-
Články
- Vzdělávání
- Časopisy
Top články
- Témata
- Kongresy
- Videa
- Podcasty
Nové podcasty
Reklama- Volná místa
Doporučené pozice
Reklama- Praxe
Restoration of Mal overcomes the defects of apoptosis in lung cancer cells
Authors: Li-Tao Yang aff001; Fei Ma aff001; Hao-Tao Zeng aff001; Miao Zhao aff001; Xian-Hai Zeng aff001; Zhi-Qiang Liu aff001; Ping-Chang Yang aff001
Authors place of work: ENT Institute, Research Center of Allergy & Immunology, Shenzhen University School of Medicine, Shenzhen, China aff001; Guangdong Provincial Key Laboratory of Regional Immunity and Diseases, Shenzhen, China aff002
Published in the journal: PLoS ONE 15(1)
Category: Research Article
doi: https://doi.org/10.1371/journal.pone.0227634Summary
Background and aims
Cancer is one of the life-threatening diseases of human beings; the pathogenesis of cancer remains to be further investigated. Toll like receptor (TLR) activities are involved in the apoptosis regulation. This study aims to elucidate the role of Mal (MyD88-adapter-like) molecule in the apoptosis regulation of lung cancer (LC) cells.
Methods
The LC tissues were collected from LC patients. LC cells and normal control (NC) cells were isolated from the tissues and analyzed by pertinent biochemical and immunological approaches.
Results
We found that fewer apoptotic LC cells were induced by cisplatin in the culture as compared to NC cells. The expression of Fas ligand (FasL) was lower in LC cells than that in NC cells. FasL mRNA levels declined spontaneously in LC cells. A complex of FasL/TDP-43 was detected in LC cells. LC cells expressed less Mal than NC cells. Activation of Mal by lipopolysaccharide (LPS) increased TDP-43 expression in LC cells. TDP-43 formed a complex with FasL mRNA to prevent FasL mRNA from decay. Reconstitution of Mal or TDP-43 restored the sensitiveness of LC cells to apoptotic inducers.
Conclusions
LC cells express low Mal levels that contributes to FasL mRNA decay through impairing TDP-43 expression. Reconstitution of Mal restores sensitiveness of LC cells to apoptosis inducers that may be a novel therapeutic approach for LC treatment.
Keywords:
Gene expression – RNA interference – Cancer treatment – apoptosis – Lung and intrathoracic tumors – Pathogenesis – Toll-like receptors – RNA-binding proteins
Introduction
Lung cancer (LC) is one of the leading causes of human death in the world [1]. The symptoms of LC are not specific, and may include weight loss, cough, bloody sputum, and feeling tired all the time. The pathogenesis of LC is unclear; the oncogene activation, inactivation of tumor suppressor genes, and gene mutations may contribute to the development of LC [2]. The LC therapeutic efficacy is currently unsatisfactory [3]. Therefore, it is necessary to further investigate the pathogenesis of LC and invent novel and effective remedies for LC treatment.
Therapeutic approaches for LC mainly include surgery, chemotherapy, radiotherapy and biotherapy. Besides surgery, one of the mechanisms of these therapies is to induce cancer cell apoptosis [4]. Therefore, the dysregulation of apoptosis in cancer cells is a large obstacle in LC treatment [5]. Apoptosis is a physiological process by which the senescent and unwanted cells are eliminated; it is also called programmed cell death [6]. Apoptosis is initiated by intrinsic events or/and extrinsic events. Some regulatory factors for apoptosis have been recognized; e.g., Fas/Fas ligand and caspases involve initiating apoptosis, while some others, e.g., Bcl-2 family, inhibit apoptosis [7]. Over-inhibition of apoptosis may result in the defects of apoptosis in the cell [7]. Although research of apoptosis advanced rapidly in the recent years, yet, factors of inducing the defects of apoptosis in cancer cells remain to be further elucidated.
Microbial factors, such as lipopolysaccharide (LPS), can regulate the process of apoptosis [8]. The Toll like receptors (TLR) mediate microbial stimuli to induce a series of bioactivities in the body [9]. Myeloid differentiation factor 88 (MyD88) and Mal (MyD88-adapter-like) are the critical components in the TLR signal transduction pathway of all TLRs (except TLR3). Published data indicate that Mal is involved in the process of apoptosis [10]; while whether Mal is associated with the pathogenesis of the defects of apoptosis in cancer is unclear.
The RNA decay is associated with the pathogenesis of cancer [11]; it is a physiological phenomenon that eliminates those RNAs not properly processed [12]. Prior to translation, RNA-binding proteins bind to the poly (A) nucleotide tail of RNA to prevent RNA from degradation to regulate RNA production. If the poly (A) tail does not add properly, the RNA may be degraded quickly, result in RNA decay [13]. TAR DNA-binding protein (TDP-43) is an essential DNA - and RNA-binding protein [14]. TDP-43 controls gene expression through RNA processing, such as regulation of splicing. TDP-43 is localized in the cytoplasmic stress granules, which may relate to pathological activities [15]. It is recognized that TDP-43 associates with the pathogenesis of cancer [16]. Yet, whether TDP-43 is involved in the development of the defects of apoptosis in LC is unclear.
Therefore, in this study, we collected LC samples from surgically removed LC tissues. The defects of apoptosis in LC cells were recognized, which was associated with the deficiency of TDP-43 in LC cells.
Materials and methods
The experimental procedures were approved by the Human Ethic Committee at Shenzhen University (180003).
Reagents
Antibodies of Fas (sc-8009), Fas ligand (sc-71096), Toll-like receptor-4 (sc-293072), MyD88 (sc-136970), Mal (sc-390687), TDP-43 (sc-100871) and shRNA kit of Mal, TLR4 (sc-40260) and TDP-43 (sc-154072) were purchased from Santa Cruz Biotech (Santa Cruz, CA). Anti-KRT8 antibody (ab191208) was purchased from abcam (Cambridge, MA). Lipopolysaccharides, fluorometric assay kits for caspase 8 and caspase 3, cisplatin, annexin v kit (APOAF-20TST) and RNA-immunoprecipitation reagents/materials were purchased from Sigma Aldrich (St. Louis., MO). Reagents and materials for RT-qPCR and Western blotting were purchased from Invitrogen (Carlsbad, CA).
Human subjects
This study was carried out in the Research Center of Allergy & Immunology at Shenzhen University. Patients with LC were recruited into this study at the affiliated hospitals of Shenzhen University (Shenzhen, China) from January 2018 to April 2019. The diagnosis and management of LC were carried out by our surgeons and pathologists following our routine procedures. The criteria of recruiting LC patients include: (1) LC; (2) not under specific LC therapies yet; (3) the LC was to be treated by surgery. The demographic data of patients are presented in Table 1. Patients with any of the following conditions were excluded from this study, including under treatment with immune suppressors, allergic diseases, autoimmune diseases and severe organ diseases. A written informed consent was obtained from each human subject.
Tab. 1. Demographic data of patients with lung cancer. Preparation of LC cells and normal control (NC) cells
Surgically removed LC tissue was collected in the operation facilities of our hospital. LC tissue and marginal normal tissue (proved by pathologists with histology procedures) were cut into small pieces, incubated with collagenase IV (1 mg/ml) at 37°C with mild agitation. Single cells were filtered through a cell strainer (70 μm first, then 40 μm) and collected by centrifugation (1,000 g x 5 min). LC cells were purified from single cells by magnetic cell sorting (MACS), in which the KRT8, an epithelial cytoskeleton gene, was used as the LC marker and NC epithelial cell marker; the cells were isolated by flow cytometry cell sorting. NC cells and LC cells isolated from individual subjects were processed and analyzed separately.
Cell culture
NC cells and LC cells were cultured in DMEM. The medium was supplemented with antibiotics (streptomycin and penicillin), fetal calf serum and glutamine. The medium was changed daily. Cell viability was greater than 99% as assessed by Trypan blue exclusion assay.
Induction of apoptosis in NC cells and LC cells
NC cells and LC cells were prepared and cultured in the presence of cisplatin at 10 μM/ml for 48 h. The cells were analyzed by flow cytometry.
Assessment of apoptotic cells
Cells were stained with propidium iodide (5 μg/ml) and annexin v reagent following the manufacturer's instructions. The cells were analyzed with a flow cytometer (FACSCanto II). Data were analyzed with software package flowjo. Data from none stained cells were used as gating references.
Real-time quantitative RT-PCR (RT-qPCR)
Cells were collected from relevant experiments. Total RNA was extracted from the cells with TRIzol reagents. The cDNA was synthesized from RNA with a reverse transcription reagent kit following the manufacturer's instructions. The samples were amplified in a qPCR device with the SYBR Green Master Mix in the presence of relevant primers, including TLR4 (gtgcctccatttcagctctg and caaagatacaccagcggctc), FasL (cagcagcccttcaattaccc and gctgtggttccctctcttct), Mal (gtctgcgcggagtctgag and gagccactcacaaactcaaaga) and TDP-43 (gcagatgatcagattgcgca and aacgcaccaaagttcatccc). Data were processed using the 2-ΔΔCt method with pooled RNA of NC sample (not stimulated) as a control. The results are presented as relevant change.
Protein extraction
Cells were collected from relevant experiments and lysed with a lysis buffer (10 mM HEPES; 1.5 mM MgCl2; 10 mM KCl; 0.5 mM DTT; 1 mM EDTA; 0.05% NP40). The lysates were centrifuged for 10 min at 13,000 g. Supernatant was collected and used as cytosolic protein extracts. The pellets were lysed with a nuclear lysis buffer (5 mM HEPES; 1.5 mM MgCl2SO4; 4.6 M NaCl; 0.2 mM EDTA; 0.5 mM DTT; 26% glycerol) and centrifuged for 10 min at 13,000 g. Supernatant was collected and used as nuclear protein extracts. The procedures were performed at 4°C.
Western blotting
Cells were harvested from relevant experiments. Total proteins were extracted from cells with protein extraction buffer (10 mM HEPES; 1.5 mM MgCl2; 10 mM KCl; 0.5 mM DTT; 1 mM EDTA; 0.05% NP40), fractioned by SDS-PAGE, and transferred onto a PVDF membrane. The membrane was blocked with 5% skim milk for 30 min, incubated with the primary antibodies of interest overnight at 4°C, washed with TBST (Tris-buffered saline containing 0.1% Tween 20) 3 times, incubated with the second antibodies (labeled with peroxidase) for 2 h at room temperature and washed 3 times with TBST. Immunoblots on the membrane were developed with enhanced chemiluminescence and photographed with an imaging device.
RNA immunoprecipitation
Cells were harvested from relevant experiments and radiated with UV for 15 min to cross-link mRNA and protein. The cells were lysed with a lysis buffer (10 mM HEPES; 1.5 mM MgCl2; 10 mM KCl; 0.5 mM DTT; 1 mM EDTA; 0.05% NP40). The lysates were precleared by incubating with protein G agarose beads for 2 h. The beads were removed by centrifugation at 5,000 g for 10 min. The supernatant was collected and incubated with antibodies of interest or isotype IgG overnight. The immunocomplexes in the samples were precipitated by incubating with protein G agarose beads for 2 h. The beads were collected by centrifugation at 5,000 g for 10 min. Complexes of RNA/proteins were eluted from the beads with an eluting buffer. RNA was extracted from the samples with an RNA extracting reagent kit following the manufacturer's instructions. The RNA was analyzed by RT-qPCR and the proteins were analyzed by Western blotting. The procedures were performed at 4°C.
Assessment of caspase activities
Caspase 8 and caspase 3 activity was measured in NC cells and LC cells (1×106/ml) by monitoring cleavage of the caspase 8 - or caspase 3-specific fluorogenic substrate according to the manufacturer’s instructions.
RNA interference (RNAi)
Mal or TDP-43 expression was knocked down in NC cells or LC cells by RNAi with a Mal RNAi reagent kit or TDP-43 reagent kit following the manufacturer’s instructions. The effect of RNAi was assessed by Western blotting 48 h later.
Reconstitution of Mal or TDP-43 in LC cells
Mal expression or TDP-43 expression was reconstituted in LC cells by transfecting LC cells with Mal-expressing plasmids (or control plasmids) or TDP-43-expressing plasmids (or control plasmids) (the plasmids were provided by Sangon Biotech (Shanghai, China) following the manufacturer’s instructions. The effects of reconstitution were assessed by Western blotting 48 h after transfection.
Statistics
The difference between the 2 groups was determined by Student t test. ANOVA was employed for multiple comparisons followed by Dunnett’s test or Bonferroni test. Correlation of data between the two groups was determined by Pearson Correlation assay. P<0.05 was considered statistical significance.
Results
Apoptotic defects in LC cells are positively correlated with FasL expression
LC cells were isolated from surgically removed LC. Normal control (NC) cells were isolated from the marginal none cancer tissues (proved by a pathologist). The cells were exposed to cisplatin (an apoptosis inducer; saline was used as a control agent) in the culture and analyzed by flow cytometry. We found that only a smaller number of apoptotic cells was induced in LC cells as compared to that in NC cells (Fig 1A and 1B), indicating that LC cells have the defects of apoptosis. Since FasL plays a critical role in the induction of apoptosis [17], the FasL expression in the cells was evaluated. The FasL expression was lower in LC cells than that in NC cells (Fig 1C and 1D). The levels of p53, Bax, Fas, caspase 3 and caspase 8 were not significantly different between LC samples and NC samples (S1 Fig). A positive correlation was identified between the FasL expression and the apoptotic cell number (Fig 1E and 1F). The results indicate that LC cells express less FasL that may contribute to the defects of apoptosis in LC cells.
Fig. 1. Apoptotic defects in LC cells. The lung cancer (LC) tissues were collected from LC patients (n = 18). LC cells and NC cells (marginal normal tissues; proved by a pathologist) were isolated from the tissues and exposed to cisplatin or saline (vehicle, used as a control) in the culture for 48 h to induce apoptosis. The cells were analyzed by flow cytometry, RT-qPCR and Western blotting. A, gated cells are apoptotic cells. B, summarized data of apoptotic cells in panel A. C, FasL mRNA levels. D, FasL protein levels. E-F, positive correlation between FasL mRNA and apoptotic cells after exposing to cisplatin. Data of bars are presented as mean ± SEM. Each dot in bars presents data obtained from one sample. Statistics: t test. FasL mRNA spontaneously decay in LC cells
Since RNA decay is a physiological phenomenon in the cell [12], data of Fig 1 imply FasL mRNA may decay spontaneously in LC cells. To test the inference, NC cells and LC cells were cultured in complete DMEM. The cells were stimulated with cisplatin first, then cultured in the presence or absence of LPS in the culture. The cells were harvested at time points of 24, 48, 72 and 96 h, respectively, and analyzed by RT-qPCR. The results showed that FasL mRNA was detected in the cells that maintained stable until 48 h post culture; since then, the FasL mRNA levels declined spontaneously in both NC cells and LC cells, which was counteracted by the presence of LPS in NC cells, but not in LC cells (Fig 2A and 2B). The effects of LPS were abolished by depleting the TLR4 expression (Fig 2B and 2C). The results indicate that FasL mRNA decays spontaneously in NC cells and LC cells, which can be counteracted by the presence of LPS in NC cells, but not in LC cells. The results suggest that activation of TLR4 can maintain the FasL mRNA levels in NC cells.
Fig. 2. FasL mRNA decays spontaneously. NC cells and LC cells were exposed to cisplatin in the culture for 48 h to increase the expression of FasL, washed with fresh medium, and then cultured in the presence or absence of LPS (100 ng/ml). The cells were harvested at indicated timepoints and analyzed by RT-qPCR. The curves show the levels of FasL mRNA in LC cells (A) and NC cells (B). C, results of TLR4 RNAi. TLR4d: TLR4-deficient NC cells. #, TLRd NC cells exposed to LPS in the culture. Data are presented as mean ± SEM and represent 6 independent experiments. Mal expression is impaired in lung epithelial cells of LC patients
We then check the major components of the signal transduction pathway of TLR4 in NC cells and LC cells. The results showed that the expression of TLR4 and MyD88 was not significantly different between NC cells and LC cells, while the Mal levels were significantly lower in LC cells as compared to that in NC cells (Fig 3). The results suggest that the Mal expression impairment may be associated with the FasL mRNA decay in LC cells.
Fig. 3. LC cells express less Mal. LC tissue was collected from LC patients (n = 18). LC cells and NC cells were isolated and analyzed by RT-qPCR and Western blotting. A-B, levels of TLR4. C-D, levels of MyD88. E-F, levels of Mal. Data of bars are presented as mean ± SEM. Each dot in bars presents data obtained from one sample. Statistics: t test. Mal expression impairment is associated with FasL mRNA decay in LC cells
Data of Figs 2 and 3 imply that the Mal expression impairment may be associated with the FasL mRNA decay in the cells. To test this, NC cells were treated with Mal RNAi to knock down the expression of Mal (Fig 4A). Mal-insufficient NC cells were treated with cisplatin first to up regulate FasL expression [18] and then cultured in the presence or absence of LPS for 48 h. The results showed that FasL mRNA decay was observed in NC cells 48 h post culture that was counteracted by the presence of LPS; such an effect was abolished in Mal-deficient NC cells (Fig 4B). On the other hand, LC cells were transfected with Mal-expressing plasmids to reconstitute the Mal expression (Fig 4C). Indeed, reconstitution of Mal stabilized the expression of FasL in the cells in the presence of LPS in the culture (Fig 4D). The results pinpoint the importance of Mal in stabilization of FasL expression in LC cells.
Fig. 4. Mal deficiency is associated with FasL mRNA decay. A-B, NC cells were prepared and exposed to cisplatin in the culture for 48 h. The cells were then washed with fresh medium and treated with Mal RNAi to knock down Mal expression (A). The cells were cultured in the presence or absence of LPS (100 ng/ml) for 48 h. The bars indicate the levels of FasL mRNA (B). C-D, LC cells were prepared; the cells were transfected with Mal-expressing plasmids or control plasmids to restore the expression of Mal (C). The cells were exposed to cisplatin in the culture for 48 h to up regulate the expression of FasL. After washing with fresh medium, the cells were cultured in the presence or absence of LPS (100 ng/ml) for 48 h. The bars indicate the levels of FasL mRNA in the cells. Data of bars are presented as mean ± SEM. Each dot in bars presents data obtained from one sample. Statistics: t test. Mal induces TDP-43 expression to stabilize FasL expression
Published data indicate that TDP-43 can stabilize some mRNAs by physical contact [19]. We wondered if TDP-43 played a role in stabilizing FasL mRNA in LC cells. To this end, we assessed TDP-43 expression in LC cells and NC cells. The results showed that TDP-43 expression was significantly lower in LC cells than that in NC cells (Fig 5A and 5B). A positive correlation was identified between expression of TDP-43 and Mal in the cells (Fig 5C and 5D). The results imply that Mal activation may increase TDP-43expression. To test this, NC cells were exposed to LPS in the culture for 48 h. The results showed that LPS up regulated TDP-43 expression in the cells, which was abolished by knocking down Mal expression by RNAi (Fig 5E and 5F). We further identified a complex of TDP-43 protein and FasL mRNA in NC cells, the amounts of which were markedly less in LC cells (Fig 5G and 5H). In addition, knockdown of TDP-43 expression significantly reduced the FasL mRNA levels in NC cells (Fig 5I and 5J), while restoration of TDP-43 increased FasL mRNA levels in LC cells (Fig 5K and 5L). The results demonstrate that activation of Mal can modulate TDP-43 expression in NC and LC cells.
