-
Články
Top novinky
Reklama- Vzdělávání
- Časopisy
Top články
Nové číslo
- Témata
Top novinky
Reklama- Kongresy
- Videa
- Podcasty
Nové podcasty
Reklama- Práce v oboru
Doporučené pozice
Reklama- Praktické
Top novinky
ReklamaHIV infection does not alter interferon α/β receptor 2 expression on mucosal immune cells
Authors: Julia Ickler aff001; Sandra Francois aff001; Marek Widera aff001; Mario L. Santiago aff002; Ulf Dittmer aff001; Kathrin Sutter aff001
Authors place of work: Institute for Virology, University Hospital Essen, University Duisburg-Essen, Essen, Germany aff001; Department of Medicine, University of Colorado Denver, Aurora, Colorado, United States of America aff002
Published in the journal: PLoS ONE 15(1)
Category: Research Article
doi: https://doi.org/10.1371/journal.pone.0218905Summary
The innate immune response induced by type I interferons (IFNs) plays a critical role in the establishment of HIV infection. IFNs are induced early in HIV infection and trigger an antiviral defense program by signaling through the IFNα/β receptor (IFNAR), which consists of two subunits, IFNAR1 and IFNAR2. Changes in IFNAR expression in HIV target cells, as well as other immune cells, could therefore have important consequences for initial HIV spread. It was previously reported that IFNAR2 expression is increased in peripheral blood CD4+ CXCR4+ T cells of HIV+ patients compared to HIV uninfected controls, suggesting that HIV infection may alter the IFN responsiveness of target cells. However, the earliest immune cells affected by HIV in vivo reside in the gut-associated lymphoid tissue (GALT). To date, it remains unknown if IFNAR expression is altered in GALT immune cells in the context of HIV infection and exposure to IFNs, including the 12 IFNα subtypes. Here, we analyzed the expression of surface bound and soluble IFNAR2 on Lamina propria mononuclear cells (LPMCs) isolated from the GALT of HIV- individuals and in plasma samples of HIV+ patients. IFNAR2 expression varied between different T cells, B cells and natural killer cells, but was not altered following HIV infection. Furthermore, expression of the soluble IFNAR2a isoform was not changed in HIV+ patients compared to healthy donors, nor in LPMCs after HIV-1 infection ex vivo. Even though the 12 human IFNα subtypes trigger different biological responses and vary in their affinity to both receptor subunits, stimulation of LPMCs with different recombinant IFNα subtypes did not result in any significant changes in IFNAR2 surface expression. Our data suggests that potential changes in the IFN responsiveness of mucosal immune cells during HIV infection are unlikely dictated by changes in IFNAR2 expression.
Keywords:
Messenger RNA – HIV – T cells – Cytotoxic T cells – immune cells – B cells – HIV infections – Interferons
Introduction
Natural transmission of HIV occurs via the vaginal or the gastrointestinal mucosa, where first responses against the invading virus are mounted. Following HIV infection, the gastrointestinal mucosa succumbs to profound enteropathy, including increased gastrointestinal inflammation, malabsorption, diarrhea and increased intestinal permeability [1], as well as microbial translocation and dysbiosis [2,3]. The gastrointestinal lymphoid tissue (GALT) shows stronger substantial depletion of CD4+ T cells, occurring mostly in CD4+ CCR5+ T cells [4,5] than peripheral mononuclear blood cells (PBMCs) which are commonly used for studying HIV immune responses. An earlier study conducted with simian immunodeficiency virus (SIV) proved the CD4+ T cell depletion not only to be more severe, but also to occur much faster in the GALT [6] and showed a delayed restoration of CD4+ T cell numbers following early combined antiretroviral therapy (cART) initiation in comparison to PBMCs [7]. As Lamina propria mononuclear cells (LPMCs), mucosal immune cells from the GALT, are highly susceptible for HIV infection and can be infected efficiently by CCR5-tropic HIV-1 strains, the Lamina propria aggregate culture (LPAC) can be used as an efficient ex vivo model to study HIV infection close to the physiological background [8].
Since adaptive immunity has yet to be mounted in the early stages of infection, innate immune responses are of great importance as the first line of defense. Early host immune responses in the GALT are mediated by type I interferons (IFNs), which are mainly secreted by plasmacytoid dendritic cells (pDC) [9]. Type I IFNs are a pleiotropic cytokine family consisting of IFNα, IFNβ, IFNε, IFNκ and IFNω. The human chromosome 9 contains 13 genes encoding for 12 individual IFNα subtypes [10], highly conserved proteins with an amino acid sequence homology of 75–99% [11]. All type I IFNs bind to the common IFNα/β receptor (IFNAR), which is widely expressed on most cell types [12]. The receptor consists of two subunits, IFNAR1 and IFNAR2, which associate with Janus kinases (Jak) Tyk2 (IFNAR1) and Jak1 (IFNAR2). Upon initial ligand binding by IFNAR2, IFNAR1 is recruited and subsequent to formation of the ternary complex out of IFNAR1, IFNAR2 and IFNα or IFNβ, Tyk2 and JAK1 become activated. Type I IFN signal transduction commonly takes place via the classical Jak-STAT pathway leading to the transcription of numerous IFN-stimulated genes (ISGs) [13]. The IFNAR2 subunit is of special interest, as it is responsible for initial ligand binding and three different isoforms are described. IFNAR2c contains long intracellular domains with associated kinases and is responsible for signal transduction. IFNAR2b is likewise a membrane bound isoform but lacks the intracellular domain, and is thought to be a negative regulator for type I IFN signaling [14]. Meanwhile, IFNAR2a is a soluble isoform, produced by either alternative splicing or by proteolytic cleavage from the cell surface and, in the murine organism, is independently regulated from trans-membranous IFNAR2 [15]. IFNAR2a is known to be increased in multiple sclerosis[16], adeno carcinoma and lung cancer [17,18] and was found to be elevated and negatively correlated with successful IFN therapy in Hepatitis C patients [19].
