status in low- and middle-income countries: A systematic review
- Health provider and service-user experiences of sensory modulation rooms in an acute inpatient psychiatry setting
- Comparison of potential drug-drug interactions with metabolic syndrome medications detected by two databases
- The Polish version of the Cultural Intelligence Scale: Assessment of its reliability and validity among healthcare professionals and medical faculty students
- Selection of optimal reference genes for qRT-PCR analysis of shoot development and graviresponse in prostrate and erect chrysanthemums
- Metastasis risk prediction model in osteosarcoma using metabolic imaging phenotypes: A multivariable radiomics model
- Defining hospital community benefit activities using Delphi technique: A comparison between China and the United States
- Establishment of the experimental procedure for prediction of conjugation capacity in mutant UGT1A1
- A robust multi-objective optimization framework to capture both cellular and intercellular properties in cardiac cellular model tuning: Analyzing different regions of membrane resistance profile in parameter fitting
- Sea star wasting disease demography and etiology in the brooding sea star Leptasterias spp.
- Diagnostic plasma miRNA-profiles for ovarian cancer in patients with pelvic mass
- Genetic diversity and drug resistance of HIV-1 among infected pregnant women newly diagnosed in Luanda, Angola
- I’ve been robbed! – Can changes in floral traits discourage bee pollination?
- Visualising statistical models using dynamic nomograms
- Assessing the capacity of Malawi’s district and central hospitals to manage traumatic diaphyseal femoral fractures in adults
- Diagnostic performance of basal cortisol level at 0900-1300h in adrenal insufficiency
- The Mastery Rubric for Bioinformatics: A tool to support design and evaluation of career-spanning education and training
- Microdissection and whole chromosome painting confirm karyotype transformation in cryptic species of the Lariophagus distinguendus (Förster, 1841) complex (Hymenoptera: Pteromalidae)
- Quality of Kangaroo Mother Care services in Ethiopia: Implications for policy and practice
- Gemcitabine potentiates the anti-tumour effect of radiation on medullary thyroid cancer
- iTRAQ-based high-throughput proteomics analysis reveals alterations of plasma proteins in patients infected with human bocavirus
- The detection of a non-anemophilous plant species using airborne eDNA
- Perception and control of low cable operation forces in voluntary closing body-powered upper-limb prostheses
- Neoadjuvant chemotherapy plus surgery versus concurrent chemoradiotherapy in stage IB2-IIB cervical cancer: A systematic review and meta-analysis
- Randomized methods to characterize large-scale vortical flow networks
- Disentangling the coexistence strategies of mud-daubing wasp species through trophic analysis in oases of Baja California peninsula
- Front-of-pack nutritional labels: Understanding by low- and middle-income Mexican consumers
- Distress in patients with end-stage renal disease: Staff perceptions of barriers to the identification of mild-moderate distress and the provision of emotional support
- Pathways to antibiotics in Bangladesh: A qualitative study investigating how and when households access medicine including antibiotics for humans or animals when they are ill
- DOC export is exceeded by C fixation in May Creek: A late-successional watershed of the Copper River Basin, Alaska
- Behavioral observation of prosocial behavior and social initiative is related to preschoolers’ psychopathological symptoms
- Evaluating the impact of citations of articles based on knowledge flow patterns hidden in the citations
- Correction: Economic sanctions and academia: Overlooked impact and long-term consequences
- Correction: A novel association between relaxin receptor polymorphism and hematopoietic stem cell yield after mobilization
- Expression of Concern: Cooperativity of Oncogenic K-Ras and Downregulated p16/INK4A in Human Pancreatic Tumorigenesis
- Price dispersion of generic medications
- Sex differences in body composition but not neuromuscular function following long-term, doxycycline-induced reduction in circulating levels of myostatin in mice
- The emotion regulation effect of cognitive control is related to depressive state through the mediation of rumination: An ERP study
- Comparison of SMS-EPI and 3D-EPI at 7T in an fMRI localizer study with matched spatiotemporal resolution and homogenized excitation profiles
- Left ventricular mass normalization for body size in children based on an allometrically adjusted ratio is as accurate as normalization based on the centile curves method