Fig. 5. Activation of Mal modulates TDP-43 expression. A-B, lung cancer (LC) tissue was collected from LC patients (n = 18). LC cells and NC cells were isolated from the tissue and analyzed by RT-qPCR and Western blotting. Bars indicate the levels of TDP-43 mRNA (A) and immunoblots indicate TDP-43 protein (B). C-D, scatter dot blots indicate a positive correlation between TDP-43 and Mal in NC and LC cells. E-F, NC cells were cultured in the presence of LPS at indicated concentrations (denoted on the x axis of E) for 48 h. Bars indicate the mRNA levels of TDP-43. Immunoblots indicate the protein levels of TDP-43. G-H, HC cells and LC cells were prepared and analyzed by RNA-immunoprecipitation assay; a complex of FasL mRNA and TDP-43 protein was identified. Bars indicate FasL mRNA in the complex. Immunoblots indicate TDP-43 protein in the complex. I, results of TDP-43 RNAi. J, NC cells (with or without TDP-43 depletion) were exposed to cisplatin in the culture for 48 h. Bars show FasL mRNA expression in EC cells. K, results of TDP-43 restoration by transfection of TDP-43 expressing plasmids (TDP-43R). L, Bars show FasL mRNA expression in LC cells. Data of bars are presented as mean ± SEM. Each dot in bars presents data obtained from one sample. Statistics: A and G, t test. E, ANOVA: p<0.0001; *p<0.01, compared with the group “0” (Bonferroni test). J and L, ANOVA + Dunnett’s test. Data of B represent 6 independent experiments (protein extracts of 18 samples were pooled). Data E-H represent 6 independent experiments. #, cells were treated with Mal RNAi to knock down the expression of Mal. $, cells were treated with control RNAi. Reconstitution of Mal restores apoptotic machinery in LC cells
The results of Fig 5 imply that the physical contact of TDP-43/FasL mRNA may play a role in regulation of apoptosis in the cells. To test this, we knocked down TDP-43 or FasL in NC cells by RNAi. The cells were exposed to cisplatin in the culture for 48 h. The results showed that knockdown either TDP-43 or FasL significantly reduced the number of apoptotic cells (Fig 6A and 6B). On the other hand, we reconstituted Mal expression in LC cells by transfection with Mal-expressing plasmids. The cells were exposed to LPS and cisplatin in the culture for 48 h and analyzed by flow cytometry. The results showed that exposure to cisplatin induced markedly more apoptotic cells in those reconstituted with Mal-expressing plasmids as compared to those transfected with control plasmids (Fig 6C and 6D). The results demonstrate that reconstitution of Mal can restore apoptotic machinery in LC cells. Taking together, the results show that deficiency or insufficiency of Mal may impair TDP-43 expression and result in less complexes of TDP-43/FasL mRNA complexes to induce defects of apoptosis in the cells.
Fig. 6. Restoration of apoptotic machinery in LC cells by modulation of Mal or TDP-43 expression. A-B, NC cells were prepared and treated with Mal RNAi or TDP-43 RNAi to knock down the expression of Mal or TDP-43. The cells were exposed to cisplatin in the culture for 48 h. The gated dot plots show apoptotic cells. The bars show summarized data of apoptotic cells. C-D, LC cells were prepared and transfected with Mal-expressing or TDP-43-expressing plasmids as denoted above each subpanel. The cells were exposed to cisplatin in the culture for 48 h. The gated dot plots show apoptotic cells. The bars show summarized data of apoptotic cells. Data of bars are presented as mean ± SEM. Each dot in bars presents data obtained from one sample. The data represent 6 independent experiments. Statistics: ANOVA + Bonferroni test. Discussion
The present data show defects of apoptosis in human LC cells. Defects of apoptosis may be attributed to FasL mRNA decays that occurs spontaneously in the cells. FasL mRNA decay can be blocked by the presence of LPS in the culture, suggesting that activation of TLR4 and its signal transduction pathway can prevent FasL mRNA decay in the cells. Further evidence shows that Mal activation increases TDP-43 expression, the latter physically contacts FasL mRNA to prevent it from decay.
The data show that LC cells have the defects of apoptosis, a phenomenon of apoptosis deregulation [20]. Apoptosis is an important physiological phenomenon in the cell. Deregulation of apoptosis may result in cancer cell over growth to develop into cancer, or induce apoptosis resistance in cancer cells [21]. We used cisplatin to induce apoptosis in experiments. Less LC cells were in a state of apoptosis. The data show that exposure to LPS stabilize FasL. Cisplatin is a drug extensively used in the anti-cancer therapy. The data suggest that LC cells naturally have apoptosis resistance.
In this study, we found that the amounts of FasL mRNA could be up regulated by exposing to cisplatin in both NC cells and LC cells. The fact indicates that the gene transcription of FasL is at functional status in both NC cells and LC cells. The data also show that the FasL mRNA decays spontaneously in both NC cells and LC cells. The presence of LPS can counteract the FasL mRNA decay in NC cells, but not in LC cells. Such a phenomenon suggests that the TLR4 signal is required in the stabilization of FasL mRNA in the cells. This is also noted in the other research system; such as Tian et al reports that activation of TLR4 regulates the FasL/caspase pathway in the liver graft survival [22]. By screening several components of the TLR signal transduction pathway, we found that Mal expression was low in LC cells as compared to that in NC cells. Mal is an important signal adaptor protein in the signal transduction pathway of TLR4 activation, and is required for TLR4-induced myddosome assembly [23]. Our data add novel data to Mal study that Mal is also involved in the induction of TDP-43 expression in LC cells. The data show that exposure to LPS stabilizes FasL mRNA in NC cells but not in LC cells because the deficiency or insufficiency of Mal in LC cells. As LC cells were isolated from the surgically removed LC tissues, LC patients had not received any anti-cancer therapies, the deficiency of Mal in LC cells may contribute to the pathogenesis of LC.
FasL is mainly expressed in T cells and natural killer cells. By activating Fas on target cells, FasL induces target cell apoptosis [24]. In this study, we found that LC cells and NC cells also expressed FasL in response to cisplatin. Such a phenomenon was also found by An et al that airway epithelial cells express FasL upon exposure to 3-methyl-4-nitrophenol, a component of diesel-exhaust particles; the endogenous FasL induces epithelial cell apoptosis [25]. A similar event was found in CD4+ T cells. He et al reported that FasL expression was increased in CD4+ T cells upon poly clonal activation that induced CD4+ T cell apoptosis [26]. Like previous studies [18], we also induced FasL expression in NC cells by exposure to cisplatin in the culture that induced NC cell apoptosis. Because of less amounts of FasL could be induced in LC cells, exposure to cisplatin unable to induce LC cell apoptosis in the culture, a phenomenon like apoptosis resistance occurs in cancer under chemoradiotherapy [27]. We observed that levels of caspase 3 and 8 were not altered in the cells after exposing to cisplatin, this is inconsistent with previous reports [28]; whether are alternative apoptotic pathways activated? This needs to be further investigated.
The data show that activation of Mal up regulates the TDP-43 expression in NC cells and LC cells. TDP-43 is a DNA - and RNA-binding protein [15] and associates with the pathogenesis of cancer [16]. Our data show that TDP-43 bound FasL mRNA in NC cells and LC cells, but the amounts of TDP-43 and TDP-43/FasL mRNA complexes are less in LC cells. Such a feature in LC cells is associated with the lower levels of FasL mRNA in LC cells. We may envisage a scenario that less signal of Mal results in less expression of TDP-43. Because of TDP-43 is required to protect FasL mRNA from decay, the less amounts of TDP-43 results in FasL mRNA decay, and thus, develops apoptosis resistance in the cells. On the other hand, previous reports indicate that the transmembrane activator, calcium modulator, and cyclophilin ligand interactor (TACI) receptor can regulate T-cell-independent marginal zone B cell responses through innate activation-induced cell death [29]. Whether TDP-43 also participates TACI receptor activities in regulating apoptosis is to be investigated.
In summary, the present data show that LC cells have defects of apoptosis that attributes to FasL mRNA decay. The insufficiency of Mal expression in LC cells results in less amounts of TDP-43 expression, the latter is required in stabilization of FasL mRNA in LC cells. Reconstitution of TDP-43 expression in LC cells restores the sensitiveness to apoptosis inducers that may develop to a novel anti-cancer therapy.
Supporting information
S1 Fig [a]
Apoptosis related activities in NC and LC cells.S2 Fig [pdf]
Full-length gel photographs of this paper.
Zdroje
1. Nanavaty P, Alvarez MS, Alberts WM. Lung cancer screening: advantages, controversies, and applications. Cancer Control. 2014;21(1):9–14. Epub 2013/12/21. doi: 10.1177/107327481402100102 24357736.
2. Kadara H, Scheet P, Wistuba II, Spira AE. Early Events in the Molecular Pathogenesis of Lung Cancer. Cancer Prev Res (Phila). 2016;9(7):518–27. Epub 2016/03/24. doi: 10.1158/1940-6207.Capr-15-0400 27006378.
3. Hirsch FR, Scagliotti GV, Mulshine JL, Kwon R, Curran WJ Jr., Wu YL, et al. Lung cancer: current therapies and new targeted treatments. Lancet. 2017;389(10066):299–311. Epub 2016/08/31. doi: 10.1016/S0140-6736(16)30958-8 27574741.
4. Zhang L, Yu J. Role of apoptosis in colon cancer biology, therapy, and prevention. Curr Colorectal Cancer Rep. 2013;9(4). Epub 2013/11/26. doi: 10.1007/s11888-013-0188-z 24273467; PubMed Central PMCID: PMC3836193.
5. Pore MM, Hiltermann TJ, Kruyt FA. Targeting apoptosis pathways in lung cancer. Cancer Lett. 2013;332(2):359–68. Epub 2010/10/27. doi: 10.1016/j.canlet.2010.09.012 20974517.
6. Suvarna V, Singh V, Murahari M. Current overview on the clinical update of Bcl-2 anti-apoptotic inhibitors for cancer therapy. European journal of pharmacology. 2019;862 : 172655. doi: 10.1016/j.ejphar.2019.172655 31494078.
7. Zanoaga O, Braicu C, Jurj A, Rusu A, Buiga R, Berindan-Neagoe I. Progress in Research on the Role of Flavonoids in Lung Cancer. International journal of molecular sciences [Internet]. 2019 2019/09//; 20(17). Available from: http://europepmc.org/abstract/MED/31480720 http://europepmc.org/articles/PMC6747533?pdf=render http://europepmc.org/articles/PMC6747533 https://doi.org/10.3390/ijms20174291.
8. Yu LC, Flynn AN, Turner JR, Buret AG. SGLT-1-mediated glucose uptake protects intestinal epithelial cells against LPS-induced apoptosis and barrier defects: a novel cellular rescue mechanism? Faseb j. 2005;19(13):1822–35. Epub 2005/11/02. doi: 10.1096/fj.05-4226com 16260652.
9. Mikulandra M, Pavelic J, Glavan TM. Recent Findings on the Application of Toll-like Receptors Agonists in Cancer Therapy. Curr Med Chem. 2017;24(19):2011–32. Epub 2017/03/23. doi: 10.2174/0929867324666170320114359 28322156.
10. Mimori K, Shiraishi T, Mashino K, Sonoda H, Yamashita K, Yoshinaga K, et al. MAL gene expression in esophageal cancer suppresses motility, invasion and tumorigenicity and enhances apoptosis through the Fas pathway. Oncogene. 2003;22(22):3463–71. Epub 2003/05/31. doi: 10.1038/sj.onc.1206378 12776198.
11. Popp MW, Maquat LE. Nonsense-mediated mRNA Decay and Cancer. Curr Opin Genet Dev. 2018;48 : 44–50. Epub 2017/11/10. doi: 10.1016/j.gde.2017.10.007 29121514; PubMed Central PMCID: PMC5869107.
12. Labno A, Tomecki R, Dziembowski A. Cytoplasmic RNA decay pathways—Enzymes and mechanisms. Biochim Biophys Acta. 2016;1863(12):3125–47. Epub 2016/11/05. doi: 10.1016/j.bbamcr.2016.09.023 27713097.
13. Gerstberger S, Hafner M, Tuschl T. A census of human RNA-binding proteins. Nat Rev Genet. 2014;15(12):829–45. Epub 2014/11/05. doi: 10.1038/nrg3813 25365966.
14. Warraich ST, Yang S, Nicholson GA, Blair IP. TDP-43: a DNA and RNA binding protein with roles in neurodegenerative diseases. The international journal of biochemistry & cell biology. 2010;42(10):1606–9. doi: 10.1016/j.biocel.2010.06.016 20601083.
15. Dewey CM, Cenik B, Sephton CF, Johnson BA, Herz J, Yu G. TDP-43 aggregation in neurodegeneration: are stress granules the key? Brain Res. 2012;1462 : 16–25. Epub 2012/03/13. doi: 10.1016/j.brainres.2012.02.032 22405725; PubMed Central PMCID: PMC3372581.
16. Guo F, Jiao F, Song Z, Li S, Liu B, Yang H, et al. Regulation of MALAT1 expression by TDP43 controls the migration and invasion of non-small cell lung cancer cells in vitro. Biochem Biophys Res Commun. 2015;465(2):293–8. Epub 2015/08/13. doi: 10.1016/j.bbrc.2015.08.027 26265046.
17. Wang M, Su P. The role of the Fas/FasL signaling pathway in environmental toxicant-induced testicular cell apoptosis: An update. Syst Biol Reprod Med. 2018;64(2):93–102. Epub 2018/01/05. doi: 10.1080/19396368.2017.1422046 29299971.
18. Sui Y, Yang Y, Wang J, Li Y, Ma H, Cai H, et al. Lysophosphatidic Acid Inhibits Apoptosis Induced by Cisplatin in Cervical Cancer Cells. Biomed Res Int. 2015;2015 : 598386. Epub 2015/09/15. doi: 10.1155/2015/598386 26366416; PubMed Central PMCID: PMC4558435.
19. Lee S, Park B. InSAC: A novel sub-nuclear body essential for Interleukin-6 and -10 RNA processing and stability. BMB Rep. 2015;48(5):239–40. Epub 2015/04/08. doi: 10.5483/BMBRep.2015.48.5.060 25845943; PubMed Central PMCID: PMC4578560.
20. Mashima T, Tsuruo T. Defects of the apoptotic pathway as therapeutic target against cancer. Drug Resist Updat. 2005;8(6):339–43. Epub 2005/12/13. doi: 10.1016/j.drup.2005.11.001 16338161.
21. Rathore R, McCallum JE, Varghese E, Florea AM, Busselberg D. Overcoming chemotherapy drug resistance by targeting inhibitors of apoptosis proteins (IAPs). Apoptosis. 2017;22(7):898–919. Epub 2017/04/21. doi: 10.1007/s10495-017-1375-1 28424988; PubMed Central PMCID: PMC5486846.
22. Tian Y, Wang J, Wang W, Ding Y, Sun Z, Zhang Q, et al. Mesenchymal stem cells improve mouse non-heart-beating liver graft survival by inhibiting Kupffer cell apoptosis via TLR4-ERK1/2-Fas/FasL-caspase3 pathway regulation. Stem Cell Res Ther. 2016;7(1):157. Epub 2016/10/30. doi: 10.1186/s13287-016-0416-y 27788674; PubMed Central PMCID: PMC5084468.
23. Bonham KS, Orzalli MH, Hayashi K, Wolf AI, Glanemann C, Weninger W, et al. A promiscuous lipid-binding protein diversifies the subcellular sites of toll-like receptor signal transduction. Cell. 2014;156(4):705–16. Epub 2014/02/18. doi: 10.1016/j.cell.2014.01.019 24529375; PubMed Central PMCID: PMC3951743.
24. Yang C, Liu HZ, Fu ZX. PEG-liposomal oxaliplatin induces apoptosis in human colorectal cancer cells via Fas/FasL and caspase-8. Cell Biol Int. 2012;36(3):289–96. Epub 2011/09/06. doi: 10.1042/CBI20100825 21888623.
25. An YF, Geng XR, Mo LH, Liu JQ, Yang LT, Zhang XW, et al. The 3-methyl-4-nitrophenol (PNMC) compromises airway epithelial barrier function. Toxicology. 2018;395 : 9–14. Epub 2018/01/09. doi: 10.1016/j.tox.2018.01.001 29307546.
26. He W, Yang C, Xia L, Zhao MZ, Ge RT, Huang H, et al. CD4(+) T cells from food allergy model are resistant to TCR-dependent apoptotic induction. Cytokine. 2014;68(1):32–9. Epub 2014/05/03. doi: 10.1016/j.cyto.2014.03.010 24787054.
27. Zhang P, Ma Y, Lv C, Huang M, Li M, Dong B, et al. Upregulation of programmed cell death ligand 1 promotes resistance response in non-small-cell lung cancer patients treated with neo-adjuvant chemotherapy. Cancer Sci. 2016;107(11):1563–71. Epub 2016/09/02. doi: 10.1111/cas.13072 27581532; PubMed Central PMCID: PMC5132280.
28. Parrish AB, Freel CD, Kornbluth S. Cellular mechanisms controlling caspase activation and function. Cold Spring Harb Perspect Biol. 2013;5(6). Epub 2013/06/05. doi: 10.1101/cshperspect.a008672 23732469; PubMed Central PMCID: PMC3660825.
29. Figgett WA, Fairfax K, Vincent FB, Le Page MA, Katik I, Deliyanti D, et al. The TACI receptor regulates T-cell-independent marginal zone B cell responses through innate activation-induced cell death. Immunity. 2013;39(3):573–83. Epub 2013/09/10. doi: 10.1016/j.immuni.2013.05.019 24012421.