Compared to healthy individuals, IFNα expression is increased and the specific expression pattern of IFNα subtypes is changed in HIV+ patients. [20–22]. The exact role of IFNs in HIV infection is still under debate, beneficial implications of IFNα as suppressed viral load, increased NK cell function and enhanced suppressive capacity of CD8+ T cells as well as an increase in the expression of ISGs containing HIV restriction factors and thus hindering viral transmission and replication could be observed [23–25]. On the other hand, rescued CD4+ T cell depletion and restored cell function following blockade of IFNAR were reported [23,26], as well as systemic immune activation and limited antigen-specific T cell responses [24], thus indicating a potential detrimental influence of IFN on the course of HIV infection.
Due to their high antiviral potential, several studies testing IFNα as a treatment option for HIV were conducted, but patients showed no or only mild benefits from the treatment [27–29]. This, along with the development of highly effective antiretroviral therapies, led to decreased interest in IFNα as a potential therapeutic strategy against HIV [30]. Furthermore, several studies showed that the clinically approved IFNα2 subtype possesses only weak antiviral activity against HIV [9,31]. Thus the question remains, whether an IFNα subtype with higher antiviral capacities against HIV, such as IFNα14, might be of great use against HIV, for example as a potential addition to cART. Initial studies using IFNα14 as an antiviral agent in humanized mice as well as gene therapy approaches with IFNα14 encoding plasmids showed promising results [31–33].
While reduced expression of canonical ISGs in LPMCs infected with HIV [34] might indicate differences in the IFN responsiveness after HIV infection, differences in the ISG expression pattern can also be observed following stimulation with various IFNα subtypes [9]. Changes in IFNAR expression during infection or subsequent to stimulation with different IFNα subtypes would have the potential to modify IFN responsiveness and induce variations in the ISG expression pattern. A recent study observed increased IFNAR2 expression on CXCR4+ CD4+ T cells in peripheral blood of HIV+ patients [35]. However, while CXCR4 is expressed in equal amounts on PBMCs and LPMCs, LPMCs show higher CCR5 frequencies than PBMCs [8]. So far, no study compared IFNAR2 expression on CCR5+ CD4+ T cells in LPMCs from HIV+ patients and healthy donors. Up to date it is also unknown, if IFNα subtypes shape the IFNα response by differences in their potential to regulate receptor expression.
To mirror the physiological background of HIV infection, we performed experiments using LPMCs isolated from the GALT of otherwise healthy patients, undergoing abdominal surgery. Here, we determine the IFNAR2 expression on different immune cell subsets and investigate the influence of HIV infection on the expression of IFNAR2a and IFNAR2b/c. Varying levels of IFNAR2b/c expression on different immune cell subsets were observed, with the highest expression occurring in B cells, followed by NK and CD4+ and CD8+ T cells. HIV-1 infection did not change the expression of either the surface bound or the soluble isoform of IFNAR2. Finally, stimulation with a half maximal effective concentration (EC50) of different IFNα subtypes did not lead to any changes in receptor expression.
Materials & methods
LPMCs and plasma of HIV-infected patients
LPMCs were isolated from patients undergoing abdominal surgery at the University Hospital Essen. Samples were received via the Westdeutsche Biobank, pathologically evaluated and judged macroscopically normal and healthy. Gut samples from 19 different patients where used in this study, 8 of them female, 11 male. The average age was 55.8 years (+/-12 years). 31.5% of the patients underwent abdominal surgery due to various types of cancers (liposarcoma, Klatskin tumor, adenoma, colon carcinoma, neuroendocrine neoplasia), followed by removal of the pancreas (26.3%). Other reasons stated for undergoing abdominal surgery were gastrectomy, cholecystectomy as well as resection of small intestine and rectum. In order to isolate LPMCs, samples were processed as previously described [36]. Briefly, mucosal tissue was rinsed with HBSS and treated with 1.6 mM DTT (Applichem, Darmstadt, Germany) for 40 min at 37°C. The tissue was rinsed twice with HBSS, and the epithelium was removed with two 60 minute treatments of 1mM EDTA (Applichem) in HBSS and 0.1% BSA (Applichem) at 37°C. Afterwards, mucosal tissue was minced into 1–2 mm square portions and treated with 1-2mg/ml of collagenase D (Sigma Aldrich, St. Louis, USA) in RPMI1640 (Thermo Fisher, Waltham, USA) for two additional 60 minute treatments. LPMCs from each treatment were passed through a cell strainer, and stored in RPMI 1640 with 45% fetal calf serum (Biochrom, Berlin, Germany) and 10% DMSO (Applichem) in liquid nitrogen.
After thawing, up to 50% of viable cells were cultivated in RPMI1640 with 10% human serum (Type AB, Pan Biotech, Aidenbach, Germany), 1% Penicillin/Streptomycin (P/S) (Thermo Fisher), 1% L-Glutamine (Thermo Fisher) and 0.4% Piperacillin/Tazobactam (Fresenius Kabi, Bad Homburg an der Hoehe, Germany). Cells were incubated with 1x106 cells/ml (37 °C and 5% CO2) for the indicated time period. LPMC collection was approved by the Ethics Committee (No.:15–6310) of the medical faculty at the University of Duisburg-Essen.
Plasma samples of HIV+ patients (22 cART-naïve as well as 22 cART-experienced HIV+ patients) were collected from the clinics of dermatology at the University Hospital Essen; HIV- samples (n = 13) were donated by healthy individuals of the University Hospital Essen. Blood collection was approved by the Ethics Committee (No.:11–4715) of the medical faculty at the University of Duisburg-Essen. Viral loads among cART-naïve patients ranged from 223–3,8x106 copies/ml with a mean of 3,37x105 copies/ml. The CD4/CD8 ratio ranged from 0.06–2.28 (mean 0.49) in cART-naïve and 0.11–1.92 (mean 0.73) in cART-experienced patients. Further details can be found in Table 1.