- Correction: Combining biophysical parameters, spectral indices and multivariate hyperspectral models for estimating yield and water productivity of spring wheat across different agronomic practices
- Correction: Flowers as viral hot spots: Honey bees (Apis mellifera) unevenly deposit viruses across plant species
- 'Small small quarrels bring about happiness or love in the relationships’: Exploring community perceptions and gendered norms contributing to male perpetrated intimate partner violence in the Central Region of Ghana
- The performance of practitioners conducting facial comparisons on images of children across age
- Increased amounts and stability of telomeric repeat-containing RNA (TERRA) following DNA damage induced by etoposide
- Patients with limitation or withdrawal of life supporting care admitted in a medico-surgical intermediate care unit: Prevalence, description and outcome over a six-month period
- Correction: Diverse radiofrequency sensitivity and radiofrequency effects of mobile or cordless phone near fields exposure in Drosophila melanogaster
- Predicting the performance of TV series through textual and network analysis: The case of Big Bang Theory
- Risk of temperature, humidity and concentrations of air pollutants on the hospitalization of AECOPD
- Mixed methods grant applications in the health sciences: An analysis of reviewer comments
- Renal abnormalities among children with sickle cell conditions in highly resource-limited setting in Ghana
- Size matters: How reaching and vergence movements are influenced by the familiar size of stereoscopically presented objects
- Willingness to receive institutional and community-based eldercare among the rural elderly in China
- An improved deep learning method for predicting DNA-binding proteins based on contextual features in amino acid sequences
- Beyond executive functions, creativity skills benefit academic outcomes: Insights from Montessori education
- A LAMP assay for the rapid and robust assessment of Wolbachia infection in Aedes aegypti under field and laboratory conditions
- Nonarteritic anterior ischemic optic neuropathy is associated with cerebral small vessel disease
- Fiber-tract localized diffusion coefficients highlight patterns of white matter disruption induced by proximity to glioma
- The fight against polio through the NO-DO newsreels during the Francoism period in Spain
- Ocean sound levels in the northeast Pacific recorded from an autonomous underwater glider
- Cost-consequence analysis of influenza vaccination among the staff of a large teaching hospital in Rome, Italy: A pilot study
- The relationship among the progression of inflammation in umbilical cord, fetal inflammatory response, early-onset neonatal sepsis, and chorioamnionitis
- How medical professional students view older people with dementia: Implications for education and practice
- An enhanced nonparametric EWMA sign control chart using sequential mechanism
- Land use change, carbon stocks and tree species diversity in green spaces of a secondary city in Myanmar, Pyin Oo Lwin
- Is there a difference in women’s experiences of care with medication vs. manual vacuum aspiration abortions? Determinants of person-centered care for abortion services
- Maternal complications in pregnancy and childbirth for women with epilepsy: Time trends in a nationwide cohort
- Adsorption of oxytetracycline on kaolinite
- Interdisciplinary stratified care for low back pain: A qualitative study on the acceptability, potential facilitators and barriers to implementation
- The role of resource transfer in positive, non-additive litter decomposition
- The impact of language on the interpretation of resuscitation clinical care plans by doctors. A mixed methods study
- Quantum dots reveal heterogeneous membrane diffusivity and dynamic surface density polarization of dopamine transporter
- Genomic analysis of Shiga toxin-producing Escherichia coli from patients and asymptomatic food handlers in Japan
- The heavy metals lead and cadmium are cytotoxic to human bone osteoblasts via induction of redox stress
- Anatomical, taxonomic, and phylogenetic reappraisal of a poorly known ghost knifefish, Tembeassu marauna (Ostariophysi: Gymnotiformes), using X-ray microcomputed tomography
- Matrix-assisted laser desorption/ionization time of flight mass spectrometry identification of Vibrio (Listonella) anguillarum isolated from sea bass and sea bream
- Recommendations of older adults on how to use the PROM ‘TOPICS-MDS’ in healthcare conversations: A Delphi study