Článek Disparate effects of antibiotic-induced microbiome change and enhanced fitness in Daphnia magnaČlánek Phanerochaete chrysosporium strain B-22, a nematophagous fungus parasitizing Meloidogyne incognitaČlánek Do atmospheric events explain the arrival of an invasive ladybird (Harmonia axyridis) in the UK?Článek Growth behavior and glyphosate resistance level in 10 populations of Echinochloa colona in AustraliaČlánek Effects of Transcranial Direct Current Stimulation on GABA and Glx in Children: A pilot studyČlánek Early conservation benefits of a de facto marine protected area at San Clemente Island, CaliforniaČlánek Evaluating risk prediction models for adults with heart failure: A systematic literature reviewČlánek Patient perceived value of teleophthalmology in an urban, low income US population with diabetesČlánek Computational analysis of functional single nucleotide polymorphisms associated with SLC26A4 geneČlánek A study to better understand under-utilization of laboratory tests for antenatal care in SenegalČlánek Monitoring the ‘diabetes epidemic’: A framing analysis of United Kingdom print news 1993-2013Článek Trophic ecology of Mexican Pacific harbor seal colonies using carbon and nitrogen stable isotopesČlánek Models of protein production along the cell cycle: An investigation of possible sources of noiseČlánek Fecal transplant prevents gut dysbiosis and anxiety-like behaviour after spinal cord injury in ratsČlánek Phylogeographic analyses point to long-term survival on the spot in micro-endemic Lycian salamandersČlánek Genlisea hawkingii (Lentibulariaceae), a new species from Serra da Canastra, Minas Gerais, BrazilČlánek Modelling the impact of migrants on the success of the HIV care and treatment program in BotswanaČlánek Does squatting need attention?—A dual-task study on cognitive resources in resistance exerciseČlánek pyKNEEr: An image analysis workflow for open and reproducible research on femoral knee cartilageČlánek Design and evaluation of a laboratory-based wheelchair castor testing protocol using community dataČlánek Role of ecology in shaping external nasal morphology in bats and implications for olfactory trackingČlánek Allergic inflammation is initiated by IL-33–dependent crosstalk between mast cells and basophilsČlánek Combined fiscal policies to promote healthier diets: Effects on purchases and consumer welfareČlánek Influence of light on the infection of Aureococcus anophagefferens CCMP 1984 by a “giant virus”Článek Manual dexterity of mice during food-handling involves the thumb and a set of fast basic movementsČlánek Quantum isomer searchČlánek Optimization of tissue sampling for Borrelia burgdorferi in white-footed mice (Peromyscus leucopus)Článek Effects of Allium hookeri on gut microbiome related to growth performance in young broiler chickensČlánek Age and altitude of residence determine anemia prevalence in Peruvian 6 to 35 months old childrenČlánek Mothers’ oral health literacy and children’s oral health status in Pikine, Senegal: A pilot studyČlánek A network analysis revealed the essential and common downstream proteins related to inguinal herniaČlánek Low risk pregnancies after a cesarean section: Determinants of trial of labor and its failureČlánek Identification and characterization of miRNAs involved in cold acclimation of zebrafish ZF4 cellsČlánek Research on motion planning for an indoor spray arm based on an improved potential field methodČlánek Eye-gaze information input based on pupillary response to visual stimulus with luminance modulationČlánek Disruption in daily eating-fasting and activity-rest cycles in Indian adolescents attending schoolČlánek The earliest farming communities north of the Carpathians: The settlement at Gwoździec site 2Článek Eligibility for hepatitis B antiviral therapy among adults in the general population in ZambiaČlánek Characterization of the visceral and neuronal phenotype of 4L/PS-NA mice modeling Gaucher diseaseČlánek Increased inflammation and endothelial markers in patients with late severe post-thrombotic syndromeČlánek Management of veterinary anaesthesia in small animals: A survey of current practice in QuebecČlánek Umbilical cord separation time, predictors and healing complications in newborns with dry careČlánek Analysis of attitudinal components towards statistics among students from different academic degreesČlánek Forecasting stock prices with long-short term memory neural network based on attention mechanismČlánek Enzyme response of activated sludge to a mixture of emerging contaminants in continuous exposureČlánek Quantitative PCR provides a simple and accessible method for quantitative microbiota profilingČlánek Comparison of Monocyte Distribution Width (MDW) and Procalcitonin for early recognition of sepsisČlánek Transcriptome analysis of Actinidia chinensis in response to Botryosphaeria dothidea infectionČlánek Niche modeling reveals life history shifts in birds at La Brea over the last twenty millenniaČlánek Distributed flux balance analysis simulations of serial biomass fermentation by two organismsČlánek Head impulse compensatory saccades: Visual dependence is most evident in bilateral vestibular lossČlánek Sofosbuvir-based regimen for genotype 2 HCV infected patients in Taiwan: A real world experienceČlánek The virulence domain of Shigella IcsA contains a subregion with specific host cell adhesion functionČlánek Short treatment with antalarmin alters adrenal gland receptors in the rat model of endometriosisČlánek Self-esteem and other risk factors for depressive symptoms among adolescents in United Arab EmiratesČlánek Influence of flow on phosphorus-dynamics and particle size in agricultural drainage ditch sedimentsČlánek An information-based approach to handle various types of uncertainty in fuzzy bodies of evidenceČlánek Novel method to measure temporal windows based on eye movements during viewing of the Necker cubeČlánek The impact of rehabilitation frequency on the risk of stroke in patients with rheumatoid arthritisČlánek Vascularization and biocompatibility of poly(ε-caprolactone) fiber mats for rotator cuff tear repairČlánek Disease-specific out-of-pocket healthcare expenditure in urban Bangladesh: A Bayesian analysisČlánek Reassortment and adaptive mutations of an emerging avian influenza virus H7N4 subtype in ChinaČlánek Occupational gender segregation and economic growth in U.S. local labor markets, 1980 through 2010Článek Accuracy of intraocular lens power calculation formulas using a swept-source optical biometerČlánek Characterization of black patina from the Tiber River embankments using Next-Generation SequencingČlánek Impact of long-term storage and freeze-thawing on eight circulating microRNAs in plasma samplesČlánek Obesity, smoking habits, and serum phosphate levels predicts mortality after life-style interventionČlánek Allele specific expression of Dof genes responding to hormones and abiotic stresses in sugarcaneČlánek Structure-function analyses of candidate small molecule RPN13 inhibitors with antitumor propertiesČlánek Multiple fragmented habitat-patch use in an urban breeding passerine, the Short-toed TreecreeperČlánek And the nominees are: Using design-awards datasets to build computational aesthetic evaluation modelČlánek Predictive factors of first dosage intravenous immunoglobulin-related adverse effects in childrenČlánek Effects of rejection intensity and rejection sensitivity on social approach behavior in womenČlánek The implementation of community-based diabetes and hypertension management care program in IndonesiaČlánek Optimization of cytotoxic activity of Nocardia sp culture broths using a design of experimentsČlánek Investigating Italian disinformation spreading on Twitter in the context of 2019 European electionsČlánek Modelling zero-truncated overdispersed antenatal health care count data of women in BangladeshČlánek Prevalence of antiphospholipid antibodies in Behçet's disease: A systematic review and meta-analysisČlánek Common mental illness among epilepsy patients in Bahir Dar city, Ethiopia: A cross-sectional studyČlánek Genetic characterization of Bacillus anthracis strains circulating in Italy from 1972 to 2018Článek Adverse reproductive effects of S100A9 on bovine sperm and early embryonic development in vitroČlánek CNP mediated selective toxicity on melanoma cells is accompanied by mitochondrial dysfunctionČlánek Factors for starting biosimilar TNF inhibitors in patients with rheumatic diseases in the real worldČlánek Use of magnetic resonance imaging to determine laterality of meniscal size in healthy volunteersČlánek Correction: Mutation spectrums of TSC1 and TSC2 in Chinese women with lymphangioleiomyomatosis (LAM)Článek Young women’s reproductive health conversations: Roles of maternal figures and clinical practicesČlánek Dominant negative effects by inactive Spa47 mutants inhibit T3SS function and Shigella virulenceČlánek Retraction: MiR-30a-5p Antisense Oligonucleotide Suppresses Glioma Cell Growth by Targeting SEPT7Článek Regional versus local wind speed and direction at a narrow beach with a high and steep foreduneČlánek MLST-based genetic relatedness of Campylobacter jejuni isolated from chickens and humans in PolandČlánek Redefining transcriptional regulation of the APOE gene and its association with Alzheimer’s diseaseČlánek Influence of inflammasome NLRP3, and IL1B and IL2 gene polymorphisms in periodontitis susceptibilityČlánek Revisits, readmissions, and outcomes for pediatric traumatic brain injury in California, 2005-2014
Článek vyšel v časopisePLOS One
Nejčtenější tento týden
2020 Číslo 1- Zachyťte pacienty s akutními porfyriemi, aby nebloudili zdravotnictvím
- Auris One: Když se dokumentace v ordinaci praktika začne psát „sama“
- „Jednohubky“ z klinického výzkumu – 2026/11
- Prof. Jan Škrha: Metformin je bezpečný, ale je třeba jej bezpečně užívat a léčbu kontrolovat
- Oxymetazolin v léčbě akutní rýmy = rychlá dekongesce a kratší trvání onemocnění
-
Všechny články tohoto čísla
- ETAPOD: A forecast model for prediction of black pod disease outbreak in Nigeria
- Disparate effects of antibiotic-induced microbiome change and enhanced fitness in Daphnia magna
- Deliver on Your Own: Disrespectful Maternity Care in rural Kenya
- Quantification of microaerobic growth of Geobacter sulfurreducens
- Number of days required to estimate physical activity constructs objectively measured in different age groups: Findings from three Brazilian (Pelotas) population-based birth cohorts
- Identifying site- and stimulation-specific TMS-evoked EEG potentials using a quantitative cosine similarity metric
- Design and assessment of TRAP-CSP fusion antigens as effective malaria vaccines
- Best compromise nutritional menus for childhood obesity
- Phanerochaete chrysosporium strain B-22, a nematophagous fungus parasitizing Meloidogyne incognita
- Non-disclosure of tuberculosis diagnosis by patients to their household members in south western Uganda
- Patch testing in Lao medical students
- A competence-regulated toxin-antitoxin system in Haemophilus influenzae
- Bund removal to re-establish tidal flow, remove aquatic weeds and restore coastal wetland services—North Queensland, Australia
- Exploring the mechanism of olfactory recognition in the initial stage by modeling the emission spectrum of electron transfer
- Risk of complications among diabetics self-reporting oral health status in Canada: A population-based cohort study
- Family Health Days program contributions in vaccination of unreached and under-immunized children during routine vaccinations in Uganda
- Calcium dobesilate reduces VEGF signaling by interfering with heparan sulfate binding site and protects from vascular complications in diabetic mice
- Predicting factors for long-term survival in patients with out-of-hospital cardiac arrest – A propensity score-matched analysis
- HIV infection does not alter interferon α/β receptor 2 expression on mucosal immune cells
- The impact of body posture on intrinsic brain activity: The role of beta power at rest
- Retraction: DJ-1 Modulates α-Synuclein Aggregation State in a Cellular Model of Oxidative Stress: Relevance for Parkinson's Disease and Involvement of HSP70
- Practical considerations in the use of a porcine model (Sus scrofa domesticus) to assess prevention of postoperative peritubal adhesions
- Do atmospheric events explain the arrival of an invasive ladybird (Harmonia axyridis) in the UK?
- Transcriptional Differences in Peanut (Arachis hypogaea L.) Seeds at the Freshly Harvested, After-ripening and Newly Germinated Seed Stages: Insights into the Regulatory Networks of Seed Dormancy Release and Germination
- First adaptation of quinoa in the Bhutanese mountain agriculture systems
- Identifying maintenance hosts for infection with Dichelobacter nodosus in free-ranging wild ruminants in Switzerland: A prevalence study
- Model order reduction for left ventricular mechanics via congruency training
- The use of mixed collagen-Matrigel matrices of increasing complexity recapitulates the biphasic role of cell adhesion in cancer cell migration: ECM sensing, remodeling and forces at the leading edge of cancer invasion
- Hyponatraemia reversibly affects human myometrial contractility. An in vitro pilot study
- Production, purification and evaluation of biodegradation potential of PHB depolymerase of Stenotrophomonas sp. RZS7
- The impact of a wireless audio system on communication in robotic-assisted laparoscopic surgery: A prospective controlled trial
- Towards a bottom-up understanding of antimicrobial use and resistance on the farm: A knowledge, attitudes, and practices survey across livestock systems in five African countries
- Geographical origin determines responses to salinity of Mediterranean caddisflies
- Non-redundant roles in sister chromatid cohesion of the DNA helicase DDX11 and the SMC3 acetyl transferases ESCO1 and ESCO2
- Seroprevalence of viral and vector-borne bacterial pathogens in domestic dogs (Canis familiaris) in northern Botswana
- Global reach of ageism on older persons’ health: A systematic review
- Musical expertise generalizes to superior temporal scaling in a Morse code tapping task
- Cross-cultural adaptation and psychometric evaluation of the Yoruba version of Oswestry disability index
- Growth behavior and glyphosate resistance level in 10 populations of Echinochloa colona in Australia
- Analysis of the lineage of Phytophthora infestans isolates using mating type assay, traditional markers, and next generation sequencing technologies
- Post-transcriptional regulation of Rad51c by miR-222 contributes cellular transformation
- Targeting chondroitinase ABC to axons enhances the ability of chondroitinase to promote neurite outgrowth and sprouting
- First eight residues of apolipoprotein A-I mediate the C-terminus control of helical bundle unfolding and its lipidation
- Repeated noninvasive stimulation of the ventromedial prefrontal cortex reveals cumulative amplification of pleasant compared to unpleasant scene processing: A single subject pilot study
- Can scientists fill the science journalism void? Online public engagement with science stories authored by scientists
- Retention and predictors of attrition among patients who started antiretroviral therapy in Zimbabwe’s national antiretroviral therapy programme between 2012 and 2015
- Prognostics for pain in osteoarthritis: Do clinical measures predict pain after total joint replacement?