Tab. 1. Clinical parameters of HIV-1+ patients. Infection
For the production of virus stocks, 6.5x105 HEK293T cells were cultivated in T175 flasks previously coated with 0.1% gelatin solution. Cell culture was performed with DMEM (Thermo Fisher) supplemented with 10% of heat-inactivated fetal calf serum (Merck Millipore, Darmstadt, Germany) and 1% P/S. Cells were transiently transfected with 9 μg HIV-1 NL4-3 nef recombinant virus containing the V3 loop region of the CCR5-tropic HIV-1 92TH014-2 strain (R5-tropic HIV-1NL4.3) [37,38]. 24 h following transfection, cells were supplemented with fresh IMDM (Thermo Fisher) containing 10% FCS and 1% P/S. 48 h after transfection, virus-containing supernatant was purified by centrifugation, aliquoted and stored until usage at -80°C.
Since HIV is not a plaque forming virus, the TCID50 of the virus stock was used to calculate the focus forming units and thus determine the multiplicity of infection (MOI) via TZM-bl Assay. 24 h after seeding TZM-bl cells in a 96 well plate, the media was removed and serial dilutions of virus stock were added to the cells. Two days post infection, supernatant was removed, cells were washed with cold PBS and subsequently fixed with formaldehyde and glutaraldehyde in PBS. The cells were again washed with cold PBS and staining solution was added. 24 h later, the assay was analyzed by counting wells that contained blue stained cells.
LPMCs were thawed one day prior to infection and infected with a MOI of 0.005, 0.01 or 0.02 (R5-tropic HIV-1NL4.3) and MOI 1 (HIV-1BaL) via spinoculation at 1000 g. Viral input was removed following spinoculation and cells were cultivated in fresh media with 1x106 cells/ml. Supernatant of HIV-infected and mock-treated cells were collected at the indicated time points and stored at -80°C until further use.
p24-ELISA
The p24 ELISA with supernatant from infected and non-infected LPMC cultures was performed according to the manufacturer’s protocol (R&D Systems, Minneapolis, USA). Absorbance was measured using the Spark® 10M multimode microplate reader (Tecan, Maennedorf, Switzerland).
FACS staining
Cell surface staining was performed using the following antibodies: anti-CD3 (SK7, BioLegend), anti-CD8 (RPA-T8, BioLegend, San Diego, USA), anti-CD19 (SJ25C1, BioLegend), anti-CD56 (NCAM16.2, BioLegend), anti-IFNAR2 (REA124, Miltenyi Biotech GmbH, Bergisch Gladbach, Germany), Fc Block human (Miltenyi Biotech GmbH). For surface staining, cells were washed once with FACS Buffer (PBS containing 0.1% BSA and 0.02% sodium azide), Pellets were then resuspended and incubated for 10 min with antibody mixture. Cells were washed once more with FACS Buffer and stored until acquisition. Dead cells were excluded from the analysis using Zombie Dye (BioLegend). Samples were acquired with a BD LSR II flow cytometer and a BD Symphony flow cytometer (Becton Dickinson, Franklin Lakes, USA) and data were analyzed using FACSDiva and FlowJo Version 10 (both Becton Dickinson).
sIFNAR2a ELISA
Supernatants of R5-tropic HIV-1NL4.3-infected LPMCs from Day 1, 4 and 7 post infection and plasma of HIV-infected patients (cART+ or cART-naïve) and healthy individuals were analyzed for the amount of sIFNAR2a by ELISA according to the manufacturer’s protocol (RayBiotech, Norcross, USA). For ELISA validation and quantification of results, a sIFNAR2a standard ranging from 0.16 ng/ml to 40 ng/ml was used. Absorbance was measured using the Spark® 10M multimode microplate reader (Tecan).
Magnetic cell separation
CD4+ T cells were isolated using a CD4+ T cell isolation Kit (Miltenyi), cells were isolated according to the manufacturer’s protocol.
Quantitative real time PCR
The mRNA of IFNα-stimulated LPMCs was isolated using the Direct Zol RNA Mini Prep Kit (Zymo Research, Irvine, USA), while mRNA of HIV-infected LPMCs was isolated using the RNeasy Mini Kit (Qiagen, Hilden, Germany). The mRNA samples of IFN-stimulated LPMCs were reverse transcribed using All in one cDNA Synthesis SuperMix (Bimake, Houston, USA) and the resulting cDNA was used for PCR. The mRNA of HIV-infected samples was subjected to one-step PCR. Quantification of the target mRNA was normalized according to the delta-delta Ct (ΔΔCt) method and the expression fold change (2-ΔΔCt) using GAPDH as reference. For the IFNAR2 isoforms IFNAR2a, IFNAR2b & IFNAR2c, Taqman PCR was performed using QuantiTect probe RT PCR Master Mix (Qiagen). Primer sequences were used as the following [39]: IFNAR2a (forward: gagcaagcagtaataaagtctcccttaa; reverse: ggctaaaaagttatg aaaattctgattcc; probe: Fam-aatgcaccctccttccacctggc-Tamra); IFNAR2b (forward: cttgaggca aggtctcgctaag; reverse: ggagtttgactgtagtgcattatga, probe: Fam-ctggaatgcagtggctattcacagg tgc-Tamra); IFNAR2c (forward: cccaaagtcttgaattttcataactt: reverse: aaatgacctccaccatatcca; probe: Fam-acctgccaccgttggaagcc-Tamra). PCRs for IFNAR1 were performed using the Powr Up SYBR Green Master Mix (Thermo Fisher), with the following primers [40]: forward: ttgtgtgaaagccagagcac; reverse: tcaagaagactttcgcagca. Amplification of IFNAR2b and IFNAR2c cDNA was performed with 40 cycles of annealing, extension and annealing steps at 95°C for 15 sec and 60°C for 1 min, following initial steps at 50°C for 2 min and 95°C for 10 minutes. For IFNAR2a, 50 cycles of 95°C for 15 sec, 67°C for 1 min and 70°C for 40 sec were used. Amplification of IFNAR1 cDNA was performed with 40 cycles at 95°C for 30 sec, 59°c for 30 sec and 70°C for 40 sec following an initial 5 min activation step at 95°C. For all one-step PCRs including reverse transcription, an initial step at 48°C for 30 min was added.