- The winner takes it all—Competitiveness of single nodes in globalized supply networks
- Hamsters in the city: A study on the behaviour of a population of common hamsters (Cricetus cricetus) in urban environment
- Correction: Liquid biopsies for omics-based analysis in sentinel mussels
- Size matters! Association between journal size and longitudinal variability of the Journal Impact Factor
- Drug resistance and epidemiology characteristics of multidrug-resistant tuberculosis patients in 17 provinces of China
- A model-based framework for chronic hepatitis C prevalence estimation
- Adding rewards to regulation: The impacts of watershed conservation on land cover and household wellbeing in Moyobamba, Peru
- Clinical determinants of social media use in individuals with schizophrenia
- Arsenic and nutrient absorption characteristics and antioxidant response in different leaves of two ryegrass (Lolium perenne) species under arsenic stress
- An evolution of socioeconomic related inequality in teenage pregnancy and childbearing in Malawi
- A single plasmid based CRISPR interference in Synechocystis 6803 – A proof of concept
- Structural vulnerability to narcotics-driven firearm violence: An ethnographic and epidemiological study of Philadelphia’s Puerto Rican inner-city
- Temporal trends in intracerebral hemorrhage: Evidence from the Austrian Stroke Unit Registry
- Prevalence and risk factors for multi-drug resistant Escherichia coli among poultry workers in the Federal Capital Territory, Abuja, Nigeria
- Prediction of disease-related metabolites using bi-random walks
- Clinical use, efficacy, and durability of maraviroc for antiretroviral therapy in routine care: A European survey
- Biomarker discovery in inflammatory bowel diseases using network-based feature selection
- The Cinderella Complex: Word embeddings reveal gender stereotypes in movies and books
- Exoproteome profiling of Trypanosoma cruzi during amastigogenesis early stages
- Reproducible phenotype alteration due to prolonged cooling of the pupae of Polyommatus icarus butterflies
- Nutritional treatment with an immune-modulating enteral formula alleviates 5-fluorouracil-induced adverse effects in rats
- Pharmacy-based predictors of non-adherence, non-persistence and reinitiation of antihypertensive drugs among patients on oral diabetes drugs in the Netherlands
- Systematic review of the accuracy of plasma preparation tubes for HIV viral load testing
- Circadian clock regulates the shape and content of dendritic spines in mouse barrel cortex
- “Anybody can make kids; it takes a real man to look after your kids”: Aboriginal men’s discourse on parenting
- Correction: A 1D computer model of the arterial circulation in horses: An important resource for studying global interactions between heart and vessels under normal and pathological conditions
- Maternal interpregnancy weight change and premature birth: Findings from an English population-based cohort study
- Correction: Identifying performance benchmarks and determinants for reproductive performance and calf survival using a longitudinal field study of cow-calf herds in western Canada
- Prognostic value of the model for end-stage liver disease excluding INR score (MELD-XI) in patients with adult congenital heart disease
- Treatment of Urethral Pain Syndrome (UPS) in Sweden
- Migration and political polarization in the U.S.: An analysis of the county-level migration network
- Epidemiology and complications of late-onset sepsis: an Italian area-based study
- The relationship between women’s experience of intimate partner violence and other socio-demographic factors, and under-5 children’s health in South Africa
- Association between trunk and gluteus muscle size and long jump performance
- Multimorbidity and complex multimorbidity in Brazilian rural workers
- Correction: Interspecific Phylogenic Relationships within Genus Melilotus Based on Nuclear and Chloroplast DNA
- Insulin-like growth factor (IGF)-II- mediated fibrosis in pathogenic lung conditions
- Wolf diet and prey selection in the South-Eastern Carpathian Mountains, Romania
- In vitro activity of aryl-thiazole derivatives against Schistosoma mansoni schistosomula and adult worms
- Sample size issues in multilevel logistic regression models
- Seed germination ecology of Ageratum houstonianum: A major invasive weed in Nepal
- Experiences of lifestyle change among women with gestational diabetes mellitus (GDM): A behavioural diagnosis using the COM-B model in a low-income setting
- Pharmacologic management of HCV treatment in patients with HCV monoinfection vs. HIV/HCV coinfection: Does coinfection really matter?