- Infants without health insurance: Racial/ethnic and rural/urban disparities in infant households’ insurance coverage
- HY5 is not integral to light mediated stomatal development in Arabidopsis
- Effects of Transcranial Direct Current Stimulation on GABA and Glx in Children: A pilot study
- Hypertension testing and treatment in Uganda and Kenya through the SEARCH study: An implementation fidelity and outcome evaluation
- Whole genome sequence analysis reveals the broad distribution of the RtxA type 1 secretion system and four novel putative type 1 secretion systems throughout the Legionella genus
- Evaluation of rice wild relatives as a source of traits for adaptation to iron toxicity and enhanced grain quality
- The Malaysian Workplace Bullying Index (MWBI): A new measure of workplace bullying in Eastern countries
- Brief communication: Long-term absence of Langerhans cells alters the gene expression profile of keratinocytes and dendritic epidermal T cells
- APOBEC3B reporter myeloma cell lines identify DNA damage response pathways leading to APOBEC3B expression
- Morphological diversity within a core collection of subterranean clover (Trifolium subterraneum L.): Lessons in pasture adaptation from the wild
- Feasibility of real-time in vivo 89Zr-DFO-labeled CAR T-cell trafficking using PET imaging
- Repository-based plasmid design
- A LAMP at the end of the tunnel: A rapid, field deployable assay for the kauri dieback pathogen, Phytophthora agathidicida
- A new method of recording from the giant fiber of Drosophila melanogaster shows that the strength of its auditory inputs remains constant with age
- Early conservation benefits of a de facto marine protected area at San Clemente Island, California
- Evaluating risk prediction models for adults with heart failure: A systematic literature review
- Age, period and cohort analysis of age-specific maternal mortality trend in Ethiopia: A secondary analysis
- Aberrant cervical innate immunity predicts onset of dysbiosis and sexually transmitted infections in women of reproductive age
- Performance of Qure.ai automatic classifiers against a large annotated database of patients with diverse forms of tuberculosis
- Closed circuit xenon delivery for 72h in neonatal piglets following hypoxic insult using an ambient pressure automated control system: Development, technical evaluation and pulmonary effects
- Safe mobility, socioeconomic inequalities, and aging: A 12-year multilevel interrupted time-series analysis of road traffic death rates in a Latin American country
- THAP11F80L cobalamin disorder-associated mutation reveals normal and pathogenic THAP11 functions in gene expression and cell proliferation
- Lesion of striatal patches disrupts habitual behaviors and increases behavioral variability
- A clinical method for estimating the modulus of elasticity of the human cornea in vivo
- Gamma gap thresholds and HIV, hepatitis C, and monoclonal gammopathy
- Infective endocarditis post-transcatheter aortic valve implantation (TAVI), microbiological profile and clinical outcomes: A systematic review
- Potentiation of curing by a broad-host-range self-transmissible vector for displacing resistance plasmids to tackle AMR
- An acceleration in hypertension-related mortality for middle-aged and older Americans, 1999-2016: An observational study
- Two common disease-associated TYK2 variants impact exon splicing and TYK2 dosage
- Patient perceived value of teleophthalmology in an urban, low income US population with diabetes
- Real-world cost-effectiveness of rivaroxaban compared with vitamin K antagonists in the context of stroke prevention in atrial fibrillation in France
- Spatial risk assessment of global change impacts on Swedish seagrass ecosystems
- The effects of low-carbohydrate diets on cardiovascular risk factors: A meta-analysis
- Computational analysis of functional single nucleotide polymorphisms associated with SLC26A4 gene
- Evidence in support of chromosomal sex influencing plasma based metabolome vs APOE genotype influencing brain metabolome profile in humanized APOE male and female mice
- Accelerated sparsity based reconstruction of compressively sensed multichannel EEG signals
- A multicenter case control study of association of vitamin D with breast cancer among women in Karachi, Pakistan
- Microvesicles from Lactobacillus reuteri (DSM-17938) completely reproduce modulation of gut motility by bacteria in mice
- Chemical profiling of Curatella americana Linn leaves by UPLC-HRMS and its wound healing activity in mice
- “Yellow” laccase from Sclerotinia sclerotiorum is a blue laccase that enhances its substrate affinity by forming a reversible tyrosyl-product adduct
- Dense carbon-nanotube coating scaffolds stimulate osteogenic differentiation of mesenchymal stem cells
- Gamma Knife radiosurgery for vestibular schwannomas: Evaluation of planning using the sphericity degree of the target volume
- Variants in ADIPOQ gene are linked to adiponectin levels and lung function in young males independent of obesity
- Purification and molecular characterization of phospholipase, antigen 5 and hyaluronidases from the venom of the Asian hornet (Vespa velutina)
- Clinical state tracking in serious mental illness through computational analysis of speech
- Why are animal source foods rarely consumed by 6-23 months old children in rural communities of Northern Ethiopia? A qualitative study
- A study to better understand under-utilization of laboratory tests for antenatal care in Senegal
- Monitoring the ‘diabetes epidemic’: A framing analysis of United Kingdom print news 1993-2013
- Heart rate variability helps to distinguish the intensity of menopausal symptoms: A prospective, observational and transversal study
- Physicians’ perspectives regarding non-medical switching of prescription medications: Results of an internet e-survey
- Trophic ecology of Mexican Pacific harbor seal colonies using carbon and nitrogen stable isotopes
- Effectiveness of information technology–enabled ‘SMART Eating’ health promotion intervention: A cluster randomized controlled trial
- Cauda Equina Syndrome Core Outcome Set (CESCOS): An international patient and healthcare professional consensus for research studies
- Incidence and prediction of intraoperative and postoperative cardiac arrest requiring cardiopulmonary resuscitation and 30-day mortality in non-cardiac surgical patients
- Microscopic distance from tumor invasion front to serosa might be a useful predictive factor for peritoneal recurrence after curative resection of T3-gastric cancer
- A new species of Macrocypraea (Gastropoda, Cypraeidae) from Trindade Island, Brazil, including phenotypic differentiation from remaining congeneric species
- The evolving topology of the Lightning Network: Centralization, efficiency, robustness, synchronization, and anonymity
- Avoid jumping to conclusions under uncertainty in Obsessive Compulsive Disorder
- Tanopicobia gen. nov., a new genus of quill mites, its phylogenetic placement in the subfamily Picobiinae (Acariformes: Syringophilidae) and picobiine relationships with avian hosts
- Large-scale spatial variation of chronic stress signals in moose
- Complex situations: Economic insecurity, mental health, and substance use among pregnant women who consider – but do not have – abortions
- Well-being and entrepreneurship: Using establishment size to identify treatment effects and transmission mechanisms
- Models of protein production along the cell cycle: An investigation of possible sources of noise
- Protein-protein interactions underlying the behavioral and psychological symptoms of dementia (BPSD) and Alzheimer’s disease
- Assessing the feasibility of a life history calendar to measure HIV risk and health in older South Africans
- Prevalence of anaemia and low intake of dietary nutrients in pregnant women living in rural and urban areas in the Ashanti region of Ghana
- Enhancing performance of subject-specific models via subject-independent information for SSVEP-based BCIs
- Perceptions of and interest in HIV pre-exposure prophylaxis use among adolescent girls and young women in Lilongwe, Malawi
- Long term conjugated linoleic acid supplementation modestly improved growth performance but induced testicular tissue apoptosis and reduced sperm quality in male rabbit
- A new approach to the temporal significance of house orientations in European Early Neolithic settlements
- Meta-analysis of the radiological and clinical features of Usual Interstitial Pneumonia (UIP) and Nonspecific Interstitial Pneumonia (NSIP)
- Extreme mortality and reproductive failure of common murres resulting from the northeast Pacific marine heatwave of 2014-2016
- Persistence of chikungunya ECSA genotype and local outbreak in an upper medium class neighborhood in Northeast Brazil
- Fecal transplant prevents gut dysbiosis and anxiety-like behaviour after spinal cord injury in rats
- In vivo elongation of thin filaments results in heart failure
- High resolution respirometry to assess function of mitochondria in native homogenates of human heart muscle
- Disparity in depressive symptoms between heterosexual and sexual minority men in China: The role of social support
- Effect of classroom intervention on student food selection and plate waste: Evidence from a randomized control trial
- Cytomegalovirus-specific CD8+ T-cell responses are associated with arterial blood pressure in people living with HIV
- In-depth hepatoprotective mechanistic study of Phyllanthus niruri: In vitro and in vivo studies and its chemical characterization
- Content shared on social media for national cancer survivors day 2018
- Cost-effectiveness of alectinib compared to crizotinib for the treatment of first-line ALK+ advanced non-small-cell lung cancer in France
- Mating strategy is determinant of adenovirus prevalence in European bats
- Preventing HIV and HSV-2 through knowledge and attitudes: A replication study of a multi-component community-based intervention in Zimbabwe
- MLST-based genetic relatedness of Campylobacter jejuni isolated from chickens and humans in Poland
- Unraveling the polychromy and antiquity of the Pachacamac Idol, Pacific coast, Peru
- Randomized clinical trial analyzing maintenance of peripheral venous catheters in an internal medicine unit: Heparin vs. saline
- Hypertension prevalence but not control varies across the spectrum of risk in patients with atrial fibrillation: A RE-LY atrial fibrillation registry sub-study
- Valuing natural habitats for enhancing coastal resilience: Wetlands reduce property damage from storm surge and sea level rise
- Universal coverage but unmet need: National and regional estimates of attrition across the diabetes care continuum in Thailand
- Patient-related factors may influence nursing perception of sleep in the Intensive Care Unit
- A systematic review and meta-analysis of acute kidney injury in the intensive care units of developed and developing countries
- Phylogeographic analyses point to long-term survival on the spot in micro-endemic Lycian salamanders
- A randomized trial of a behavioral intervention to decrease hospital length of stay by decreasing bedrest
- Genlisea hawkingii (Lentibulariaceae), a new species from Serra da Canastra, Minas Gerais, Brazil
- Structural variation and its potential impact on genome instability: Novel discoveries in the EGFR landscape by long-read sequencing
- Assessment of forest cover and carbon stock changes in sub-tropical pine forest of Azad Jammu & Kashmir (AJK), Pakistan using multi-temporal Landsat satellite data and field inventory
- Color image segmentation using adaptive hierarchical-histogram thresholding
- The association between nonalcoholic fatty liver disease and esophageal, stomach, or colorectal cancer: National population-based cohort study
- Effects in spite of tough constraints - A theory of change based investigation of contextual and implementation factors affecting the results of a performance based financing scheme extended to malnutrition in Burundi
- Comparison of motif-based and whole-unique-sequence-based analyses of phage display library datasets generated by biopanning of anti-Borrelia burgdorferi immune sera
- Identification of the cleavage sites leading to the shed forms of human and mouse anti-aging and cognition-enhancing protein Klotho
- Research performance and age explain less than half of the gender pay gap in New Zealand universities
- Do bumblebees have signatures? Demonstrating the existence of a speed-curvature power law in Bombus terrestris locomotion patterns
- A primary healthcare information intervention for communicating cardiovascular risk to patients with poorly controlled hypertension: The Education and Coronary Risk Evaluation (Educore) study—A pragmatic, cluster-randomized trial
- “I did not know it was a medical condition”: Predictors, severity and help seeking behaviors of women with female sexual dysfunction in the Volta region of Ghana
- The role of services content for manufacturing competitiveness: A network analysis
- Mortality and demographic recovery in early post-black death epidemics: Role of recent emigrants in medieval Dijon
- Modelling the impact of migrants on the success of the HIV care and treatment program in Botswana
- Does squatting need attention?—A dual-task study on cognitive resources in resistance exercise
- A human mission to Mars: Predicting the bone mineral density loss of astronauts
- The role of demographic history and selection in shaping genetic diversity of the Galápagos penguin (Spheniscus mendiculus)
- Attitudes towards animal study registries and their characteristics: An online survey of three cohorts of animal researchers
- Risk perception and behavioral change during epidemics: Comparing models of individual and collective learning
- Drug-target interaction prediction using Multi Graph Regularized Nuclear Norm Minimization
- A preliminary study of resting brain metabolism in treatment-resistant depression before and after treatment with olanzapine-fluoxetine combination
- Use of serum KL-6 level for detecting patients with restrictive allograft syndrome after lung transplantation
- Gait asymmetry in glucocerebrosidase mutation carriers with Parkinson’s disease
- Radioiodine therapy and Graves’ disease – Myths and reality
- pyKNEEr: An image analysis workflow for open and reproducible research on femoral knee cartilage
- Creatinine versus cystatin C for renal function-based mortality prediction in an elderly cohort: The Northern Manhattan Study
- Risk factors for third-generation cephalosporin resistant Enterobacteriaceae in gestational urine cultures: A retrospective cohort study based on centralized electronic health records
- Population-based estimates of humoral autoimmunity from the U.S. National Health and Nutrition Examination Surveys, 1960–2014
- Residential neighbourhood greenspace is associated with reduced risk of cardiovascular disease: A prospective cohort study
- Circulating CTRP9 correlates with the prevention of aortic calcification in renal allograft recipients
- Potential socioeconomic impacts from ocean acidification and climate change effects on Atlantic Canadian fisheries
- Prevention and control of cholera with household and community water, sanitation and hygiene (WASH) interventions: A scoping review of current international guidelines
- Kinematic analysis of motor learning in upper limb body-powered bypass prosthesis training
- The treeness of the tree of historical trees of life
- Female finches prefer courtship signals indicating male vigor and neuromuscular ability
- The effect of spatial position and age within an egg-clutch on embryonic development and key metabolic enzymes in two clownfish species, Amphiprion ocellaris and Amphiprion frenatus
- Egg donors’ motivations, experiences, and opinions: A survey of egg donors in South Africa
- Polymer-free sirolimus-eluting stent use in Europe and Asia: Ethnic differences in demographics and clinical outcomes
- How “simple” methodological decisions affect interpretation of population structure based on reduced representation library DNA sequencing: A case study using the lake whitefish
- The impact of translated reminder letters and phone calls on mammography screening booking rates: Two randomised controlled trials
- Application of a genetic algorithm to the keyboard layout problem
- Design and evaluation of a laboratory-based wheelchair castor testing protocol using community data
- Relationship between diabetic macular edema and choroidal layer thickness
- Evaluation of the predictive ability of ultrasound-based assessment of breast cancer using BI-RADS natural language reporting against commercial transcriptome-based tests
- A Comprehensive Data Gathering Network Architecture in Large-Scale Visual Sensor Networks
- Recovery of health-related quality of life after burn injuries: An individual participant data meta-analysis
- Modeling aggressive market order placements with Hawkes factor models
- Higher prevalence of splenic artery aneurysms in hereditary hemorrhagic telangiectasia: Vascular implications and risk factors
- Measuring the diffusion of innovations with paragraph vector topic models
- Role of ecology in shaping external nasal morphology in bats and implications for olfactory tracking
- Neandertals on the beach: Use of marine resources at Grotta dei Moscerini (Latium, Italy)
- Allergic inflammation is initiated by IL-33–dependent crosstalk between mast cells and basophils
- High expression of olfactomedin-4 is correlated with chemoresistance and poor prognosis in pancreatic cancer
- Wattpad as a resource for literary studies. Quantitative and qualitative examples of the importance of digital social reading and readers’ comments in the margins
- Constructing and influencing perceived authenticity in science communication: Experimenting with narrative
- Development and validation of a prognostic model predicting symptomatic hemorrhagic transformation in acute ischemic stroke at scale in the OHDSI network
- Immune recovery markers in a double blind clinical trial comparing dolutegravir and raltegravir based regimens as initial therapy (SPRING-2)
- A non-canonical role for p27Kip1 in restricting proliferation of corneal endothelial cells during development
- Combined fiscal policies to promote healthier diets: Effects on purchases and consumer welfare
- Estimating the impact of drug use on US mortality, 1999-2016
- Complex patterns of cell growth in the placenta in normal pregnancy and as adaptations to maternal diet restriction
- Tofu intake is inversely associated with risk of breast cancer: A meta-analysis of observational studies
- Digging the diversity of Iberian bait worms Marphysa (Annelida, Eunicidae)
- Influence of light on the infection of Aureococcus anophagefferens CCMP 1984 by a “giant virus”
- MESSAR: Automated recommendation of metabolite substructures from tandem mass spectra
- Temporal ordering of input modulates connectivity formation in a developmental neuronal network model of the cortex
- Healthy lifestyle index and its association with hypertension among community adults in Sri Lanka: A cross-sectional study
- Manual dexterity of mice during food-handling involves the thumb and a set of fast basic movements
- Research on an evolutionary game model and simulation of a cluster innovation network based on fairness preference
- Reconstructing Krassilovia mongolica supports recognition of a new and unusual group of Mesozoic conifers
- Selection of memory clinic patients for CSF biomarker assessment can be restricted to a quarter of cases by using computerized decision support, without compromising diagnostic accuracy
- From organ to cell: Multi-level telomere length assessment in patients with idiopathic pulmonary fibrosis
- Training interval in cardiopulmonary resuscitation
- Quantum isomer search
- Ultrastructure of light-activated axons following optogenetic stimulation to produce late-phase long-term potentiation
- Optimization of tissue sampling for Borrelia burgdorferi in white-footed mice (Peromyscus leucopus)
- How do critical care staff respond to organisational challenge? A qualitative exploration into personality types and cognitive processing in critical care
- Symmetric core-cohesive blockmodel in preschool children’s interaction networks
- Effects of supplemental creatine and guanidinoacetic acid on spatial memory and the brain of weaned Yucatan miniature pigs
- Predicting antibacterial activity from snake venom proteomes
- Community-Based Health Planning and Services Plus programme in Ghana: A qualitative study with stakeholders in two Systems Learning Districts on improving the implementation of primary health care
- An investigation of transportation practices in an Ontario swine system using descriptive network analysis
- Comparison of gridded precipitation datasets for rainfall-runoff and inundation modeling in the Mekong River Basin
- Functional interactions in patients with hemianopia: A graph theory-based connectivity study of resting fMRI signal
- PCR for the detection of pathogens in neonatal early onset sepsis
- Mercury and selenium concentrations in fishes of the Upper Colorado River Basin, southwestern United States: A retrospective assessment
- The effects of dual-task cognitive interference on gait and turning in Huntington’s disease
- Effects of Allium hookeri on gut microbiome related to growth performance in young broiler chickens
- Novel imaging biomarkers for mapping the impact of mild mitochondrial uncoupling in the outer retina in vivo
- Hyperkalemia treatment modalities: A descriptive observational study focused on medication and healthcare resource utilization
- Age and altitude of residence determine anemia prevalence in Peruvian 6 to 35 months old children
- Web service QoS prediction using improved software source code metrics
- Long term impact of PositiveLinks: Clinic-deployed mobile technology to improve engagement with HIV care
- Comparison of post-transplantation diabetes mellitus incidence and risk factors between kidney and liver transplantation patients
- Mothers’ oral health literacy and children’s oral health status in Pikine, Senegal: A pilot study
- A definition-by-example approach and visual language for activity patterns in engineering disciplines
- A network analysis revealed the essential and common downstream proteins related to inguinal hernia
- Use of conventional cardiac troponin assay for diagnosis of non-ST-elevation myocardial infarction: ‘The Ottawa Troponin Pathway’
- Low risk pregnancies after a cesarean section: Determinants of trial of labor and its failure
- Exploratory analysis of the potential for advanced diagnostic testing to reduce healthcare expenditures of patients hospitalized with meningitis or encephalitis
- Airway epithelial specific deletion of Jun-N-terminal kinase 1 attenuates pulmonary fibrosis in two independent mouse models
- Identification and characterization of miRNAs involved in cold acclimation of zebrafish ZF4 cells
- Research on motion planning for an indoor spray arm based on an improved potential field method
- Camera-traps are a cost-effective method for surveying terrestrial squamates: A comparison with artificial refuges and pitfall traps
- Detailed analysis of the transverse arch of hallux valgus feet with and without pain using weightbearing ultrasound imaging and precise force sensors
- The role of survivin in the progression of pancreatic ductal adenocarcinoma (PDAC) and a novel survivin-targeted therapeutic for PDAC
- Filling the human resource gap through public-private partnership: Can private, community-based skilled birth attendants improve maternal health service utilization and health outcomes in a remote region of Bangladesh?
- HIV antiretroviral drugs, dolutegravir, maraviroc and ritonavir-boosted atazanavir use different pathways to affect inflammation, senescence and insulin sensitivity in human coronary endothelial cells
- Still standing: Recent patterns of post-fire conifer refugia in ponderosa pine-dominated forests of the Colorado Front Range
- Surrogate R-spondins for tissue-specific potentiation of Wnt Signaling
- Biogeographic study of human gut-associated crAssphage suggests impacts from industrialization and recent expansion
- Apolipoprotein-AI mimetic peptides D-4F and L-5F decrease hepatic inflammation and increase insulin sensitivity in C57BL/6 mice
- Treating patients with driving phobia by virtual reality exposure therapy – a pilot study
- The impact of race relations on NFL attendance: An econometric analysis
- The potential impact of the Affordable Care Act and Medicaid expansion on reducing colorectal cancer screening disparities in African American males
- Efficient processing of raster and vector data
- Rewilding with large herbivores: Positive direct and delayed effects of carrion on plant and arthropod communities
- Early life experience and alterations of group composition shape the social grooming networks of former pet and entertainment chimpanzees (Pan troglodytes)
- Muscarinic modulation of M and h currents in gerbil spherical bushy cells
- Therapeutic hypothermia after out of hospital cardiac arrest improve 1-year survival rate for selective patients
- Carotid plaques and neurological impairment in patients with acute cerebral infarction
- Deep learning based image reconstruction algorithm for limited-angle translational computed tomography
- Subterranean Deuteraphorura Absolon, 1901, (Hexapoda, Collembola) of the Western Carpathians — Troglomorphy at the northern distributional limit in Europe
- Fragmentation and inefficiencies in US equity markets: Evidence from the Dow 30
- Association between coffee drinking and telomere length in the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial
- Hyperbaric oxygen preconditioning and the role of NADPH oxidase inhibition in postischemic acute kidney injury induced in spontaneously hypertensive rats
- Rad51 paralogs and the risk of unselected breast cancer: A case-control study
- Aqueous ethanol extract of Libidibia ferrea (Mart. Ex Tul) L.P. Queiroz (juca) exhibits antioxidant and migration-inhibiting activity in human gastric adenocarcinoma (ACP02) cells
- Diagnostic differences in respiratory breathing patterns and work of breathing indices in children with Duchenne muscular dystrophy
- The role of narrative in collaborative reasoning and intelligence analysis: A case study
- Proportions of CD4 test results indicating advanced HIV disease remain consistently high at primary health care facilities across four high HIV burden countries
- Modelling of amino acid turnover in the horse during training and racing: A basis for developing a novel supplementation strategy
- Single-modal and multi-modal false arrhythmia alarm reduction using attention-based convolutional and recurrent neural networks
- Eye-gaze information input based on pupillary response to visual stimulus with luminance modulation
- Predictive value of comb-push ultrasound shear elastography for the differentiation of reactive and metastatic axillary lymph nodes: A preliminary investigation
- Type 1 diabetes is associated with an increased risk of venous thromboembolism: A retrospective population-based cohort study
- Trends of litter decomposition and soil organic matter stocks across forested swamp environments of the southeastern US
- Post mortem evaluation of inflammation, oxidative stress, and PPARγ activation in a nonhuman primate model of cardiac sympathetic neurodegeneration
- Were ancient foxes far more carnivorous than recent ones?—Carnassial morphological evidence
- Disruption in daily eating-fasting and activity-rest cycles in Indian adolescents attending school
- Plasma proteome profiling of freshwater and seawater life stages of rainbow trout (Oncorhynchus mykiss)
- Association between baseline abundance of Peptoniphilus, a Gram-positive anaerobic coccus, and wound healing outcomes of DFUs
- The earliest farming communities north of the Carpathians: The settlement at Gwoździec site 2
- Trends of the prevalence and incidence of hypertrophic cardiomyopathy in Korea: A nationwide population-based cohort study
- Percent amplitude of fluctuation: A simple measure for resting-state fMRI signal at single voxel level
- Antimicrobial activity of Asteraceae species against bacterial pathogens isolated from postmenopausal women
- Designing information provision to serve as a reminder of altruistic benefits: A case study of the risks of air pollution caused by industrialization
- Are changes in depressive symptoms, general health and residential area socio-economic status associated with trajectories of waist circumference and body mass index?