Stimulation with different human IFNα subtypes
IFNα subtypes were produced and purified as previously described [31]. The activity of each subtype was determined using the human ISRE-Luc reporter cell line, a retinal pigment epithelial cell line transfected with a plasmid containing the Firefly Luciferase gene, stably integrated under control of the IFN-stimulation-response element (ISRE). Following stimulation with IFNα, chemiluminescence can be detected and used to calculate the respective activity in units against commercially available IFNα (PBL assays sciences, Piscataway, USA) [31]. For stimulation experiments, thawed LPMCs were cultivated for the indicated time points with the EC50 of each subtype: IFNα1 1.9x103 U/ml (equals 1.78 ng/ml), IFNα2 1x103 U/ml (equals 4.8 ng/ml), IFNα8 4x103 U/ml (equals 52.6 ng/ml), IFNα14 65 U/ml (equals 0.26 ng/ml).
Statistical analysis
Statistical analysis and graphical presentations were carried out with Graph Pad Prism v6. For comparisons of two datasets, paired t-test was performed. For data including several groups one way ANOVA and Bonferroni’s multiple comparison test was performed.
Results
IFNAR2 expression after HIV-1 infection
The gut-associated lymphoid tissue is a major site of HIV replication and spread shortly after transmission due to the high numbers of activated, effector memory CD4+ T cells that express the co-receptor CCR5 in this compartment. This process highly depends on type I IFN mediated innate immune responses. The IFN α/β receptor consists of the two subunits IFNAR1 and IFNAR2, of which IFNAR2 is responsible for initial ligand binding. To analyze the impact of HIV-1 infection on IFNα signaling, we determined the surface expression of IFNAR2 on NK cells, B cells, CD4+ and CD8+ T cells among LPMCs isolated from the gastrointestinal mucosa of 11 healthy donors, undergoing abdominal surgery (Fig 1). All gut samples were pathologically evaluated and judged macroscopically normal and healthy by a pathologist. To exclude possible doublets from the analysis, we used forward scatter area versus forward scatter height and sideward scatter area versus sideward scatter height blots, respectively. The remaining single cells were further gated for immune cells based on forward scatter area and sideward scatter area and subsequently gated on viable cells. Using fluorescence minus one controls (FMO), IFNAR2 expression was then analyzed on CD4+ T cells, CD8+ T cells, B cells and NK cells (Fig 1A).
Fig. 1. IFNAR2 expression following HIV-1 infection of LPMCs. LPMCs from healthy donors were infected with R5-tropic HIV-1NL4.3 and cultivated for 4 days. (A) Surface expression of IFNAR2 (black line) on mock-treated and infected cells was determined via flow cytometry on CD4+ T cells, CD8+ T cells, B cells and NK cells using fluorescence minus one controls (tinted area). Histograms and dot plots of one representative LPMC sample are shown. (B) Individual frequencies of IFNAR2-expressing cells and mean values (+SEM) are shown as dots and bars (n = 11). Differences between the groups were analyzed by paired student’s t-test. (C) P24 expression of mock-treated and HIV-infected samples was analyzed by ELISA, p24 expression and mean values (+SEM) are shown by bars (n = 8). Differences between the groups were analyzed by paired student’s t-test, **** indicates p<0.0001. Of the four immune cell populations analyzed in this study, CD4+ T cells are the most common cell type, accounting for an average of 58.3% (+/ - 26.4%) of all viable cells, followed by CD8+ T cells (mean 21.2% +/-15.77%), and B cells (mean 9.8%, +/ - 18.10%). The least abundant subtype are NK cells (mean 2.2%, +/ - 2.0%).
The percentages of IFNAR2-expressing cells varied strongly between different immune cell subsets, with B cells containing almost three times more IFNAR2-expressing cells (mean 54.7%) than NK cells (mean 20.3%). The smallest proportion of IFNAR2+ cells was found among CD4+ T cells (mean 12.3%) and CD8+ T cells (mean 13.8%) (Fig 1B). Analyzing the mean fluorescence intensity (MFI) at a single cell level, few differences between immune cell subsets were observed with individual NK cells expressing only slightly higher IFNAR2 levels, followed by B cells and both CD4+ T cells and CD8+ T cells (S1 Fig). Following infection with R5-tropic HIV-1NL4.3 with different MOIs (MOI 0.005, MOI 0.01 and MOI 0.02) and HIV-1BaL with MOI 1, neither the percentages of IFNAR2 expressing cells (Fig 1B and S1 Fig) between immune cell subsets, nor the amount of IFNAR2 molecules on the single cell level (MFI, S1 and S2 Figs) changed four or seven days post infection (S3 Fig), indicating that HIV itself has no effect on IFNAR2 surface expression. Successful infection of LPMCs was examined by p24 ELISA (Fig 1C and S1 Fig).