- The association between cigarette smoking and serum thyroid stimulating hormone, thyroid peroxidase antibodies and thyroglobulin antibodies levels in Chinese residents: A cross-sectional study in 10 cities
- Mouse movement measures enhance the stop-signal task in adult ADHD assessment
- Ecosystem functioning in urban grasslands: The role of biodiversity, plant invasions and urbanization
- Correction: KETOS: Clinical decision support and machine learning as a service – A training and deployment platform based on Docker, OMOP-CDM, and FHIR Web Services
- Does craniofacial morphology affect third molars impaction? Results from a population-based study in northeastern Germany
- Hyperconnectivity during screen-based stories listening is associated with lower narrative comprehension in preschool children exposed to screens vs dialogic reading: An EEG study
- Weight loss is associated with improved quality of life among rural women completers of a web-based lifestyle intervention
- Long-term high-grain diet altered the ruminal pH, fermentation, and composition and functions of the rumen bacterial community, leading to enhanced lactic acid production in Japanese Black beef cattle during fattening
- Beyond detoxification: Pleiotropic functions of multiple glutathione S-transferase isoforms protect mice against a toxic electrophile
- Golgi reassembly and stacking protein 65 downregulation is required for the anti-cancer effect of dihydromyricetin on human ovarian cancer cells
- SSR marker development in Clerodendrum trichotomum using transcriptome sequencing
- Risk factors for the carriage of Streptococcus infantarius subspecies infantarius isolated from African fermented dairy products
- Development of an intervention tool for precision oral self-care: Personalized and evidence-based practice for patients with periodontal disease
- Personal values in adolescence and psychological distress in adults: A cross-sectional study based on a retrospective recall
- Overactive bladder and bladder pain syndrome/interstitial cystitis in primary Sjögren’s syndrome patients: A nationwide population-based study
- Clinical utility of combined preimplantation genetic testing methods in couples at risk of passing on beta thalassemia/hemoglobin E disease: A retrospective review from a single center
- Hip stress distribution - Predictor of dislocation in hip arthroplasties. A retrospective study of 149 arthroplasties
- Mortality, morbidity, and cardiac surgery in Injection Drug Use (IDU)-associated versus non-IDU infective endocarditis: The need to expand substance use disorder treatment and harm reduction services
- Pup mortality in New Zealand sea lions (Phocarctos hookeri) at Enderby Island, Auckland Islands, 2013-18
- In vitro endothelial cell migration from limbal edge-modified Quarter-DMEK grafts
- Liquid Chromatography/Mass Spectrometry based serum metabolomics study on recurrent abortion women with antiphospholipid syndrome
- Gut carriage of antimicrobial resistance genes among young children in urban Maputo, Mozambique: Associations with enteric pathogen carriage and environmental risk factors
- Prepubertal nutrition alters Leydig cell functional capacity and timing of puberty
- Reliability of the Swedish version of the Evidence-Based Practice Attitude Scale assessing physiotherapist’s attitudes to implementation of evidence-based practice
- Mitochondrial alarmins are tissue mediators of ventilator-induced lung injury and ARDS
- Complete Chloroplast Genomes of Vachellia nilotica and Senegalia senegal: Comparative Genomics and Phylogenomic Placement in a New Generic System
- Retraction: Over-Expression of Superoxide Dismutase Ameliorates Cr(VI) Induced Adverse Effects via Modulating Cellular Immune System of Drosophila melanogaster
- Effect of pre-season training phase on anthropometric, hormonal and fitness parameters in young soccer players
- Exosomes from conditioned media of bone marrow-derived mesenchymal stem cells promote bone regeneration by enhancing angiogenesis
- Outcome of patients with heart failure after transcatheter aortic valve implantation
- Fatty acid profile of Romanian’s common bean (Phaseolus vulgaris L.) lipid fractions and their complexation ability by β-cyclodextrin
- Appropriate empirical antibiotic therapy and mortality: Conflicting data explained by residual confounding
- Treatment of corneal endothelial damage in a rabbit model with a bioengineered graft using human decellularized corneal lamina and cultured human corneal endothelium
- Telbivudine on IgG-associated hypergammaglobulinemia and TGF-β1 hyperactivity in hepatitis B virus-related liver cirrhosis
- Correction: Axial variation of deoxyhemoglobin density as a source of the low-frequency time lag structure in blood oxygenation level-dependent signals
- Correction: Mobile health-based physical activity intervention for individuals with spinal cord injury in the community: A pilot study
- Retraction: Placental expression of CD100, CD72 and CD45 is dysregulated in human miscarriage
- Correction: Use of IoT sensing and occupant surveys for determining the resilience of buildings to forest fire generated PM2.5
- Correction: The modulation of facial mimicry by attachment tendencies and their underlying affiliation motives in 3-year-olds: An EMG study
- Correction: Cognitive impairment in multiple sclerosis: An exploratory analysis of environmental and lifestyle risk factors
- Discovering novel disease comorbidities using electronic medical records
- Glutathione contributes to efficient post-Golgi trafficking of incoming HPV16 genome
- Epidemiology and antimicrobial resistance of methicillin-resistant Staphylococcus aureus isolates colonizing pigs with different exposure to antibiotics
- Social information use in adolescents: The impact of adults, peers and household composition
- Public practices on antibiotic use: A cross-sectional study among Qatar University students and their family members
- Effects of Topper Training on psychosocial problems, self-esteem, and peer victimisation in Dutch children: A randomised trial
- Comparative studies of two generations of NanoString nCounter System
- General practitioners’ perceptions of delayed antibiotic prescription for respiratory tract infections: A phenomenographic study
- Can altered magnetic field affect the foraging behaviour of ants?