- Extracellular vesicles of U937 macrophage cell line infected with DENV-2 induce activation in endothelial cells EA.hy926
- FlexGraph: Flexible partitioning and storage for scalable graph mining
- Post-weaning infant-to-mother bonding in nutritionally independent female mice
- A little good is good enough: Ethical consumption, cheap excuses, and moral self-licensing
- Link-centric analysis of variation by demographics in mobile phone communication patterns
- Multimodal hand gesture recognition using single IMU and acoustic measurements at wrist
- Variance based weighting of multisensory head rotation signals for verticality perception
- Eligibility for hepatitis B antiviral therapy among adults in the general population in Zambia
- Tobacco smoking and health-related quality of life among university students: Mediating effect of depression
- Drivers of the opioid crisis: An appraisal of financial conflicts of interest in clinical practice guideline panels at the peak of opioid prescribing
- Nutritional inadequacies in commercial vegan foods for dogs and cats
- LTA1 and dmLT enterotoxin-based proteins activate antigen-presenting cells independent of PKA and despite distinct cell entry mechanisms
- The Shapley value for a fair division of group discounts for coordinating cooling loads
- Comparison and evaluation of the morphology of crowns generated by biogeneric design technique with CEREC chairside system
- Assessing risk factors and impact of cyberbullying victimization among university students in Myanmar: A cross-sectional study
- Incidence of hospital-acquired pressure ulcers in patients with "minimal risk" according to the "Norton-MI" scale
- Intra-host symbiont diversity in eastern Pacific cold seep tubeworms identified by the 16S-V6 region, but undetected by the 16S-V4 region
- Lipoprotein(a) plasma levels are not associated with survival after acute coronary syndromes: An observational cohort study
- Use of Nanotrap particles for the capture and enrichment of Zika, chikungunya and dengue viruses in urine
- Pancreatic secretory trypsin inhibitor reduces multi-organ injury caused by gut ischemia/reperfusion in mice
- The effect of diet on the gastrointestinal microbiome of juvenile rehabilitating green turtles (Chelonia mydas)
- Biochemical characterization of Ty1 retrotransposon protease
- Lateral pressure equalisation as a principle for designing support surfaces to prevent deep tissue pressure ulcers
- Immunomodulatory function of the cystic fibrosis modifier gene BPIFA1
- The validation of the Beijing version of the Montreal Cognitive Assessment in Chinese patients undergoing hemodialysis
- All of gene expression (AOE): An integrated index for public gene expression databases
- Characterization of the visceral and neuronal phenotype of 4L/PS-NA mice modeling Gaucher disease
- Inflammasome expression is higher in ovarian tumors than in normal ovary
- HCV genotype profile in Brazil of mono-infected and HIV co-infected individuals: A survey representative of an entire country
- Engaging with change: Information and communication technology professionals’ perspectives on change at the mid-point in the UK/EU Brexit process
- Adherence to iron-folic acid supplement and associated factors among antenatal care attending pregnant mothers in governmental health institutions of Adwa town, Tigray, Ethiopia: Cross-sectional study
- Flower, seed, and fruit development in three Tunisian species of Polygonum: Implications for their taxonomy and evolution of distyly in Polygonaceae
- Development of a risk score for prediction of poor treatment outcomes among patients with multidrug-resistant tuberculosis
- Preclinical evaluation of AT-527, a novel guanosine nucleotide prodrug with potent, pan-genotypic activity against hepatitis C virus
- Aqueous extract from Mangifera indica Linn. (Anacardiaceae) leaves exerts long-term hypoglycemic effect, increases insulin sensitivity and plasma insulin levels on diabetic Wistar rats
- Marine seafood production via intense exploitation and cultivation in China: Costs, benefits, and risks
- Signatures of medical student applicants and academic success
- Discovery of Jogalong virus, a novel hepacivirus identified in a Culex annulirostris (Skuse) mosquito from the Kimberley region of Western Australia
- The effects of extended photoperiod and warmth on hair growth in ponies and horses at different times of year
- Modeling the effect of prolonged ethanol exposure on global gene expression and chromatin accessibility in normal 3D colon organoids
- Clinical, cytogenetic and molecular genetic characterization of a tandem fusion translocation in a male Holstein cattle with congenital hypospadias and a ventricular septal defect
- Severity of misophonia symptoms is associated with worse cognitive control when exposed to misophonia trigger sounds
- Detection of Torque Teno Virus (TTV) and TTV-Like Minivirus in patients with presumed infectious endophthalmitis in India
- CD4 rate of increase is preferred to CD4 threshold for predicting outcomes among virologically suppressed HIV-infected adults on antiretroviral therapy
- The evolution of secondary flow phenomena and their effect on primary shock conditions in shock tubes: Experimentation and numerical model
- Estimating the basic reproduction number of a pathogen in a single host when only a single founder successfully infects
- What drugs modify the risk of iatrogenic impulse-control disorders in Parkinson’s disease? A preliminary pharmacoepidemiologic study
- Evaluating emotional distress and health-related quality of life in patients with heart failure and their family caregivers: Testing dyadic dynamics using the Actor-Partner Interdependence Model
- Community- and trophic-level responses of soil nematodes to removal of a non-native tree at different stages of invasion
- Association of ECG parameters with late gadolinium enhancement and outcome in patients with clinical suspicion of acute or subacute myocarditis referred for CMR imaging
- Sonographic measurement of normal common bile duct diameter and associated factors at the University of Gondar comprehensive specialized hospital and selected private imaging center in Gondar town, North West Ethiopia
- Catchment-scale export of antibiotic resistance genes and bacteria from an agricultural watershed in central Iowa
- Impact of multi-drug resistant bacteria on economic and clinical outcomes of healthcare-associated infections in adults: Systematic review and meta-analysis
- Characterization of a universal screening approach for congenital CMV infection based on a highly-sensitive, quantitative, multiplex real-time PCR assay
- Proof-of-concept for a non-invasive, portable, and wireless device for cardiovascular monitoring in pediatric patients
- On PTV definition for glioblastoma based on fiber tracking of diffusion tensor imaging data
- Multiregional origins of the domesticated tetraploid wheats
- Racism against Totonaco women in Veracruz: Intercultural competences for health professionals are necessary
- Increased inflammation and endothelial markers in patients with late severe post-thrombotic syndrome
- Genes associated with body weight gain and feed intake identified by meta-analysis of the mesenteric fat from crossbred beef steers
- Intraoperative computed tomography imaging for dose calculation in intraoperative electron radiation therapy: Initial clinical observations
- Multiple paedomorphic lineages of soft-substrate burrowing invertebrates: parallels in the origin of Xenocratena and Xenoturbella
- Human lung epithelial BEAS-2B cells exhibit characteristics of mesenchymal stem cells
- Simple non-mydriatic retinal photography is feasible and demonstrates retinal microvascular dilation in Chronic Obstructive Pulmonary Disease (COPD)
- Evaluating poverty alleviation strategies in a developing country
- RNAmountAlign: Efficient software for local, global, semiglobal pairwise and multiple RNA sequence/structure alignment
- Maternal depressive symptoms and children’s cognitive development: Does early childcare and child’s sex matter?
- Pan-cancer analysis of somatic mutations and epigenetic alterations in insulated neighbourhood boundaries
- Evaluation of a bioengineered ACL matrix’s osteointegration with BMP-2 supplementation
- Psychosocial profiles of physical activity fluctuation in office employees: A latent profile analysis
- Prevalence and characteristics of Livestock-Associated Methicillin-Resistant Staphylococcus aureus (LA-MRSA) isolated from chicken meat in the province of Quebec, Canada
- HIV treatment response among female sex workers participating in a treatment as prevention demonstration project in Cotonou, Benin
- Soluble AXL as a marker of disease progression and survival in melanoma
- Using machine learning methods to determine a typology of patients with HIV-HCV infection to be treated with antivirals
- Quantifying tourism booms and the increasing footprint in the Arctic with social media data
- Gender differences influence over insomnia in Korean population: A cross-sectional study
- Impact of scion/rootstock reciprocal effects on metabolomics of fruit juice and phloem sap in grafted Citrus reticulata
- Adapting cognitive diagnosis computerized adaptive testing item selection rules to traditional item response theory
- Usability assessment of seven HIV self-test devices conducted with lay-users in Johannesburg, South Africa
- Autumn shifts in cold tolerance metabolites in overwintering adult mountain pine beetles
- Management of veterinary anaesthesia in small animals: A survey of current practice in Quebec
- Genetic structure of the European hedgehog (Erinaceus europaeus) in Denmark
- Molecular karyotyping of Siberian wild rye (Elymus sibiricus L.) with oligonucleotide fluorescence in situ hybridization (FISH) probes
- Umbilical cord separation time, predictors and healing complications in newborns with dry care
- The strain distribution in the lumbar anterior longitudinal ligament is affected by the loading condition and bony features: An in vitro full-field analysis
- Marine resource congestion in China: Identifying, measuring, and assessing its impact on sustainable development of the marine economy
- Analysis of attitudinal components towards statistics among students from different academic degrees
- Effects of fatigue induced by repeated-sprint on kicking accuracy and velocity in female soccer players
- A pre-clinical validation plan to evaluate analytical sensitivities of molecular diagnostics such as BD MAX MDR-TB, Xpert MTB/Rif Ultra and FluoroType MTB
- Leadership for success in transforming medical abortion policy in Canada
- Clinical correlates associated with the long-term response of bipolar disorder patients to lithium, valproate or lamotrigine: A retrospective study
- Determinants of change in long-acting or permanent contraceptives use in Ethiopia; A multivariate decomposition analysis of data from the Ethiopian demographic and health survey
- Forecasting stock prices with long-short term memory neural network based on attention mechanism
- On the genus Crossaster (Echinodermata: Asteroidea) and its distribution
- Intracellular and in vivo evaluation of imidazo[2,1-b]thiazole-5-carboxamide anti-tuberculosis compounds
- Serum amyloid P component promotes formation of distinct aggregated lysozyme morphologies and reduces toxicity in Drosophila flies expressing F57I lysozyme
- Optogenetically induced cellular habituation in non-neuronal cells
- An integrated vitamin E-coated polymer hybrid nanoplatform: A lucrative option for an enhanced in vitro macrophage retention for an anti-hepatitis B therapeutic prospect
- The effect of strontium and silicon substituted hydroxyapatite electrochemical coatings on bone ingrowth and osseointegration of selective laser sintered porous metal implants
- Modeling the Theory of Planned Behaviour to predict adherence to preventive dental visits in preschool children
- Molecular prevalence of Bartonella, Babesia, and hemotropic Mycoplasma species in dogs with hemangiosarcoma from across the United States
- Color discrimination and gas chromatography-mass spectrometry fingerprint based on chemometrics analysis for the quality evaluation of Schizonepetae Spica
- Comparisons of recurrence-free survival and overall survival between microwave versus radiofrequency ablation treatment for hepatocellular carcinoma: A multiple centers retrospective cohort study with propensity score matching
- Transcriptome-wide identification of novel circular RNAs in soybean in response to low-phosphorus stress
- Oral misoprostol, low dose vaginal misoprostol, and vaginal dinoprostone for labor induction: Randomized controlled trial
- The association between dietary patterns before and in early pregnancy and the risk of gestational diabetes mellitus (GDM): Data from the Malaysian SECOST cohort
- Gene expression noise in a complex artificial toxin expression system
- Dynamic Extreme Aneuploidy (DEA) in the vegetable pathogen Phytophthora capsici and the potential for rapid asexual evolution
- Assertive, trainable and older dogs are perceived as more dominant in multi-dog households
- Prediction of Uropathogens by Flow Cytometry and Dip-stick Test Results of Urine Through Multivariable Logistic Regression Analysis
- Accelerated brain aging towards transcriptional inversion in a zebrafish model of the K115fs mutation of human PSEN2
- Copper to Tuscany – Coals to Newcastle? The dynamics of metalwork exchange in early Italy
- The Brazilian TP53 mutation (R337H) and sarcomas
- Interleukin 6 is increased in preclinical HNSCC models of acquired cetuximab resistance, but is not required for maintenance of resistance
- Detection of amitraz resistance and reduced treatment efficacy in the Varroa Mite, Varroa destructor, within commercial beekeeping operations
- Impact of viral disease hypophagia on pig jejunal function and integrity
- Enzyme response of activated sludge to a mixture of emerging contaminants in continuous exposure
- Molecular evidence for horizontal transmission of chelonid alphaherpesvirus 5 at green turtle (Chelonia mydas) foraging grounds in Queensland, Australia
- Technology anxiety and resistance to change behavioral study of a wearable cardiac warming system using an extended TAM for older adults
- Evaluation and validation of 2D biomechanical models of the knee for radiograph-based preoperative planning in total knee arthroplasty
- Soil-Transmitted Helminth infections reduction in Bhutan: A report of 29 years of deworming
- Age-related differences in the temporal dynamics of spectral power during memory encoding
- cagA gene EPIYA motif genetic characterization from Colombian Helicobacter pylori isolates: Standardization of a molecular test for rapid clinical laboratory detection
- Mugharat an-Nachcharini: A specialized sheep-hunting camp reveals high-altitude habitats in the earliest Neolithic of the Central Levant
- Spectral characteristics of urine from patients with end-stage kidney disease analyzed using Raman Chemometric Urinalysis (Rametrix)
- Clinicians’ communication with patients receiving a MCI diagnosis: The ABIDE project
- Quantitative PCR provides a simple and accessible method for quantitative microbiota profiling
- Fast quantitative time lapse displacement imaging of endothelial cell invasion
- Two novel mutations in MSX1 causing oligodontia
- 7,200 years old constructions and mudbrick technology: The evidence from Tel Tsaf, Jordan Valley, Israel
- Tuberculosis recurrences and predictive factors in a vulnerable population in Catalonia
- Dome-shaped macula in children and adolescents
- Barriers in the access, diagnosis and treatment completion for tuberculosis patients in central and western Nepal: A qualitative study among patients, community members and health care workers
- Evaluation of KRAS, NRAS and BRAF mutations detection in plasma using an automated system for patients with metastatic colorectal cancer
- Targeted transcriptomic study of the implication of central metabolic pathways in mannosylerythritol lipids biosynthesis in Pseudozyma antarctica T-34
- Preliminary evidences of the presence of extracellular DNA single stranded forms in soil
- A comparison of quality of life between patients treated with different dialysis modalities in Taiwan
- The effectiveness of substance use interventions for homeless and vulnerably housed persons: A systematic review of systematic reviews on supervised consumption facilities, managed alcohol programs, and pharmacological agents for opioid use disorder
- Spatiotemporal characteristics and driving forces of construction land expansion in Yangtze River economic belt, China
- Comparison of Monocyte Distribution Width (MDW) and Procalcitonin for early recognition of sepsis
- Morphological association between the muscles and bones in the craniofacial region
- Transcriptome analysis of Actinidia chinensis in response to Botryosphaeria dothidea infection
- Evaluating two decision aids for Australian men supporting informed decisions about prostate cancer screening: A randomised controlled trial
- Serum galectins as potential biomarkers of inflammatory bowel diseases
- Linguistic Z-number weighted averaging operators and their application to portfolio selection problem
- Comparative study on skin protection activity of polyphenol-rich extract and polysaccharide-rich extract from Sargassum vachellianum
- Real-world data about emotional stress, disability and need for social care in a German IBD patient cohort
- The regenerative compatibility: A synergy between healthy ecosystems, environmental attitudes, and restorative experiences
- Fusion of augmented reality imaging with the endoscopic view for endonasal skull base surgery; a novel application for surgical navigation based on intraoperative cone beam computed tomography and optical tracking
- Functional characterization of NK cells in Mexican pediatric patients with acute lymphoblastic leukemia: Report from the Mexican Interinstitutional Group for the Identification of the Causes of Childhood Leukemia
- Radiomics signature for prediction of lateral lymph node metastasis in conventional papillary thyroid carcinoma
- Antenatal depression and its association with adverse birth outcomes in low and middle-income countries: A systematic review and meta-analysis
- Perceptions of risk and influences of choice in pregnant women with obesity. An evidence synthesis of qualitative research
- The role of refugee and migrant migration status on medication adherence: Mediation through illness perceptions
- Job stress and emotional exhaustion at work in Spanish workers: Does unhealthy work affect the decision to drive?
- Correction: Amphibians on the hotspot: Molecular biology and conservation in the South American Atlantic Rainforest
- Sexual risk classes among youth experiencing homelessness: Relation to childhood adversities, current mental symptoms, substance use, and HIV testing
- Time for change is now: Experiences of participants in a community-based approach for iron and folic acid supplementation in a rural county in Kenya, a qualitative study
- Non-invasive genetic monitoring for the threatened valley elderberry longhorn beetle
- Statistical learning for turboshaft helicopter accidents using logistic regression
- Vegetation change over seven years in the largest protected Pacific Northwest Bunchgrass Prairie remnant
- The effect of various metal-salts on the sedimentation of soil in a water-based suspension
- Using electronic health record system triggers to target delivery of a patient-centered intervention to improve venous thromboembolism prevention for hospitalized patients: Is there a differential effect by race?