Expression of IFNAR2 isoforms
The IFNAR2 receptor subunit is expressed in three different isoforms: IFNAR2a, IFNAR2b and IFNAR2c. IFNAR2c and IFNAR2b are membrane-bound isoforms, IFNAR2c being responsible for signal transduction while IFNAR2b, which lacks the necessary intracellular domains, is thought to be a negative regulator for type I IFN signaling [14]. IFNAR2a is a soluble isoform, which can be produced through alternative splicing or proteolytic cleavage from the cell surface. Since we could not observe any difference in IFNAR2b/c surface expression following HIV-infection (Fig 1B), we next analyzed the expression of soluble IFNAR2 (sIFNAR2a) in the supernatant of mock-treated and HIV-infected LPMCs at days 1, 4 and 7 post infection via ELISA (Fig 2A). Similar to the surface expression of IFNAR2 (Fig 1B), we did not observe any significant differences in the sIFNAR2a expression between mock-treated and HIV-infected LPMCs for any of the indicated time points (Fig 2A). To examine possible effects of HIV-1 infection in vivo, we compared the sIFNAR2 expression in plasma samples of healthy donors (mean 0.41 ng/ml) with plasma samples of HIV-1+ cART-naïve (mean 0.40 ng/ml) and cART-experienced patients (mean 0.21 ng/ml) (Fig 2B). According to the in vitro HIV-infected LPMC results, sIFNAR2a levels did not significantly differ between the groups. Furthermore, we did not find any correlation between viral loads and sIFNAR2a expression in cART-naïve patients. Additionally, no association between the cART regimen and sIFNAR2a expression was observed in cART-experienced HIV+-patients.
Fig. 2. Soluble IFNAR2a expression in HIV-1-infected LPMCs and plasma samples. Supernatant of mock-treated and R5-tropic HIV-1NL4.3-infected LPMCs from days 1, 4 and 7 post infection (A, n = 6) and plasma samples (B) from healthy donors (n = 13), cART-naïve (n = 22) and cART-experienced HIV-1+ patients (n = 22) were analyzed for sIFNAR2a expression via ELISA. The dotted line indicates the detection limit of 0.16 ng/ml. Individual frequencies of sIFNAR2a-expressing samples and mean values (+SEM) are shown as dots and bars. Statistically significant differences between the groups were analyzed by paired student‘s t-test (LPMCs) and ordinary one way ANOVA analysis with Bonferroni’s multiple comparison (plasma samples). To further validate the previous IFNAR2 protein data and to distinguish between the isoforms IFNAR2b and IFNAR2c, we performed quantitative real time (qRT)-PCR analysis. Therefore, we infected LPMCs from different donors with R5-tropic HIV-1NL4.3, cultivated the cells for 4 days and isolated the mRNA of separated CD4+ T cells. In accordance to the protein surface expression data (Fig 1B), we could not detect any significant changes in IFNAR2b and IFNAR2c mRNA transcripts between mock-treated and HIV-infected LPMCs (Fig 3). Furthermore, we did not detect any IFNAR2a mRNA in our samples, supporting the results from the sIFNAR2a ELISA (Fig 2A). We also determined the mRNA expression of IFNAR1, however, we did not detect any significant differences in transcription level after HIV infection (Fig 3).
Fig. 3. IFNAR1 and IFNAR2 mRNA expression in HIV-1-infected LPMCs. LPMCs were infected with R5-tropic HIV-1NL4.3 and cultivated for 4 days. Following CD4+ T cell isolation, mRNA expression levels of IFNAR1, IFNAR2b and IFNAR2c were analyzed via qRT-PCR. Quantification of the target mRNA was normalized according to the delta-delta Ct (ΔΔCt) method and the expression fold change (2-ΔΔCt) using GAPDH as reference. The mean gene fold expression (+SEM) of each target is shown in bars (n = 4). Differences between the groups were analyzed by paired student’s t-test. IFNAR2 expression following IFNα subtype stimulation
IFNAR1 and IFNAR2 are known to be differentially regulated and their expression can decrease upon ligand binding [41]. Since the 12 individual human IFNα subtypes differ in their antiviral capacity against HIV [9,31], we sought to compare subtypes with very high (IFNα8 & IFNα14) to those with very low (IFNα1 & IFNα2) antiviral activities, with respect to their potential to influence receptor expression. Furthermore, the chosen IFNα subtypes represent subtypes with high (α14, α2), middle (α8) and low (α1) affinity to IFNAR2.
LPMCs from four different healthy donors were stimulated with the EC50 (Fig 4) of IFNα1, IFNα2, IFNα8 and IFNα14 for 15 min, 30 min, 2 h and 24 h. Subsequently, surface receptor expression was determined via flow cytometry. We did not see significant differences in the surface expression of IFNAR2 on CD4+ and CD8+ T cells, B cells and NK cells after stimulation with the different IFNα subtypes. Furthermore, stimulation did not lead to changes in IFNAR2 expression compared to the unstimulated control. Slight elevations of IFNAR2 expression up to approximately 130% compared to the unstimulated control were observed 24 h following stimulation for all tested cell populations. Interestingly, one of the four tested LPMC donors exhibited an increase of IFNAR2 expression up to 270% on CD8+ T cells after IFNα stimulation (Fig 5). In addition to the percentages of IFNAR2 expressing cells, no significant differences were detected at the single cell level when analyzing the MFI (S4 Fig).