- Parasitic infections and medical expenses according to Health Insurance Review Assessment claims data in South Korea, 2011–2018
- A prospective observational study of on-treatment plasma homocysteine levels as a biomarker of toxicity, depression and vitamin supplementation lead-in time pre pemetrexed, in patients with non-small cell lung cancer and malignant mesothelioma
- A strategy to identify protein-N-myristoylation-dependent phosphorylation reactions of cellular proteins by using Phos-tag SDS-PAGE
- Expression profile of sonic hedgehog signaling-related molecules in basal cell carcinoma
- Seasonal alternation of the ontogenetic development of the moon jellyfish Aurelia coerulea in Maizuru Bay, Japan
- Reliability of measurement of active trunk movement in wheelchair basketball players
- Chinese SLE Treatment and Research group (CSTAR) registry: Clinical significance of thrombocytopenia in Chinese patients with systemic lupus erythematosus
- Does source credibility matter for point-of-decision prompts? A quasi-experimental field study to increase stair use
- Male-pattern baldness and incident coronary heart disease and risk factors in the Heinz Nixdorf Recall Study
- Quality and utilization patterns of maternity waiting homes at referral facilities in rural Zambia: A mixed-methods multiple case analysis of intervention and standard of care sites
- Determining an optimal pool size for testing beef herds for Johne’s disease in Australia
- Correction: Change in larval fish assemblage in a USA east coast estuary estimated from twenty-six years of fixed weekly sampling
- APOE-knockout in rabbits causes loss of cells in nucleus pulposus and enhances the levels of inflammatory catabolic cytokines damaging the intervertebral disc matrix
- Testing Species Assignments in Extant Terebratulide Brachiopods: A Three-dimensional Geometric Morphometric Analysis of Long-Looped Brachidia
- A daily diary study on maladaptive daydreaming, mind wandering, and sleep disturbances: Examining within-person and between-persons relations
- Improved chemotherapy modeling with RAG-based immune deficient mice
- Effect of tracheal antimicrobial peptide on the development of Mannheimia haemolytica pneumonia in cattle
- The internal realities of individuals with type 2 diabetes – a functional framework of self-management practices via Grounded Theory approach
- Role of platelet parameters in early detection and prediction of severity of preeclampsia: A comparative cross-sectional study at Ayder comprehensive specialized and Mekelle general hospitals, Mekelle, Tigray, Ethiopia
- eIF4E and 4EBP1 are prognostic markers of head and neck squamous cell carcinoma recurrence after definitive surgery and adjuvant radiotherapy
- Smoking and other determinants of bone turnover
- Oxygen delivery, oxygen consumption and decreased kidney function after cardiopulmonary bypass
- School engagement of children in early grades: Psychometric, and gender comparisons
- Correction: A review of the elusive bicolored iris Snouted Treefrogs (Anura: Hylidae:Scinax uruguayus group)
- Perceived attractiveness of Czech faces across 10 cultures: Associations with sexual shape dimorphism, averageness, fluctuating asymmetry, and eye color
- Discovery of stable and prognostic CT-based radiomic features independent of contrast administration and dimensionality in oesophageal cancer
- Correction: Population-based dementia prediction model using Korean public health examination data: A cohort study
- Location, location, location: Close ties among older continuing care retirement community residents
- Correction: ISED: Constructing a high-resolution elevation road dataset from massive, low-quality in-situ observations derived from geosocial fitness tracking data
- Correction: Use of validated objective methods of locomotion characteristics and weight distribution for evaluating the efficacy of ketoprofen for alleviating pain in cows with limb pathologies
- Monitoring fine root growth to identify optimal fertilization timing in a forest plantation: A case study in Northeast Vietnam
- Metabolic costs of spontaneous swimming in Sprattus sprattus L., at different water temperatures
- Enterovirus 71 vaccine acceptance among parents of children < 5 years old and their knowledge of hand, foot and mouth disease, Chongqing, China, 2017
- Correction: Transcriptome profiling of mouse brain and lung under Dip2a regulation using RNA-sequencing