- Effects of CK2β subunit down-regulation on Akt signalling in HK-2 renal cells
- Novel broad-spectrum activity-based probes to profile malarial cysteine proteases
- Health-related quality of life in cancer patients treated with immune checkpoint inhibitors: A systematic review on reporting of methods in randomized controlled trials
- Environmental tobacco smoke (ETS) and hyperlipidemia modified by perceived work stress
- Association between opioid analgesic therapy and initiation of buprenorphine management: An analysis of prescription drug monitoring program data
- Effect of a community-based approach of iron and folic acid supplementation on compliance by pregnant women in Kiambu County, Kenya: A quasi-experimental study
- Radiocarbon dating of two old African baobabs from India
- Improvement project in higher education institutions: A BPEP-based model
- An updated evaluation of serum sHER2, CA15.3, and CEA levels as biomarkers for the response of patients with metastatic breast cancer to trastuzumab-based therapies
- Genome-wide association study of metabolic syndrome in Korean populations
- The diagnostic accuracy of liver fibrosis in non-viral liver diseases using acoustic radiation force impulse elastography: A systematic review and meta-analysis
- Drug therapy problems and treatment satisfaction among ambulatory patients with epilepsy in a specialized hospital in Ethiopia
- Short- & long-term effects of monetary and non-monetary incentives to cooperate in public good games: An experiment
- Niche modeling reveals life history shifts in birds at La Brea over the last twenty millennia
- Morphological consequences of artificial cranial deformation: Modularity and integration
- Distributed flux balance analysis simulations of serial biomass fermentation by two organisms
- Plasma kynurenines and prognosis in patients with heart failure
- Occurrence and distribution of anthropogenic persistent organic pollutants in coastal sediments and mud shrimps from the wetland of central Taiwan
- Intensified visual clutter induces increased sympathetic signalling, poorer postural control, and faster torsional eye movements during visual rotation
- Restoration of cortical symmetry and binaural function: Cortical auditory evoked responses in adult cochlear implant users with single sided deafness
- A smartphone-enabled wireless and batteryless implantable blood flow sensor for remote monitoring of prosthetic heart valve function
- Gut microbiota composition alterations are associated with the onset of diabetes in kidney transplant recipients
- Shock index and TIMI risk index as valuable prognostic tools in patients with acute coronary syndrome complicated by cardiogenic shock
- Merit overrules theory of mind when young children share resources with others
- Economic burden of maternal morbidity – A systematic review of cost-of-illness studies
- Comparison of balance changes after inspiratory muscle or Otago exercise training
- Correction: Escherichia coli and Salmonella spp. isolated from Australian meat chickens remain susceptible to critically important antimicrobial agents
- Metabolic analysis of amino acids and vitamin B6 pathways in lymphoma survivors with cancer related chronic fatigue
- Cell-free DNA donor fraction analysis in pediatric and adult heart transplant patients by multiplexed allele-specific quantitative PCR: Validation of a rapid and highly sensitive clinical test for stratification of rejection probability
- Immunopathogenesis of canine chronic ulcerative stomatitis
- Correction: Quantification of speech and synchrony in the conversation of adults with autism spectrum disorder
- Efficacy and safety of ultrasonic circular cyclocoagulation with second-generation probe in glaucoma: A retrospective study
- Generalizing findings from a randomized controlled trial to a real-world study of the iLookOut, an online education program to improve early childhood care and education providers’ knowledge and attitudes about reporting child maltreatment
- Self-selection of food ingredients and agricultural by-products by the house cricket, Acheta domesticus (Orthoptera: Gryllidae): A holistic approach to develop optimized diets
- Machine learning detection of Atrial Fibrillation using wearable technology
- Comparative proteomic analysis of different stages of breast cancer tissues using ultra high performance liquid chromatography tandem mass spectrometer
- A cross-sectional study of psychopathy and khat abuse among prisoners in the correctional institution in Jimma, Ethiopia
- Head impulse compensatory saccades: Visual dependence is most evident in bilateral vestibular loss
- Complementarity of empirical and process-based approaches to modelling mosquito population dynamics with Aedes albopictus as an example—Application to the development of an operational mapping tool of vector populations
- Pepsin promotes laryngopharyngeal neoplasia by modulating signaling pathways to induce cell proliferation
- When and what to test for: A cost-effectiveness analysis of febrile illness test-and-treat strategies in the era of responsible antibiotic use
- Comparison of effects and safety in providing controlled hypotension during surgery between dexmedetomidine and magnesium sulphate: A meta-analysis of randomized controlled trials
- The gene encoding the ketogenic enzyme HMGCS2 displays a unique expression during gonad development in mice
- Seroepidemiological study of rubella in Vojvodina, Serbia: 24 years after the introduction of the MMR vaccine in the national immunization programme
- Efficacy of a mitochondrion-targeting agent for reducing the level of urinary protein in rats with puromycin aminonucleoside-induced minimal-change nephrotic syndrome
- Association of endothelial nitric oxide synthase (NOS3) gene polymorphisms with primary open-angle glaucoma in a Saudi cohort
- Antitrust analysis with upward pricing pressure and cost efficiencies
- Machine learning models for identifying preterm infants at risk of cerebral hemorrhage
- Natural selection contributes to food web stability
- Pyramiding QTLs controlling tolerance against drought, salinity, and submergence in rice through marker assisted breeding
- Diversity and plant growth-promoting functions of diazotrophic/N-scavenging bacteria isolated from the soils and rhizospheres of two species of Solanum
- Sustainability effects of motor control stabilisation exercises on pain and function in chronic nonspecific low back pain patients: A systematic review with meta-analysis and meta-regression
- Sofosbuvir-based regimen for genotype 2 HCV infected patients in Taiwan: A real world experience
- The virulence domain of Shigella IcsA contains a subregion with specific host cell adhesion function
- Sequencing artifacts derived from a library preparation method using enzymatic fragmentation
- Analysis of the Rdr1 gene family in different Rosaceae genomes reveals an origin of an R-gene cluster after the split of Rubeae within the Rosoideae subfamily
- Concomitant phytonutrient and transcriptome analysis of mature fruit and leaf tissues of tomato (Solanum lycopersicum L. cv. Oregon Spring) grown using organic and conventional fertilizer
- Quantitative analysis of adsorption and desorption of volatile organic compounds on reusable zeolite filters using gas chromatography
- Comparing bioinformatic pipelines for microbial 16S rRNA amplicon sequencing
- TMEM98 is a negative regulator of FRAT mediated Wnt/ß-catenin signalling
- Modeling migration patterns in the USA under sea level rise
- Quo vadis Pantanal? Expected precipitation extremes and drought dynamics from changing sea surface temperature
- Cloud-computing and machine learning in support of country-level land cover and ecosystem extent mapping in Liberia and Gabon
- An exploratory study on the quality of patient screening and counseling for hypertension management in Tanzania
- Relation of fibroblast growth factor receptor 2 expression to hepatocellular carcinoma recurrence after liver resection
- The Brief Measure of Emotional Preoperative Stress (B-MEPS) as a new predictive tool for postoperative pain: A prospective observational cohort study
- The impact of diabetes mellitus medication on the incidence of endogenous endophthalmitis
- Correction: Chl1 DNA helicase and Scc2 function in chromosome condensation through cohesin deposition
- Clinical and pathological features of thrombotic microangiopathy influencing long-term kidney transplant outcomes
- Multidisciplinary investigation of two Egyptian child mummies curated at the University of Tartu Art Museum, Estonia (Late/Graeco-Roman Periods)
- Occupational exposure to particulate matter from air pollution in the outdoor workplaces in Almaty during the cold season
- Morphological adjustment in free-living Steinernema feltiae infective juveniles to increasing concentration of Nemafric-BL phytonematicide
- Murine Surf4 is essential for early embryonic development
- Using mHealth to improve health care delivery in India: A qualitative examination of the perspectives of community health workers and beneficiaries
- Algorithmic handwriting analysis of the Samaria inscriptions illuminates bureaucratic apparatus in biblical Israel
- Key necroptotic proteins are required for Smac mimetic-mediated sensitization of cholangiocarcinoma cells to TNF-α and chemotherapeutic gemcitabine-induced necroptosis
- Concurrent lipidomics and proteomics on malignant plasma cells from multiple myeloma patients: Probing the lipid metabolome
- Short treatment with antalarmin alters adrenal gland receptors in the rat model of endometriosis
- Is it really always only the others who are to blame? GP’s view on medical overuse. A questionnaire study
- Serum visfatin and vaspin levels in hepatocellular carcinoma (HCC)
- Retraction: SDR9C7 Promotes Lymph Node Metastases in Patients with Esophageal Squamous Cell Carcinoma
- iTRAQ proteomics reveals the regulatory response to Magnaporthe oryzae in durable resistant vs. susceptible rice genotypes
- A smartphone-based test for the assessment of attention deficits in delirium: A case-control diagnostic test accuracy study in older hospitalised patients
- Association between tuberculosis and depression on negative outcomes of tuberculosis treatment: A systematic review and meta-analysis
- Incidence and predictors of loss to follow up among adult HIV patients on antiretroviral therapy in University of Gondar Comprehensive Specialized Hospital: A competing risk regression modeling
- Point-of-care diagnostic (POCD) method for detecting Bursaphelenchus xylophilus in pinewood using recombinase polymerase amplification (RPA) with the portable optical isothermal device (POID)
- Bioluminescent imaging of Arabidopsis thaliana using an enhanced Nano-lantern luminescence reporter system
- Biosynthetic pathway of indole-3-acetic acid in ectomycorrhizal fungi collected from northern Thailand
- Clinical implications of elevated serum interleukin-6 in IgG4-related disease
- Downscaling NLDAS-2 daily maximum air temperatures using MODIS land surface temperatures
- Sex-specific and opposite modulatory aspects revealed by PPI network and pathway analysis of ischemic stroke in humans
- Plasma Trimethylamine-N-oxide and impaired glucose regulation: Results from The Oral Infections, Glucose Intolerance and Insulin Resistance Study (ORIGINS)
- Self-esteem and other risk factors for depressive symptoms among adolescents in United Arab Emirates
- Control of the microsporidian parasite Nosema ceranae in honey bees (Apis mellifera) using nutraceutical and immuno-stimulatory compounds
- The effect of storage conditions on microbial communities in stool
- Role of donor genotype in RT-QuIC seeding activity of chronic wasting disease prions using human and bank vole substrates
- Influence of flow on phosphorus-dynamics and particle size in agricultural drainage ditch sediments
- A prospective, randomized, double-blind trial to compare body weight-adjusted and fixed doses of palonosetron for preventing postoperative nausea and vomiting in obese female patients
- Application of computerized 3D-CT texture analysis of pancreas for the assessment of patients with diabetes
- Predictive validation and forecasts of short-term changes in healthcare expenditure associated with changes in smoking behavior in the United States
- An information-based approach to handle various types of uncertainty in fuzzy bodies of evidence
- Oral magnesium supplementation for leg cramps in pregnancy—An observational controlled trial
- Health care professionals’ knowledge of commonly used sedative, analgesic and neuromuscular drugs: A single center (Rambam Health Care Campus), prospective, observational survey
- Campylobacter portucalensis sp. nov., a new species of Campylobacter isolated from the preputial mucosa of bulls
- OGG1 deficiency alters the intestinal microbiome and increases intestinal inflammation in a mouse model
- Transgenic interleukin 11 expression causes cross-tissue fibro-inflammation and an inflammatory bowel phenotype in mice
- Novel method to measure temporal windows based on eye movements during viewing of the Necker cube
- Whole blood transcriptomic analysis of beef cattle at arrival identifies potential predictive molecules and mechanisms that indicate animals that naturally resist bovine respiratory disease
- Effects of smoke flavoring using different wood chips and barbecuing on the formation of polycyclic aromatic hydrocarbons and heterocyclic aromatic amines in salmon fillets
- Sleep quality and sex modify the relationships between trait energy and fatigue on state energy and fatigue
- The role of peer, parental, and school norms in predicting adolescents’ attitudes and behaviours of majority and different minority ethnic groups in Croatia
- Filtered beauty in Oslo and Tokyo: A spatial frequency analysis of facial attractiveness
- The impact of rehabilitation frequency on the risk of stroke in patients with rheumatoid arthritis
- Availability, prices and affordability of selected antibiotics and medicines against non-communicable diseases in western Cameroon and northeast DR Congo
- The effect of mutations derived from mouse-adapted H3N2 seasonal influenza A virus to pathogenicity and host adaptation
- Detection of posttraumatic pneumothorax using electrical impedance tomography—An observer-blinded study in pigs with blunt chest trauma
- Educators’ perceptions of organisational readiness for implementation of a pre-adolescent transdisciplinary school health intervention for inter-generational outcomes
- Beyond the heterodimer model for mineralocorticoid and glucocorticoid receptor interactions in nuclei and at DNA
- The effects of sport expertise and shot results on basketball players’ action anticipation
- Framework and algorithms for identifying honest blocks in blockchain
- Efficacy and safety of anti-viral therapy for Hepatitis B virus-associated glomerulonephritis: A meta-analysis
- Selective transmission of some HIV-1 subtype C variants might depend on Envelope stimulating dendritic cells to secrete IL-10
- Noise reduction and quantification of fiber orientations in greyscale images
- Exploring the impact of terminology differences in blood and organ donor decision making
- Ontogenetic similarities between giraffe and sauropod neck osteological mobility
- Load transfer mechanism and critical length of anchorage zone for anchor bolt
- Income inequalities in stroke incidence and mortality: Trends in stroke-free and stroke-affected life years based on German health insurance data
- Community’s perception, experiences and health seeking behavior towards newborn illnesses in Debre Libanos District, North Shoa, Oromia, Ethiopia: Qualitative study
- Platelet indices significantly correlate with liver fibrosis in HCV-infected patients
- Reanalysis of the Bridge et al. study of suicide following release of 13 Reasons Why
- Validation of the easyscreen flavivirus dengue alphavirus detection kit based on 3base amplification technology and its application to the 2016/17 Vanuatu dengue outbreak
- The nitrate content of fresh and cooked vegetables and their health-related risks
- Bioreactor for mobilization of mesenchymal stem/stromal cells into scaffolds under mechanical stimulation: Preliminary results
- Serotonin transporter dependent modulation of food-seeking behavior
- Implicit task switching in Parkinson’s disease is preserved when on medication
- Root treatment with oxathiapiprolin, benthiavalicarb or their mixture provides prolonged systemic protection against oomycete foliar pathogens
- Real-world effectiveness and safety of ranibizumab for the treatment of myopic choroidal neovascularization: Results from the LUMINOUS study
- Non-gradient and genotype-dependent patterns of RSV gene expression
- Multiplex real-time PCR for the detection of Clavibacter michiganensis subsp. michiganensis, Pseudomonas syringae pv. tomato and pathogenic Xanthomonas species on tomato plants
- The 24-hour urinary cortisol in post-traumatic stress disorder: A meta-analysis
- Parasites modulate the gut-microbiome in insects: A proof-of-concept study
- The dynamics of shapes of vesicle membranes with time dependent spontaneous curvature
- Vascularization and biocompatibility of poly(ε-caprolactone) fiber mats for rotator cuff tear repair
- The shield of self-compassion: A buffer against disordered eating risk from physical appearance perfectionism
- Disease-specific out-of-pocket healthcare expenditure in urban Bangladesh: A Bayesian analysis
- Advanced biofilm analysis in streams receiving organic deicer runoff
- Upregulation of long non-coding RNA ROR1-AS1 promotes cell growth and migration in bladder cancer by regulation of miR-504
- Method development and validation for rapid identification of epigallocatechin gallate using ultra-high performance liquid chromatography
- Neonatal sepsis in Iran: A systematic review and meta-analysis on national prevalence and causative pathogens
- Drug-eluting versus bare-metal stents for first myocardial infarction in patients with atrial fibrillation: A nationwide population-based cohort study
- Same-day antiretroviral therapy initiation for HIV-infected adults in South Africa: Analysis of routine data
- Health-related quality of life among patients with type 2 diabetes mellitus in Eastern Province, Saudi Arabia: A cross-sectional study
- Photocatalytic biocidal effect of copper doped TiO2 nanotube coated surfaces under laminar flow, illuminated with UVA light on Legionella pneumophila
- The interoceptive hippocampus: Mouse brain endocrine receptor expression highlights a dentate gyrus (DG)–cornu ammonis (CA) challenge–sufficiency axis
- Educational attainment and HIV testing and counselling service utilisation during antenatal care in Ghana: Analysis of Demographic and Health Surveys
- Dissection of flag leaf metabolic shifts and their relationship with those occurring simultaneously in developing seed by application of non-targeted metabolomics
- Centromeres of Cucumis melo L. comprise Cmcent and two novel repeats, CmSat162 and CmSat189
- Acute high-intensity and moderate-intensity interval exercise do not change corticospinal excitability in low fit, young adults
- “I like the way I am, but I feel like I could get a little bit bigger”: Perceptions of body image among adolescents and youth living with HIV in Durban, South Africa
- Nanoparticle-based ‘turn-on’ scattering and post-sample fluorescence for ultrasensitive detection of water pollution in wider window
- The relationship of moral sensitivity and patient safety attitudes with nursing students’ perceptions of disclosure of patient safety incidents: A cross-sectional study
- Insights into the strategy of micro-environmental adaptation: Transcriptomic analysis of two alvinocaridid shrimps at a hydrothermal vent
- Thirty-day readmission after medical-surgical hospitalization for people who experience imprisonment in Ontario, Canada: A retrospective cohort study
- The effect of long-term brine discharge from desalination plants on benthic foraminifera
- Hyper-spectral response and estimation model of soil degradation in Kenli County, the Yellow River Delta
- Prescribing trends of glaucoma drugs in six major cities of China from 2013 to 2017
- Significant changes in synovial fluid microRNAs after high tibial osteotomy in medial compartmental knee osteoarthritis: Identification of potential prognostic biomarkers
- Reassortment and adaptive mutations of an emerging avian influenza virus H7N4 subtype in China
- Ischemia and reperfusion injury in superficial inferior epigastric artery-based vascularized lymph node flaps
- High failure rates of protease inhibitor-based antiretroviral treatment in rural Tanzania – A prospective cohort study
- Switchable resolution in soft x-ray tomography of single cells
- Mitochondrial DNA variations and mitochondrial dysfunction in Fanconi anemia
- Extended-spectrum beta-lactamase (ESBL)-producing and non-ESBL-producing Escherichia coli isolates causing bacteremia in the Netherlands (2014 – 2016) differ in clonal distribution, antimicrobial resistance gene and virulence gene content
- Molecular characterization of blaKHM-1 encoding plasmid in an Enterobacter hormaechei subsp. hoffmannii isolate from blood culture
- PR3 levels are impaired in plasma and PBMCs from Arabs with cardiovascular diseases
- Sex differences in self-regulation in early, middle and late adolescence: A large-scale cross-sectional study
- Interaction between elevated temperature and different types of Na-salicylate treatment in Brachypodium dystachion
- A highway crash risk assessment method based on traffic safety state division
- A brain connectivity characterization of children with different levels of mathematical achievement based on graph metrics
- Quantifying the level of difficulty to treat major depressive disorder with antidepressants: Treatment Resistance to Antidepressants Evaluation Scale
- Occupational gender segregation and economic growth in U.S. local labor markets, 1980 through 2010
- The association of telomere length and telomerase activity with adverse outcomes in older patients with non-ST-elevation acute coronary syndrome
- Construction of a high-density genetic map and fine mapping of a candidate gene locus for a novel branched-spike mutant in barley
- Alterations of aqueous humor Aβ levels in Aβ-infused and transgenic mouse models of Alzheimer disease
- Parameters impacting the live birth rate per transfer after frozen single euploid blastocyst transfer
- Deep2Full: Evaluating strategies for selecting the minimal mutational experiments for optimal computational predictions of deep mutational scan outcomes
- Economic compensation interventions to increase uptake of voluntary medical male circumcision for HIV prevention: A systematic review and meta-analysis
- Distinctive effect of anesthetics on the effect of limb remote ischemic postconditioning following ischemic stroke
- Natural hybridization between Phyllagathis and Sporoxeia species produces a hybrid without reproductive organs
- Preliminary evaluation of a novel nine-biomarker profile for the prediction of autism spectrum disorder
- The impact of peer attachment on prosocial behavior, emotional difficulties and conduct problems in adolescence: The mediating role of empathy
- Spatial and climatic variables independently drive elevational gradients in ant species richness in the Eastern Himalaya
- What is the qualitative evidence concerning the risks, diagnosis, management and consequences of gastrointestinal infections in the community in the United Kingdom? A systematic review and meta-ethnography
- Naringenin protects AlCl3/D-galactose induced neurotoxicity in rat model of AD via attenuation of acetylcholinesterase levels and inhibition of oxidative stress
- Key barriers and enablers associated with uptake and continuation of oral pre-exposure prophylaxis (PrEP) in the public sector in Zimbabwe: Qualitative perspectives of general population clients at high risk for HIV
- Characterizing the University of California’s tenure-track teaching position from the faculty and administrator perspectives
- Restoration of Mal overcomes the defects of apoptosis in lung cancer cells
- Patient preferences for maintenance therapy in Crohn’s disease: A discrete-choice experiment
- Diagnostic performance of serum interferon gamma, matrix metalloproteinases, and periostin measurements for pulmonary tuberculosis in Japanese patients with pneumonia
- Hesperidin improves insulin resistance via down-regulation of inflammatory responses: Biochemical analysis and in silico validation
- Accuracy of intraocular lens power calculation formulas using a swept-source optical biometer
- Characterization of black patina from the Tiber River embankments using Next-Generation Sequencing
- Comparison of blood lactate and perceived exertion responses in two matched time-under-tension protocols
- Fibrin hydrogels are safe, degradable scaffolds for sub-retinal implantation
- Post-translational modifications of Drosophila melanogaster HOX protein, Sex combs reduced
- Problem gambling, associations with comorbid health conditions, substance use, and behavioural addictions: Opportunities for pathways to treatment
- Liganded T3 receptor β2 inhibits the positive feedback autoregulation of the gene for GATA2, a transcription factor critical for thyrotropin production
- Characterization of METTL16 as a cytoplasmic RNA binding protein
- Impact of long-term storage and freeze-thawing on eight circulating microRNAs in plasma samples
- Nanosheet wrapping-assisted coverslip-free imaging for looking deeper into a tissue at high resolution
- Assessment of dynamic cerebral autoregulation in humans: Is reproducibility dependent on blood pressure variability?