Fig. 4. Titration of individual IFNα subtype activity. The recombinant human reporter cell line ISRE-Luc was stimulated with series dilutions of each IFNα subtype. Maximal and minimal effective concentrations were determined and the EC50 was calculated. The upper and lower dotted lines indicate maximal and minimal effective concentration of the respective IFNα subtype, the middle dotted line indicates the EC50. Fig. 5. IFNAR2 expression following stimulation with IFNα subtypes. LPMCs were stimulated with the EC50 of IFNα1, IFNα2, IFNα8 and IFNα14 for 15 min, 30 min, 2 h and 24 h. Surface expression of IFNAR2 on unstimulated and stimulated cells was determined via flow cytometry on CD4+ T cells, CD8+ T cells, B cells and NK cells. Individual frequencies of IFNAR2-expressing cells and mean values (+SEM) are shown as dots and bars (n = 4). Differences between the groups were analyzed by ordinary one way ANOVA analysis and Bonferroni’s multiple comparisons. To further investigate the impact of IFN-stimulation on IFNAR expression and regulation, we determined the mRNA expression of the three IFNAR2 isoforms and IFNAR1. To this end, we isolated mucosal CD4+ T cells from LPMCs by magnetic cell separation and stimulated them with the EC50 of IFNα2 and IFNα14. After 30 min and 24 hours of incubation, mRNA was isolated and its expression was analyzed using isoform-specific primer. Similar to the qRT-PCRs performed on HIV-infected LPMCs (Fig 3), we could not detect any significant changes in the transcription level of IFNAR1, IFNAR2b and IFNAR2c following stimulation with IFNα subtypes for 30 min (Fig 6A) or 24 h (Fig 6B) when compared to the unstimulated controls, supporting the protein surface expression data shown in Fig 5. In accordance to qRT-PCRs performed on HIV-infected LPMCs and to the results from the sIFNAR2a ELISA (Fig 2A), we did not detect any IFNAR2a mRNA in our samples.
Fig. 6. IFNAR1 and IFNAR2 mRNA expression in IFNα subtype-stimulated cells. After isolation of CD4+ T cells from LPMCs, cells were stimulated with the EC50 of IFNα1, IFNα2, IFNα8 and IFNα14 for 30 min (A) and 24 h (B). Following mRNA isolation and reverse transcription, transcription levels of IFNAR1, IFNAR2b and IFNAR2c were analyzed via qRT-PCR. Quantification of the target mRNA was normalized according to the delta-delta Ct (ΔΔCt) method and the expression fold change (2-ΔΔCt) using GAPDH as reference. The mean gene fold expression (+ SEM) of each target is shown in bars (n = 3). Differences between the groups were analyzed by ordinary one way ANOVA analysis and Bonferroni’s multiple comparisons. Discussion
IFNα/β responses are the immediate early host reaction against invading viruses and crucial for mounting immune responses. Upon engagement of IFNAR, signal transduction results in the expression of hundreds of ISGs, among them several genes encoding for antiviral proteins. Even though all 12 human IFNα subtypes bind the same receptor, they trigger different biological responses and vary strongly in their antiviral activity against HIV. Whereas the only clinically approved subtype IFNα2 exhibits merely weak antiviral effects, other subtypes, such as IFNα14, are highly antiviral against HIV [9,31]. In this study, we aimed to determine whether the different responses are based on differential expression of IFNAR2 on various immune cell populations and if receptor expression levels might be altered upon infection with HIV. Indeed we could find strong differences in the percentages of IFNAR2 expressing cells, which were almost three times as high on B cells compared to CD4+ and CD8+ T cells (Fig 1B). These findings are in agreement with other studies, which also showed higher expression of IFNAR2 on B and NK compared to T cells [42,43]. Whereas Killian et al. [35] observed increased IFNAR2 expression on CXCR4+ CD4+ T cells in whole blood of HIV+ patients compared to healthy donors, we did not see any differences in IFNAR2 surface expression on the analyzed immune cell subsets following HIV infection of LPMCs in vitro. Taken into account that the biological effect of IFNα subtypes highly depends on the microenvironment and cell type [44], differences in receptor expression between different tissues are not unexpected. Furthermore, Killian et al. found increased IFNAR2 expression only on CXCR4+ CD4+ T cells of HIV+ patients compared to healthy donors, but not on CCR5+ CD4+ T cells. We did not determine the ratio of CXCR4+ CD4+ T cells versus CCR5+ CD4+ T cells in our samples. However, while only a small proportion of peripheral CD4+ T cells express CCR5, the majority of CD4+ T cells in LPMCs are reported to be CCR5+ [8]. For HIV+ patients, increased IFNAR2 expression was associated with clinical progression despite effective antiviral therapy progression [35]. Perhaps additional time points after infection are necessary to detect significant changes in IFNAR2 expression when using the LPAC model. Finally, Killian et al. only saw a significant increase in IFNAR2 expression on HAART-patients, and not on therapy-naïve long-term non-progressors, possibly indicating that HAART has an influence on IFNAR2 expression rather than HIV itself [35]. Other studies in mouse models reported a downregulation of IFNAR1 and IFNAR2 during influenza A infections, caused by viral proteins [45,46]. Influenza A was also shown to downregulate IFNAR1 and IFNAR2 in human monocyte-derived macrophages, however ex vivo infection of human lung tissue with Influenza A only reduced the expression of IFNAR1, but not IFNAR2 [46].