- Genetic diversity and antiretroviral resistance-associated mutation profile of treated and naive HIV-1 infected patients from the Northwest and Southwest regions of Cameroon
- Maximum parsimony interpretation of chromatin capture experiments
- Multiple innate antibacterial immune defense elements are correlated in diverse ungulate species
- Incidence and characteristics of ventricular tachycardia in patients after percutaneous coronary revascularization of chronic total occlusions
- Estimating measures of latent variables from m-alternative forced choice responses
- Clade F AAVHSCs cross the blood brain barrier and transduce the central nervous system in addition to peripheral tissues following intravenous administration in nonhuman primates
- First evidence of hepatitis E virus infection in a small mammal (yellow-necked mouse) from Croatia
- The inhibitory effects of polypyrrole on the biofilm formation of Streptococcus mutans
- Self-reported adverse drug effects and associated factors among H. pylori infected patients on standard triple therapy: Prospective follow up study
- Upregulation of ERK phosphorylation in rat dorsal root ganglion neurons contributes to oxaliplatin-induced chronic neuropathic pain
- Characterization of the relationship between neutron production and thermal load on a target material in an accelerator-based boron neutron capture therapy system employing a solid-state Li target
- Remote heart rate monitoring - Assessment of the Facereader rPPg by Noldus
- Seroprevalence of rubella virus antibodies among pregnant women in the Center and South-West regions of Cameroon
- Effectiveness of steam sterilization of reusable medical devices in primary and secondary care public hospitals in Nepal and factors associated with ineffective sterilization: A nation-wide cross-sectional study
- Relevance of HTLV-1 proviral load in asymptomatic and symptomatic patients living in endemic and non-endemic areas of Argentina
- Ritualized aggressive behavior reveals distinct social structures in native and introduced range tawny crazy ants
- The value of kinetic glomerular filtration rate estimation on medication dosing in acute kidney injury
- Screening and characterization of long noncoding RNAs involved in the albinism of Ananas comosus var. bracteatus leaves
- Visual attention to emotional faces in adolescents with social anxiety disorder receiving cognitive behavioral therapy
- A Q fever outbreak associated to courier transport of pets
- Antibodies against measles and rubella virus among different age groups in Thailand: A population-based serological survey
- Molecular diet analysis of Anguilliformes leptocephalus larvae collected in the western North Pacific
- Correction: The relationship between context, structure, and processes with outcomes of 6 regional diabetes networks in Europe
- Correction: The C-reactive protein/albumin ratio as an independent predictor of mortality in patients with severe sepsis or septic shock treated with early goal-directed therapy
- Interleukin 21 (IL-21) regulates chronic allograft vasculopathy (CAV) in murine heart allograft rejection
- Semantic computational analysis of anticoagulation use in atrial fibrillation from real world data
- The implementation of HTA in medicine pricing and reimbursement policies in Indonesia: Insights from multiple stakeholders
- International experiences during United States ophthalmology residency training: Current structure of international experiences and perspectives of faculty mentors at United States training institutions
- Questionable utility of digoxin in left-ventricular assist device recipients: A multicenter, retrospective analysis
- Genotyping and outcomes of presumptive second line ART failure cases switched to third line or maintained on second line ART in Mumbai, India
- A mathematical model of honey bee colony dynamics to predict the effect of pollen on colony failure
- Airway microbiome composition correlates with lung function and arterial stiffness in an age-dependent manner
- An odorant receptor from Anopheles gambiae that demonstrates enantioselectivity to the plant volatile, linalool
- Factors associated with full immunization of children 12–23 months of age in Ethiopia: A multilevel analysis using 2016 Ethiopia Demographic and Health Survey
- Additional evidence that the rat renal interstitium contracts in vivo