- Early diagnosis of sepsis in emergency departments, time to treatment, and association with mortality: An observational study
- Validity of cerebrovascular ICD-9-CM codes in healthcare administrative databases. The Umbria Data-Value Project
- Tuberculoid leprosy: An in vivo microvascular evaluation of cutaneous lesions
- Neuromuscular blockers in the acute respiratory distress syndrome: A meta-analysis
- Identification of putative Type-I sex pheromone biosynthesis-related genes expressed in the female pheromone gland of Streltzoviella insularis
- Redefining transcriptional regulation of the APOE gene and its association with Alzheimer’s disease
- Disease-relevant mutations alter amino acid co-evolution networks in the second nucleotide binding domain of CFTR
- A bushel of viruses: Identification of seventeen novel putative viruses by RNA-seq in six apple trees
- Torque teno virus viral load is related to age, CMV infection and HLA type but not to Alzheimer's disease
- The variability of bacterial communities in both the endosphere and ectosphere of different niches in Chinese chives (Allium tuberosum)
- Tripartite factors leading to molecular divergence between human and murine smooth muscle
- Characterization of dermal skin innervation in fibromyalgia syndrome
- A neonatal nonhuman primate model of gestational Zika virus infection with evidence of microencephaly, seizures and cardiomyopathy
- A scoping review of importation and predictive models related to vector-borne diseases, pathogens, reservoirs, or vectors (1999–2016)
- Assessment of climate change impact on the malaria vector Anopheles hyrcanus, West Nile disease, and incidence of melanoma in the Vojvodina Province (Serbia) using data from a regional climate model
- Associations of cigarette smoking and burden of thoracic aortic calcification in asymptomatic individuals: A dose-response relationship
- Healthcare utilization of Mexican-American Medicare beneficiaries with and without Alzheimer’s disease and related dementias
- Evaluation of questionnaire as an instrument to measure the level of nutritional and weight gain knowledge in pregnant women in Poland. A pilot study
- TranCEP: Predicting the substrate class of transmembrane transport proteins using compositional, evolutionary, and positional information
- Non-Invasive Functional-Brain-Imaging with an OPM-based Magnetoencephalography System
- Expression of acyl-CoA-binding protein 5 from Rhodnius prolixus and its inhibition by RNA interference
- Transforming assessment of speech in children with cleft palate via online crowdsourcing
- High prevalence of off-label and unlicensed paediatric prescribing in a hospital in Indonesia during the period Aug.—Oct. 2014
- General practice management of rotator cuff related shoulder pain: A reliance on ultrasound and injection guided care
- Estimating the population size of female sex workers and transgender women in Sri Lanka
- Can helmet decrease mortality of craniocerebral trauma patients in a motorcycle accident?: A propensity score matching
- Obesity, smoking habits, and serum phosphate levels predicts mortality after life-style intervention
- Treatment of children under 4 years of age with medulloblastoma and ependymoma in the HIT2000/HIT-REZ 2005 trials: Neuropsychological outcome 5 years after treatment
- Can a semi-quantitative method replace the current quantitative method for the annual screening of microalbuminuria in patients with diabetes? Diagnostic accuracy and cost-saving analysis considering the potential health burden
- A two-arm parallel double-blind randomised controlled pilot trial of the efficacy of Omega-3 polyunsaturated fatty acids for the treatment of women with endometriosis-associated pain (PurFECT1)
- Association of benzodiazepines, opioids and tricyclic antidepressants use and falls in trauma patients: Conditional effect of age
- Burden and risk factors of cutaneous leishmaniasis in a peri-urban settlement in Kenya, 2016
- Predicting strike susceptibility and collision patterns of the common buzzard at wind turbine structures in the federal state of Brandenburg, Germany
- Embryonic thermal manipulation has short and long-term effects on the development and the physiology of the Japanese quail
- High-order radiomics features based on T2 FLAIR MRI predict multiple glioma immunohistochemical features: A more precise and personalized gliomas management
- Human-raptor conflict in rural settlements of Colombia
- Regional adaptations and parallel mutations in Feline panleukopenia virus strains from China revealed by nearly-full length genome analysis
- Long-term ecological research in southern Brazil grasslands: Effects of grazing exclusion and deferred grazing on plant and arthropod communities
- Assessment of peritoneal microbial features and tumor marker levels as potential diagnostic tools for ovarian cancer
- Survival analysis of 230 patients with unresectable hepatocellular carcinoma treated with bland transarterial embolization
- Adverse drug reaction reporting practice and associated factors among medical doctors in government hospitals in Addis Ababa, Ethiopia
- TaWAK6 encoding wall-associated kinase is involved in wheat resistance to leaf rust similar to adult plant resistance
- Deficiency syndromes in top predators associated with large-scale changes in the Baltic Sea ecosystem
- The inhibitor of apoptosis proteins antagonist Debio 1143 promotes the PD-1 blockade-mediated HIV load reduction in blood and tissues of humanized mice
- Allele specific expression of Dof genes responding to hormones and abiotic stresses in sugarcane
- Perceived relative social status and cognitive load influence acceptance of unfair offers in the Ultimatum Game
- Quantitative evaluation of choriocapillaris using optical coherence tomography and optical coherence tomography angiography in patients with central serous chorioretinopathy after half-dose photodynamic therapy
- Structure-function analyses of candidate small molecule RPN13 inhibitors with antitumor properties
- Extracting lung function measurements to enhance phenotyping of chronic obstructive pulmonary disease (COPD) in an electronic health record using automated tools
- Multiple fragmented habitat-patch use in an urban breeding passerine, the Short-toed Treecreeper
- Histological and immunohistochemical characterization of the porcine ocular surface
- Household environmental tobacco smoke exposure in healthy young children in Hong Kong: Prevalence and risk factors
- Wind energy development and wildlife conservation in Lithuania: A mapping tool for conflict assessment
- Characteristics and prognosis of primary treatment-naïve oral cavity squamous cell carcinoma in Norway, a descriptive retrospective study
- Effect of epoch length on intensity classification and on accuracy of measurement under controlled conditions on treadmill: Towards a better understanding of accelerometer measurement
- Peer distribution of HIV self-test kits to men who have sex with men to identify undiagnosed HIV infection in Uganda: A pilot study
- Error rates of human reviewers during abstract screening in systematic reviews
- Faecal analyses and alimentary tracers reveal the foraging ecology of two sympatric bats
- Urethral realignment with maximal urethral length and bladder neck preservation in robot-assisted radical prostatectomy: Urinary continence recovery
- Error metrics determination in functionally approximated circuits using SAT solvers
- Spatial movement pattern recognition in soccer based on relative player movements
- A novel visual ranking system based on arterial spin labeling perfusion imaging for evaluating perfusion disturbance in patients with ischemic stroke
- Prospective Validation of the Laboratory Risk Indicator for Necrotizing Fasciitis (LRINEC) Score for Necrotizing Fasciitis of the Extremities
- The importance of transporters and cell polarization for the evaluation of human stem cell-derived hepatic cells
- Incidence, trends, and outcomes of infection sites among hospitalizations of sepsis: A nationwide study
- Morphological and functional characteristics of mitral annular calcification and their relationship to stroke
- And the nominees are: Using design-awards datasets to build computational aesthetic evaluation model
- Service delivery interventions to increase uptake of voluntary medical male circumcision for HIV prevention: A systematic review
- Multidimensional Scales of Perceived Self-Efficacy (MSPSE): Measurement invariance across Italian and Colombian adolescents
- Diversity of Mycobacteriaceae from aquatic environment at the São Paulo Zoological Park Foundation in Brazil
- A graph-based algorithm for RNA-seq data normalization
- Parents’ underestimation of their child’s weight status. Moderating factors and change over time: A cross-sectional study
- Pharmacokinetics, absolute bioavailability and tolerability of ketamine after intranasal administration to dexmedetomidine sedated dogs
- Spatial variation in fertilizer prices in Sub-Saharan Africa
- Knowledge, beliefs, and concerns about bone health from a systematic review and metasynthesis of qualitative studies
- Successful isolation of Treponema pallidum strains from patients’ cryopreserved ulcer exudate using the rabbit model
- Effects of size and elasticity on the relation between flow velocity and wall shear stress in side-wall aneurysms: A lattice Boltzmann-based computer simulation study
- Pupil response to noxious corneal stimulation
- Incidence, risk factors and healthcare costs of central line-associated nosocomial bloodstream infections in hematologic and oncologic patients
- The impact of computed radiography and teleradiology on patients’ diagnosis and treatment in Mweso, the Democratic Republic of Congo
- Differential effects of synthetic psychoactive cathinones and amphetamine stimulants on the gut microbiome in mice
- Hepatitis B and C virus infection among HIV patients within the public and private healthcare systems in Chile: A cross-sectional serosurvey
- Increased episodes of aspiration on videofluoroscopic swallow study in children with nasogastric tube placement
- Obstructive sleep apnea and hypopnea syndrome in patients admitted in a tertiary hospital in Cameroon: Prevalence and associated factors
- Association of single nucleotide polymorphisms with dyslipidemia in antiretroviral exposed HIV patients in a Ghanaian population: A case-control study
- Sonic Hedgehog upregulation does not enhance the survival and engraftment of stem cell-derived cardiomyocytes in infarcted hearts
- The pharmacokinetic parameters and the effect of a single and repeated doses of memantine on gastric myoelectric activity in experimental pigs
- Blind method for discovering number of clusters in multidimensional datasets by regression on linkage hierarchies generated from random data
- Predictive factors of first dosage intravenous immunoglobulin-related adverse effects in children
- Description and characterization of the artisanal elasmobranch fishery on Guatemala’s Caribbean coast
- Individual and community level determinants of short birth interval in Ethiopia: A multilevel analysis
- Effects of rejection intensity and rejection sensitivity on social approach behavior in women
- The impact of IoT security labelling on consumer product choice and willingness to pay
- The development and validation of a measurement instrument to investigate determinants of health care utilisation for low back pain in Ethiopia
- Validity of the French version of the Autonomy Preference Index and its adaptation for patients with advanced cancer
- The epidemiological characteristics and spatio-temporal analysis of childhood hand, foot and mouth disease in Korea, 2011-2017
- Exponential random graph model parameter estimation for very large directed networks
- The implementation of community-based diabetes and hypertension management care program in Indonesia
- Effect of temperature variation on hospital admissions and outcomes in dogs with myxomatous mitral valve disease and new onset pulmonary edema
- The development of the Police Practices Scale: Understanding policing approaches towards street-based female sex workers in a U.S. City
- A capability approach to assess aquaculture sustainability standard compliance
- Pre-collecting lymphatic vessels form detours following obstruction of lymphatic flow and function as collecting lymphatic vessels
- Construct validity and reliability of the Talent Development Environment Questionnaire in Caribbean youth track and field athletes
- Optimization of cytotoxic activity of Nocardia sp culture broths using a design of experiments
- Tissue-resident macrophages can be generated de novo in adult human skin from resident progenitor cells during substance P-mediated neurogenic inflammation ex vivo
- Microbiota in foods from Inuit traditional hunting
- Investigating Italian disinformation spreading on Twitter in the context of 2019 European elections
- In vivo expression of peptidylarginine deiminase in Drosophila melanogaster
- Modelling zero-truncated overdispersed antenatal health care count data of women in Bangladesh
- Detection and density of breeding marsh birds in Iowa wetlands
- A lineage-specific rapid diagnostic test (Chagas Sero K-SeT) identifies Brazilian Trypanosoma cruzi II/V/VI reservoir hosts among diverse mammalian orders
- Aromatase deficiency in hematopoietic cells improves glucose tolerance in male mice through skeletal muscle-specific effects
- If host is refractory, insistent parasite goes berserk: Trypanosomatid Blastocrithidia raabei in the dock bug Coreus marginatus
- Antimicrobial resistance patterns and molecular resistance markers of Campylobacter jejuni isolates from human diarrheal cases
- Protective role of brain derived neurotrophic factor (BDNF) in obstructive sleep apnea syndrome (OSAS) patients
- An IL-18-centered inflammatory network as a biomarker for cerebral white matter injury
- Prevalence of antiphospholipid antibodies in Behçet's disease: A systematic review and meta-analysis
- Chemical analysis of snus products from the United States and northern Europe
- Effect of prednisolone on glyoxalase 1 in an inbred mouse model of aristolochic acid nephropathy using a proteomics method with fluorogenic derivatization-liquid chromatography-tandem mass spectrometry
- Impact of early-onset persistent stunting on cognitive development at 5 years of age: Results from a multi-country cohort study
- Aggregation of CAT tails blocks their degradation and causes proteotoxicity in S. cerevisiae
- Expression of concern: Compensatory increase of transglutaminase 2 is responsible for resistance to mTOR inhibitor treatment
- Common mental illness among epilepsy patients in Bahir Dar city, Ethiopia: A cross-sectional study
- Staging dementia based on caregiver reported patient symptoms: Implications from a latent class analysis
- Health-related quality of life and its determinants among ambulatory patients with epilepsy at Ambo General Hospital, Ethiopia: Using WHOQOL-BREF
- In silico analysis and high-risk pathogenic phenotype predictions of non-synonymous single nucleotide polymorphisms in human Crystallin beta A4 gene associated with congenital cataract
- Fungal diversity in canopy soil of silver beech, Nothofagus menziesii (Nothofagaceae)
- Referral decisions and its predictors related to orthopaedic care. A retrospective study in a novel primary care setting
- Readiness to prescribe: Using educational design to untie the Gordian Knot
- Influence of gelation on the retention of purple cactus pear extract in microencapsulated double emulsions
- Factors related to met needs for rehabilitation 6 years after stroke
- Association of cataract and sun exposure in geographically diverse populations of India: The CASE study. First Report of the ICMR-EYE SEE Study Group
- Investigation of injury severity in urban expressway crashes: A case study from Beijing
- Clinical outcomes of incident peritoneal dialysis patients coming from kidney transplantation program: A case-control study
- Evaluation of the factors influencing the housing safety awareness of residents in Shanghai
- Morphometric study of the diaphragmatic surface of the liver in the human fetus
- Food insecurity and dietary diversity among lactating mothers in the urban municipality in the mountains of Nepal
- Genetic characterization of Bacillus anthracis strains circulating in Italy from 1972 to 2018
- Promising antifungal activity of new oxadiazole against Candida krusei
- An atlas of personality, emotion and behaviour
- Long-term effects of intracranial islet grafting on cognitive functioning in a rat metabolic model of sporadic Alzheimer's disease-like dementia
- Compartmentalized profiling of amniotic fluid cytokines in women with preterm labor
- Comparison of the myometrial transcriptome from singleton and twin pregnancies by RNA-Seq
- Adverse reproductive effects of S100A9 on bovine sperm and early embryonic development in vitro
- Functional dynamics of bacterial species in the mouse gut microbiome revealed by metagenomic and metatranscriptomic analyses
- Astrocyte senescence promotes glutamate toxicity in cortical neurons
- Primary ciliary dyskinesia and psychological well-being in adolescence
- Dipeptidyl peptidase-4 is increased in the abdominal aortic aneurysm vessel wall and is associated with aneurysm disease processes
- Primary care physician knowledge, attitudes, and diagnostic testing practices for norovirus and acute gastroenteritis
- Microfluidic-prepared DOTAP nanoparticles induce strong T-cell responses in mice
- Intraocular scattering as a predictor of driving performance in older adults with cataracts
- Reduced bone mineral density among HIV infected patients on anti-retroviral therapy in Blantyre, Malawi: Prevalence and associated factors
- Correction: Extraversion personality, perceived health and activity participation among community-dwelling aging adults in Hong Kong
- A rainwater control optimization design approach for airports based on a self-organizing feature map neural network model
- Influence of inflammasome NLRP3, and IL1B and IL2 gene polymorphisms in periodontitis susceptibility
- 18F-FDG-PET/MRI in the diagnostic work-up of limbic encephalitis
- The socioeconomic impact of orthopaedic trauma: A systematic review and meta-analysis
- Treatment patterns among patients with moderate-to-severe ulcerative colitis in the United States and Europe
- City to city learning and knowledge exchange for climate resilience in southern Africa
- Nuclear translocation of Atox1 potentiates activin A-induced cell migration and colony formation in colon cancer
- Activity-dependent switches between dynamic regimes of extracellular matrix expression
- Molecular sequencing and morphological identification reveal similar patterns in native bee communities across public and private grasslands of eastern North Dakota
- A mathematical model for assessing the effectiveness of controlling relapse in Plasmodium vivax malaria endemic in the Republic of Korea
- Cryo-focused ion beam preparation of perovskite based solar cells for atom probe tomography
- Physiological and transcriptomic responses of Lanzhou Lily (Lilium davidii, var. unicolor) to cold stress
- Unusual genome expansion and transcription suppression in ectomycorrhizal Tricholoma matsutake by insertions of transposable elements
- Estimating associations between antidepressant use and incident mild cognitive impairment in older adults with depression
- The use of telephone communication between nurse navigators and their patients
- CNP mediated selective toxicity on melanoma cells is accompanied by mitochondrial dysfunction
- HIV RNA measurement in dried blood spots of HIV-infected patients in Thailand using Abbott m2000 system
- Retraction: Oncogenic Fibulin-5 Promotes Nasopharyngeal Carcinoma Cell Metastasis through the FLJ10540/AKT Pathway and Correlates with Poor Prognosis
- Ultra-rapid cooling of ibex sperm by spheres method does not induce a vitreous extracellular state and increases the membrane damages
- Some animals are more equal than others: Validation of a new scale to measure how attitudes to animals depend on species and human purpose of use
- Observation and quantification of the morphological effect of trypan blue rupturing dead or dying cells
- The visual perception of emotion from masks
- Hexavalent chromium removal and total chromium biosorption from aqueous solution by Quercus crassipes acorn shell in a continuous up-flow fixed-bed column: Influencing parameters, kinetics, and mechanism
- The predictive value of anthropometric indices for cardiometabolic risk factors in Chinese children and adolescents: A national multicenter school-based study
- Lean back and wait for the alarm? Testing an automated alarm system for nosocomial outbreaks to provide support for infection control professionals
- Regional disparities in health care resources in traditional Chinese medicine county hospitals in China
- Analysis on hydraulic characteristics of improved sandy soil with soft rock
- Development and use of a scale to assess gender differences in appraisal of mistreatment during childbirth among Ethiopian midwifery students
- Factors for starting biosimilar TNF inhibitors in patients with rheumatic diseases in the real world
- Correction: Force field generalization and the internal representation of motor learning
- Prevalence and foetomaternal effects of iron deficiency anaemia among pregnant women in Lagos, Nigeria
- Socioeconomic risk factors for fatal opioid overdoses in the United States: Findings from the Mortality Disparities in American Communities Study (MDAC)
- Microbiome signatures in neonatal central line associated bloodstream infections
- Interventions for incarcerated adults with opioid use disorder in the United States: A systematic review with a focus on social determinants of health
- Opening gap width influences distal tibial rotation below the osteotomy site following open wedge high tibial osteotomy
- The impact of lowbush blueberry (Vaccinium angustifolium Ait.) and cranberry (Vaccinium macrocarpon Ait.) pollination on honey bee (Apis mellifera L.) colony health status
- Surveys of knowledge and awareness of antibiotic use and antimicrobial resistance in general population: A systematic review
- Managerial capacity among district health managers and its association with district performance: A comparative descriptive study of six districts in the Eastern Region of Ghana
- Knee joint distraction in regular care for treatment of knee osteoarthritis: A comparison with clinical trial data
- Reconstruction of a regulated two-cell metabolic model to study biohydrogen production in a diazotrophic cyanobacterium Anabaena variabilis ATCC 29413
- Cochlear dysfunction is associated with styrene exposure in humans
- Intra-individual variation of particles in exhaled air and of the contents of Surfactant protein A and albumin
- Revisits, readmissions, and outcomes for pediatric traumatic brain injury in California, 2005-2014
- Enhanced handover mechanism using mobility prediction in wireless networks
- Association between regular exercise and asthma control among adults: The population-based Northern Finnish Asthma Study
- Pharyngeal microbiome alterations during Neisseria gonorrhoeae infection
- Assessment of the clinical utility of four NGS panels in myeloid malignancies. Suggestions for NGS panel choice or design
- Assessment of time management practice and associated factors among primary hospitals employees in north Gondar, northwest Ethiopia
- Genetic diversity and population structure of feral rapeseed (Brassica napus L.) in Japan
- Are the current gRNA ranking prediction algorithms useful for genome editing in plants?