Our findings concerning the expression of the soluble isoform of IFNAR2, sIFNAR2a, are in accordance with the results for IFNAR2b/c surface expression. We detected trace amounts of sIFNAR2a in the supernatant of HIV-infected LPMCs (Fig 2A) and we did not see any difference in sIFNAR2a concentrations in the plasma of healthy donors and HIV+ cART-naïve and cART-experienced patients (Fig 2B). Both agonistic and antagonistic properties of sIFNAR2a where shown in mice, specifically concerning their ability to influence the efficacy of therapeutic IFNα treatment [15,47]. In mouse cell lines and primary cells overexpressing sIFNAR2a, the antiproliferative and antiviral effects of IFNα and IFNβ stimulation were inhibited. Recombinant sIFNAR2a was able to bind IFNα and IFNβ and complex with IFNAR1 on the surface of IFNAR2-/- thymocytes, leading to an antiproliferative response [15]. A later study by the same group proofed transgenic mice with elevated sIFNAR2a expression to be more susceptible to LPS-mediated septic shock, in which IFNβ plays a major role. Spleen cells of those transgenic mice overexpressing sIFNAR2a showed a faster, higher and more sustainable activation of STAT1 and STAT3, hence highlighting the agonistic abilities of sIFNAR2a [47]. Organ-dependent ratios of the mRNA for sIFNAR2a versus the mRNA for transmembranous IFNAR2 indicate an independent regulation from transmembranous IFNAR2 and a possibly organ specific biological function [15]. In humans, sIFNAR2a is reported to be elevated in systemic lupus [48] and various types of cancer [17] and to be associated with rather aggressive types of lung cancer [18]. Contradicting findings of elevated [16], decreased [49] and unchanged [48] sIFNAR2a levels in multiple sclerosis compared to healthy patients were reported. IFN therapy was further shown to induce elevated levels of sIFNAR2a compared to differentially treated multiple sclerosis patients and healthy donors [48]. This finding reflects what is seen during hepatitis C infection, in which sIFNAR2a expression was found to be predictive for the response to IFNα2 therapy [19]. One study reported a negative correlation between IFNAR2a expression and B cell exhaustion as well as impaired antibody production in the blood of HIV+ ART - treated, but not HIV+ ART naïve patients [50], which indicates ART rather than HIV itself as the primary effector and thus supports the data mentioned before [35]. Since we did not perform functional analysis of B cells in our samples, we cannot exclude the possibility of an association between sIFNAR2a levels and impaired B cell function. Given that we did not observe any differences between cART-naïve and cART-experienced patients, it is rather unlikely that HIV infection has any influence on the expression of the different IFNAR2 isoforms on LPMCs.
The different affinities of IFNα to both receptor subunits and their respective cell surface density is pivotal for regulation of the biological IFNα response [44,51]. For IFNAR2, a correlation between affinity and antiviral activity was observed [9], while antiproliferative effects seem to be more associated with the affinity to IFNAR1 and the stability of the ternary complex, respectively [52,53]. In addition to the specific dose of IFNα the cell is receiving, micro-environmental factors [45,54] and precise timing of exposure to IFNα in reference to proceeding or subsequent priming of the target cells as well as the duration of ligand binding influence the biological outcome of IFN stimulation [44]. To this end, we analyzed the effect of stimulating LPMCs with four IFNα subtypes, representing subtypes with high (IFNα14), middle (IFNα2 & IFNα8) and low (IFNα1) binding affinity to IFNAR2. Though IFNα8 and especially IFNα14 are highly antiviral against HIV, IFNα1 and IFNα2 exhibit only weak antiviral effects against HIV [9,31,52]. With all four tested subtypes, we did not see any differences in IFNAR2 expression on CD4+ T cells, CD8+ T cells, B cells or NK cells at 15 min, 30 min, 2 h and 24 h post stimulation (Fig 5). Following IFN-stimulation with much higher concentrations than the reported EC50, we observed a downregulation of IFNAR2 on lymphocytes (unpublished data), however these concentrations exceed physiologically tolerable levels of IFNα, and thus are not applicable for therapeutic treatments. As recently reviewed [51], low doses of IFNα have only marginal effects on receptor expression, whereas high doses result in a stronger downregulation of receptor from the cell surface, since a considerably higher amount of receptor molecules is engaged [51] and thus showing a ligand induced dose dependent receptor downregulation.
With all IFNα subtypes possessing different affinities to both receptor subunits, it is likely that they also differ in their influence on ligand induced downregulation of the receptor. Several studies have shown downregulation of both IFNAR1 and IFNAR2 after ligand stimulation on cell lines [41] and on human PBMCs [43], however, only IFNα2 was tested in these studies. In contrast to our findings, Tochizawa et al. [43] observed decreased IFNAR2 expression on PBMCs following 2 h stimulation with 100 U/ml and 1000 U/ml IFNα2, the latter being equal to the EC50 for IFNα2 used in our experiments. As discussed above, it is possible that LPMCs react differently than PBMCs to IFNα stimulation and further elucidation of which cell types exactly exhibit the observed IFNAR2 downregulation is needed. Out of the four cell lines tested by Marijanovic et al. [41], IFNAR2 downregulation was only detected on Hek293T and on HeLa cells, but not on Daudi or Jurkat cells. Among those four, Daudi and Jurkat cells are the only ones originating from immune cells, with Daudi cells being Burkitt Lymphoma cells and Jurkat cells originate from human T cells. Thus, the expression profile of IFNAR1 and IFNAR2 on Daudi and Jurkat cells is more likely to resemble the expression profile of human ex vivo LPMC samples than the expression profiles of HeLa and Hek293T cells. Additionally, the downregulation measured on HeLa and Hek293T cells was more pronounced for IFNAR1 than it was for IFNAR2. Due to the tight regulation of IFNAR1 expression on the cell surface it is likely that IFNAR1 expression is more sensitive to IFNα subtype induced downregulation and its expression has greater influence in shaping the IFNα subtype dependent biological response [55].
In conclusion, neither HIV infection nor IFNα stimulation seem to influence the expression of IFNAR2, which therefore likely does not to affect the IFN responsiveness of cells in the gut during HIV infection.
Supporting information
S1 Fig [a]
IFNAR2 expression following HIV-1 infection of LPMCs.S2 Fig [tif]
IFNAR2 expression following HIV-1 infection of LPMCs.S3 Fig [a]
IFNAR2 frequencies on LPMCs infected with HIV for 4 and 7 days.S4 Fig [tif]
IFNAR2 expression following stimulation with IFNα subtypes.