- Factors affecting acceptance of at-birth point of care HIV testing among providers and parents in Kenya: A qualitative study
- Removal efficiency of central vacuum system and protective masks to suspended particles from dental treatment
- Psychological well-being and distress in patients with generalized anxiety disorder: The roles of positive and negative functioning
- Conventional rotator cuff versus all-suture anchors—A biomechanical study focusing on the insertion angle in an unlimited cyclic model
- Are viral-infections associated with Ménière’s Disease? A systematic review and meta-analysis of molecular-markers of viral-infection in case-controlled observational studies of MD
- An evaluation of genetic causes and environmental risks for bilateral optic atrophy
- Comparative vector competence of the Afrotropical soft tick Ornithodoros moubata and Palearctic species, O. erraticus and O. verrucosus, for African swine fever virus strains circulating in Eurasia
- Effects of the solubility of yeast cell wall preparations on their potential prebiotic properties in dogs
- Carbogen gas-challenge BOLD fMRI in assessment of liver hypoxia after portal microcapsules implantation
- Socioeconomic determinants of cancer screening utilisation in Latin America: A systematic review
- Development of an easy-to-use questionnaire assessing critical care nursing competence in Japan: A cross-sectional study
- Towards successful business process improvement – An extension of change acceleration process model
- Correction: Dietary polyphenols as a safe and novel intervention for modulating pain associated with intervertebral disc degeneration in an in-vivo rat model
- Correction: Phylogenetic analysis of hepatitis C virus among HIV/ HCV co-infected patients in Nigeria
- Correction: Relationship between self-disclosure to first acquaintances and subjective well-being in people with schizophrenia spectrum disorders living in the community
- Impact of ATM rs1801516 on late skin reactions of radiotherapy for breast cancer: Evidences from a cohort study and a trial sequential meta-analysis
- Involvement of human and canine MRP1 and MRP4 in benzylpenicillin transport
- Soil organic matter rather than ectomycorrhizal diversity is related to urban tree health
- Clinical risk assessment in early pregnancy for preeclampsia in nulliparous women: A population based cohort study
- The relation between circulating levels of vitamin D and parathyroid hormone in children and adolescents with overweight or obesity: Quest for a threshold
- Behavioural evidence for segments as subordinate units in Chinese spoken word production: The form-preparation paradigm revisited
- Correction: Measuring the impact of an interdisciplinary learning project on nursing, architecture and landscape design students’ empathy
- Analysis of the characteristics of chemotherapy-resistant renal cell carcinomas based on global transcriptional analysis of their tissues and cell lines
- The characteristics and treatment patterns of patients with Parkinson’s disease in the United States and United Kingdom: A retrospective cohort study
- Sex differences in youth elite swimming
- Unconventional SCCmec types and low prevalence of the Panton-Valentine Leukocidin exotoxin in South African blood culture Staphylococcus aureus surveillance isolates, 2013-2016
- Prosocial perceptions of taxation predict support for taxes
- Correction: Clonality analysis of pulmonary tumors by genome-wide copy number profiling
- Improved oxygenation following methylprednisolone therapy and survival in paediatric acute respiratory distress syndrome
- Normative values for relative schoolbag weight in primary school children aged 6-14 from Czech Republic: A pilot study
- Correction: Intensive longitudinal modelling predicts diurnal activity of salivary alpha-amylase
- Correction: SNV discovery and functional candidate gene identification for milk composition based on whole genome resequencing of Holstein bulls with extremely high and low breeding values
- Monoclonal antibody anti-PBP2a protects mice against MRSA (methicillin-resistant Staphylococcus aureus) infections
- Diurnal variations of amplitude of accommodation in different age groups
- HHIP overexpression inhibits the proliferation, migration and invasion of non-small cell lung cancer
- Infusion of HIV-1 Nef-expressing astrocytes into the rat hippocampus induces enteropathy and interstitial pneumonitis and increases blood–brain-barrier permeability