- Difference between physical therapist estimation and psychological patient-reported outcome measures in patients with low back pain
- Heterogeneity in the distribution of 159 drug-response related SNPs in world populations and their genetic relatedness
- Metabolic and lipidomic profiling of steatotic human livers during ex situ normothermic machine perfusion guides resuscitation strategies
- Investigating cumulative effects of pre-performance routine interventions in beach volleyball serving
- Dispensing of antibiotics without prescription and associated factors in drug retail outlets of Eritrea: A simulated client method
- MicroRNA expression and DNA methylation profiles do not distinguish between primary and recurrent well-differentiated liposarcoma
- Assessment of acyl-CoA cholesterol acyltransferase (ACAT-1) role in ovarian cancer progression—An in vitro study
- Cytoplasmic factories, virus assembly, and DNA replication kinetics collectively constrain the formation of poxvirus recombinants
- The wavelet power spectrum of perfusion weighted MRI correlates with tumor vascularity in biopsy-proven glioblastoma samples
- Agreement between cardiovascular disease risk assessment tools: An application to the United Arab Emirates population
- Constructing HLM to examine multi-level poverty-contributing factors of farmer households: Why and how?
- Patterns of symptoms possibly indicative of cancer and associated help-seeking behaviour in a large sample of United Kingdom residents—The USEFUL study
- An automated alarm system for food safety by using electronic invoices
- Neural effects of acute stress on appetite: A magnetoencephalography study
- Use of magnetic resonance imaging to determine laterality of meniscal size in healthy volunteers
- Co-prevalence of extracranial carotid aneurysms differs between European intracranial aneurysm cohorts
- Thermal biology of two tropical lizards from the Ecuadorian Andes and their vulnerability to climate change
- When weight is an encumbrance; avoidance of stairs by different demographic groups
- Non-mycosis fungoides cutaneous lymphomas in a referral center in Taiwan: A retrospective case series and literature review
- From the host's point of view: Effects of variation in burying beetle brood care and brood size on the interaction with parasitic mites
- Kernel-based Gaussian process for anomaly detection in sparse gamma-ray data
- Unmet care needs of children with ADHD
- Accelerometer-assessed outdoor physical activity is associated with meteorological conditions among older adults: Cross-sectional results from the OUTDOOR ACTIVE study
- Identification of Korean cancer survivors’ unmet needs and desired psychosocial assistance: A focus group study
- Evaluation of inactivated Bordetella pertussis as a delivery system for the immunization of mice with Pneumococcal Surface Antigen A
- The role of moral reasoning & personality in explaining lyrical preferences
- Would you like to participate in this trial? The practice of informed consent in intrapartum research in the last 30 years
- Correction: Mutation spectrums of TSC1 and TSC2 in Chinese women with lymphangioleiomyomatosis (LAM)
- Forward lunge before and after anterior cruciate ligament reconstruction: Faster movement but unchanged knee joint biomechanics
- Challenges associated with homologous directed repair using CRISPR-Cas9 and TALEN to edit the DMD genetic mutation in canine Duchenne muscular dystrophy
- Integrated targeted serum metabolomic profile and its association with gender, age, disease severity, and pattern identification in acne
- A prospective case-control study on miRNA circulating levels in subjects born small for gestational age (SGA) evaluated from childhood into young adulthood
- Polymer-fiber-coupled field-effect sensors for label-free deep brain recordings
- Global depth perception alters local timing sensitivity
- How to detect a polytrauma patient at risk of complications: A validation and database analysis of four published scales
- Module for SWC neuron morphology file validation and correction enabled for high throughput batch processing
- Reduced gray matter volume and cortical thickness associated with traffic-related air pollution in a longitudinally studied pediatric cohort
- Recombinant human soluble thrombomodulin is associated with attenuation of sepsis-induced renal impairment by inhibition of extracellular histone release
- Human and climatic drivers affect spatial fishing patterns in a multiple-use marine protected area: The Galapagos Marine Reserve
- Correction: Leisure-time physical activity and sports in the Brazilian population: A social disparity analysis
- Application of the mixture item response theory model to the Self-Administered Food Security Survey Module for Children
- Numerical simulation of atmospheric CO2 concentration and flux over the Korean Peninsula using WRF-VPRM model during Korus-AQ 2016 campaign
- Feline irradiated diet-induced demyelination; a model of the neuropathology of sub-acute combined degeneration?
- Improved multi-parametric prediction of tissue outcome in acute ischemic stroke patients using spatial features
- Genome-wide association and epistatic interactions of flowering time in soybean cultivar
- Correction: Association between workplace bullying and burnout, professional quality of life, and turnover intention among clinical nurses
- Correction: Estimation of membrane bending modulus of stiffness tuned human red blood cells from micropore filtration studies
- Correction: Limited indirect effects of an infant pneumococcal vaccination program in an aging population
- Correction: Targeting of the Plzf Gene in the Rat by Transcription Activator-Like Effector Nuclease Results in Caudal Regression Syndrome in Spontaneously Hypertensive Rats
- Fieldwork-based determination of design priorities for point-of-use drinking water quality sensors for use in resource-limited environments
- Young women’s reproductive health conversations: Roles of maternal figures and clinical practices
- Correction: Differential recordings of local field potential: A genuine tool to quantify functional connectivity
- Survival of medial versus lateral unicompartmental knee arthroplasty: A meta-analysis
- Novel MscL agonists that allow multiple antibiotics cytoplasmic access activate the channel through a common binding site
- Is it time to stop sweeping data cleaning under the carpet? A novel algorithm for outlier management in growth data
- Changes in oak (Quercus robur) photosynthesis after winter moth (Operophtera brumata) herbivory are not explained by changes in chemical or structural leaf traits
- Mutual interaction between motor cortex activation and pain in fibromyalgia: EEG-fNIRS study
- Evaluation of liposomal ciprofloxacin formulations in a murine model of anthrax
- Analysis of cholesterol in mouse brain by HPLC with UV detection
- Sugar, amino acid and inorganic ion profiling of the honeydew from different hemipteran species feeding on Abies alba and Picea abies
- Exploring prior diseases associated with incident late-onset Alzheimer’s disease dementia
- Hypertension prevalence in patients attending tertiary pain management services, a registry-based Australian cohort study
- SRL pathogenicity island contributes to the metabolism of D-aspartate via an aspartate racemase in Shigella flexneri YSH6000
- Correction: Comprehensive genome-wide analysis of the pear (Pyrus bretschneideri) laccase gene (PbLAC) family and functional identification of PbLAC1 involved in lignin biosynthesis
- Epilepsy in a melanocyte-lineage mTOR hyperactivation mouse model: A novel epilepsy model
- Water consumption and prevalence of irritable bowel syndrome among adults
- Mixed evidence for the relationship between periodontitis and Alzheimer’s disease: A bidirectional Mendelian randomization study
- Correction: Health conditions associated with overweight in climacteric women
- Correction: Determining Glomerular Filtration Rate in Homozygous Sickle Cell Disease: Utility of Serum Creatinine Based Estimating Equations
- Modelling the number of antenatal care visits in Bangladesh to determine the risk factors for reduced antenatal care attendance
- Correction: Cumulative viral load as a predictor of CD4+ T-cell response to antiretroviral therapy using Bayesian statistical models
- Dominant negative effects by inactive Spa47 mutants inhibit T3SS function and Shigella virulence
- ICOS-deficient and ICOS YF mutant mice fail to control Toxoplasma gondii infection of the brain
- Diel patterns in swimming behavior of a vertically migrating deepwater shark, the bluntnose sixgill (Hexanchus griseus)
- Life history of northern Gulf of Mexico Warsaw grouper Hyporthodus nigritus inferred from otolith radiocarbon analysis
- Physiology education for intensive care medicine residents: A 15-minute interactive peer-led flipped classroom session
- Strengthening capacity for natural sciences research: A qualitative assessment to identify good practices, capacity gaps and investment priorities in African research institutions
- Systematic scoping review of the concept of ‘genetic identity’ and its relevance for germline modification
- Height of overburden fracture based on key strata theory in longwall face
- Laboratory strains of Bacillus anthracis lose their ability to rapidly grow and sporulate compared to wildlife outbreak strains
- Improvement of classification performance of Parkinson’s disease using shape features for machine learning on dopamine transporter single photon emission computed tomography
- Comparative pharmacokinetics and pharmacodynamics of the advanced Retinol-Binding Protein 4 antagonist in dog and cynomolgus monkey
- Correction: A handy method to remove bacterial contamination from fungal cultures
- Correction: Effect of statin on life prognosis in Japanese patients undergoing hemodialysis
- Retraction: Outer Membrane Protein A (OmpA) of Shigella flexneri 2a Induces TLR2-Mediated Activation of B Cells: Involvement of Protein Tyrosine Kinase, ERK and NF-κB
- Retraction: Biofabrication of streptomycin-conjugated calcium phosphate nanoparticles using red ginseng extract and investigation of their antibacterial potential
- Receiver operating characteristic curve analysis of clinical signs for screening of convergence insufficiency in young adults
- Correction: Drivers of deforestation in the basin of the Usumacinta River: Inference on process from pattern analysis using generalised additive models
- Efficacy of fertilizing method for different potash sources in cotton (Gossypium hirsutum L.) nutrition under arid climatic conditions
- Podocyte autophagy is associated with foot process effacement and proteinuria in patients with minimal change nephrotic syndrome
- Effect of Lactobacillus acidophilus D2/CSL (CECT 4529) supplementation in drinking water on chicken crop and caeca microbiome
- Retraction: MiR-30a-5p Antisense Oligonucleotide Suppresses Glioma Cell Growth by Targeting SEPT7
- Correction: Dynamics of plasma micronutrient concentrations and their correlation with serum proteins and thyroid hormones in patients with paracoccidioidomycosis
- Impact of lower limb osteoarthritis on health-related quality of life: A cross-sectional study to estimate the expressed loss of utility in the Spanish population
- Correction: Prevalence of damaged and missing teeth among women in the southern plains of Nepal: Findings of a simplified assessment tool
- Correction: Tissue-Specific Expressed Antibody Variable Gene Repertoires
- Retraction: Immunoglobulin G Expression in Lung Cancer and Its Effects on Metastasis
- Correction: Causal knowledge promotes behavioral self-regulation: An example using climate change dynamics
- Retraction: Use of Granulocyte Colony-Stimulating Factor for the Treatment of Thin Endometrium in Experimental Rats
- Correction: Dynamic mechanical and nanofibrous topological combinatory cues designed for periodontal ligament engineering
- Correction: Evaluating the foundations that help avert antimicrobial resistance: Performance of essential water sanitation and hygiene functions in hospitals and requirements for action in Kenya
- From seed to flour: Sowing sustainability in the use of cantaloupe melon residue (Cucumis melo L. var. reticulatus)
- Core Scientific Dataset Model: A lightweight and portable model and file format for multi-dimensional scientific data
- Accounting for measurement error to assess the effect of air pollution on omic signals
- Leucine zipper transcription factor-like 1 binds adaptor protein complex-1 and 2 and participates in trafficking of transferrin receptor 1
- Barriers for tuberculosis case finding in Southwest Ethiopia: A qualitative study
- Genetic predisposition to celiac disease in Kazakhstan: Potential impact on the clinical practice in Central Asia
- A lower psoas muscle volume was associated with a higher rate of recurrence in male clear cell renal cell carcinoma
- Two angles of overqualification-the deviant behavior and creative performance: The role of career and survival job
- Cost-utility analysis of de-escalating biological disease-modifying anti-rheumatic drugs in patients with rheumatoid arthritis
- Efficient estimation of stereo thresholds: What slope should be assumed for the psychometric function?
- Learning efficient haptic shape exploration with a rigid tactile sensor array
- Effects of dietary supplementation with a microalga (Schizochytrium sp.) on the hemato-immunological, and intestinal histological parameters and gut microbiota of Nile tilapia in net cages
- Regional versus local wind speed and direction at a narrow beach with a high and steep foredune
- Fragmented QRS complex in patients with systemic lupus erythematosus at the time of diagnosis and its relationship with disease activity
- Severe thiamine deficiency in eastern Baltic cod (Gadus morhua)
- Transfer entropy as a variable selection methodology of cryptocurrencies in the framework of a high dimensional predictive model
- Psychometric validation of Czech version of the Sport Motivation Scale
- Correction: Multiple innate antibacterial immune defense elements are correlated in diverse ungulate species
- Recognition of personality disorder and anxiety disorder comorbidity in patients treated for depression in secondary psychiatric care
- Correction: Strategies for achieving high sequencing accuracy for low diversity samples and avoiding sample bleeding using illumina platform
- PLOS One
- Archiv čísel
- Aktuální číslo
- Informace o časopisu
Nejčtenější v tomto čísle- Severity of misophonia symptoms is associated with worse cognitive control when exposed to misophonia trigger sounds
- Chemical analysis of snus products from the United States and northern Europe
- Calcium dobesilate reduces VEGF signaling by interfering with heparan sulfate binding site and protects from vascular complications in diabetic mice
- Effect of Lactobacillus acidophilus D2/CSL (CECT 4529) supplementation in drinking water on chicken crop and caeca microbiome
Kurzy
Zvyšte si kvalifikaci online z pohodlí domova
Revma Focus: Spondyloartritidy
nový kurz
Autoři: doc. MUDr. Norbert Pauk, Ph.D.
Autoři: prof. MUDr. Vladimír Palička, CSc., Dr.h.c., doc. MUDr. Václav Vyskočil, Ph.D., MUDr. Petr Kasalický, CSc., MUDr. Jan Rosa, Ing. Pavel Havlík, Ing. Jan Adam, Hana Hejnová, DiS., Jana Křenková
Autoři: MUDr. Irena Krčmová, CSc.
Všechny kurzyPřihlášení#ADS_BOTTOM_SCRIPTS#Zapomenuté hesloZadejte e-mailovou adresu, se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.
- Vzdělávání