- Correlation analysis of cold-related gene expression with physiological and biochemical indicators under cold stress in oil palm
- Student engagement and wellbeing over time at a higher education institution
- Gender-based differences in platelet function and platelet reactivity to P2Y12 inhibitors
- Influence of season and social context on male giant panda (Ailuropoda melanoleuca) vocal behaviour
- Development of an intravaginal ring for the topical delivery of Aurora kinase A inhibitor, MLN8237
- Differential phosphorylation determines the repressor and activator potencies of GLI1 proteins and their efficiency in modulating the HPV life cycle
- Polymorphisms of FDPS, LRP5, SOST and VKORC1 genes and their relation with osteoporosis in postmenopausal Romanian women
- Depression increases the risk of rotator cuff tear and rotator cuff repair surgery: A nationwide population-based study
- Interleukin-38 interacts with destrin/actin-depolymerizing factor in human keratinocytes
- Correction: Fast, quantitative, murine cardiac 19F MRI/MRS of PFCE-labeled progenitor stem cells and macrophages at 9.4T
- Persistent post-discharge opioid prescribing after traumatic brain injury requiring intensive care unit admission: A cross-sectional study with longitudinal outcome
- Genome-wide histone modification profiling of inner cell mass and trophectoderm of bovine blastocysts by RAT-ChIP
- Aerobic exercise increases post-exercise exogenous protein oxidation in healthy young males
- Selection for tandem stop codons in ciliate species with reassigned stop codons
- Research ethics in inter- and multi-disciplinary teams: Differences in disciplinary interpretations
- Correction: Analyzing data from the digital healthcare exchange platform for surveillance of antibiotic prescriptions in primary care in urban Kenya: A mixed-methods study
- Correction: People making deontological judgments in the Trapdoor dilemma are perceived to be more prosocial in economic games than they actually are
- LFRET, a novel rapid assay for anti-tissue transglutaminase antibody detection
- Effects of isotemporal substitution of sedentary behavior with light-intensity or moderate-to-vigorous physical activity on cardiometabolic markers in male adolescents
- Topical estrogen application to wounds promotes delayed cutaneous wound healing in 80-week-old female mice
- Correction: An international randomised placebo-controlled trial of a four-component combination pill (“polypill”) in people with raised cardiovascular risk
- Correction: Evaluation of lung toxicity risk with computed tomography ventilation image for thoracic cancer patients
- Retraction: Pathological Roles of Interleukin-22 in the Development of Recurrent Hepatitis C after Liver Transplantation
- Correction: Elevational Distribution and Ecology of Small Mammals on Tanzania's Second Highest Mountain
- Correction: Decreased breast cancer-specific mortality risk in patients with a history of thyroid cancer
- Correction: Fecal microbiota dysbiosis in macaques and humans within a shared environment
- Correction: The center of pressure and ankle muscle co-contraction in response to anterior-posterior perturbations
- PLOS One
- Archiv čísel
- Aktuální číslo
- Informace o časopisu
Nejčtenější v tomto čísle- A daily diary study on maladaptive daydreaming, mind wandering, and sleep disturbances: Examining within-person and between-persons relations
- Pathways to conspiracy: The social and linguistic precursors of involvement in Reddit’s conspiracy theory forum
- A 3’ UTR SNP rs885863, a cis-eQTL for the circadian gene VIPR2 and lincRNA 689, is associated with opioid addiction
- A substitution mutation in a conserved domain of mammalian acetate-dependent acetyl CoA synthetase 2 results in destabilized protein and impaired HIF-2 signaling
Kurzy
Zvyšte si kvalifikaci online z pohodlí domova
Autoři: prof. MUDr. Vladimír Palička, CSc., Dr.h.c., doc. MUDr. Václav Vyskočil, Ph.D., MUDr. Petr Kasalický, CSc., MUDr. Jan Rosa, Ing. Pavel Havlík, Ing. Jan Adam, Hana Hejnová, DiS., Jana Křenková
Autoři: MUDr. Irena Krčmová, CSc.
Autoři: MDDr. Eleonóra Ivančová, PhD., MHA
Autoři: prof. MUDr. Eva Kubala Havrdová, DrSc.
Všechny kurzyPřihlášení#ADS_BOTTOM_SCRIPTS#Zapomenuté hesloZadejte e-mailovou adresu, se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.
- Vzdělávání