Zdroje
1. Brenchley JM, Douek DC. HIV infection and the gastrointestinal immune system. Mucosal Immunol. 2008;1 : 23–30. doi: 10.1038/mi.2007.1 19079157
2. Marchetti G, Tincati C, Silvestri G. Microbial Translocation in the Pathogenesis of HIV Infection and AIDS. Clin Microbiol Rev. 2013;23. doi: 10.1128/CMR.00050-12 23297256
3. Zevin AS, McKinnon L, Burgener A, Klatt NR. Microbial translocation and microbiome dysbiosis in HIV-associated immune activation. Curr Opin HIV AIDS. NIH Public Access; 2016;11 : 182–90. doi: 10.1097/COH.0000000000000234 26679414
4. Brenchley JM, Schacker TW, Ruff LE, Price DA, Taylor JH, Beilman GJ, et al. CD4 + T Cell Depletion During All Stages of HIV Disease Occurs Predominantly in the Gastrointestinal Tract. Pediatrics. 2017;116 : 572.1–573. doi: 10.1542/peds.2005-0698bbbb
5. Schneider T, Jahn H, Schmidt W, Riecken E, Zeitz M, Ullrich R, et al. Loss of CD4 T lymphocytes in patients infected with human immunodeficiency virus type 1 is more pronounced in the duodenal mucosa than in the peripheral blood [Internet]. Gut. 1995. Available: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1382905/pdf/gut00529-0094.pdf
6. Belyakov IM, Ahlers JD. Functional CD8+ CTLs in mucosal sites and HIV infection: moving forward toward a mucosal AIDS vaccine. Trends Immunol. Elsevier Current Trends; 2008;29 : 574–585. doi: 10.1016/J.IT.2008.07.010 18838298
7. Guadalupe M, Reay E, Sankaran S, Prindiville T, Flamm J, Mcneil A, et al. Severe CD4 T-Cell Depletion in Gut Lymphoid Tissue during Primary Human Immunodeficiency Virus Type 1 Infection and Substantial Delay in Restoration following Highly Active Antiretroviral Therapy. J Virol. 2003;77 : 11708–11717. doi: 10.1128/JVI.77.21.11708-11717.2003 14557656
8. Lapenta C, Boirivant M, Marini M, Santini SM, Logozzi M, Viora M, et al. Human intestinal lamina propria lymphocytes are naturally permissive to HIV-1 infection. Eur J Immunol. 1999;29 : 1202–1208. doi: 10.1002/(SICI)1521-4141(199904)29 : 04<1202::AID-IMMU1202>3.0.CO;2-O 10229087
9. Harper MS, Guo K, Gibbert K, Lee EJ, Dillon SM, Barrett BS, et al. Interferon-α Subtypes in an Ex Vivo Model of Acute HIV-1 Infection: Expression, Potency and Effector Mechanisms. PLOS Pathog. 2015;11: e1005254. doi: 10.1371/journal.ppat.1005254 26529416
10. Weissmann C, Weber H. The interferon genes. Prog Nucleic Acid Res Mol Biol. 1986;33 : 251–300. Available: http://www.ncbi.nlm.nih.gov/pubmed/3025923 doi: 10.1016/s0079-6603(08)60026-4
11. Hardy MP, Owczarek CM, Jermiin LS, Ejdebäck M, Hertzog PJ. Characterization of the type I interferon locus and identification of novel genes. Genomics. 2004;84 : 331–345. doi: 10.1016/j.ygeno.2004.03.003 15233997
12. De Weerd NA, Nguyen T. The interferons and their receptors-distribution and regulation. Immunol Cell Biol. Nature Publishing Group; 2012;90 : 483–491. doi: 10.1038/icb.2012.9 22410872
13. Sutter K, Dickow J, Dittmer U. Interferon α subtypes in HIV infection. Cytokine Growth Factor Rev. Elsevier; 2018;40 : 13–18. doi: 10.1016/j.cytogfr.2018.02.002 29475588
14. Gazziola C, Cordani N, Carta S, De Lorenzo E, Colombatti A, Perris R. The relative endogenous expression levels of the IFNAR2 isoforms influence the cytostatic and pro-apoptotic effect of IFNα on pleomorphic sarcoma cells. Int J Oncol. Spandidos Publications; 2005;26 : 129–140. doi: 10.3892/ijo.26.1.129
15. Hardy MP, Owczarek CM, Trajanovska S, Liu X, Kola I, Hertzog PJ. The soluble murine type I interferon receptor Ifnar-2 is present in serum, is independently regulated, and has both agonistic and antagonistic properties. Blood. 2001;97 : 473–482. doi: 10.1182/blood.v97.2.473 11154225
16. Chadha K, Weinstock-Guttman B, Zivadinov R, Bhasi K, Muhitch J, Feichter J, et al. Interferon Inhibitory Activity in Patients With Multiple Sclerosis. Arch Neurol. 2006;63 : 1579. doi: 10.1001/archneur.63.11.1579 17101826
17. Ambrus JLS, Dembinski W, Ambrus JLJ, Sykes DE, Akhter S, Kulaylat MN, et al. Free interferon-?/? receptors in the circulation of patients with adenocarcinoma. Cancer. 2003;98 : 2730–2733. doi: 10.1002/cncr.11843 14669296
18. Tanaka S, Hattori N, Ishikawa N, Horimasu Y, Deguchi N, Takano A, et al. Interferon (alpha, beta and omega) receptor 2 is a prognostic biomarker for lung cancer. Pathobiology. 2012;79 : 24–33. doi: 10.1159/000331230 22236545
19. Mizukoshi E, Kaneko S, Kaji K, Terasaki S, Matsushita E, Muraguchi M, et al. Serum Levels of Soluble Interferon Alfa / Beta Receptor as an Inhibitory Factor of Interferon in the Patients With Chronic Hepatitis C. Hepatology. 1999;30 : 1325–1331. doi: 10.1002/hep.510300516 10534358
20. Li Y, Sun B, Esser S, Jessen H, Streeck H, Widera M, et al. Expression Pattern of Individual IFNA Subtypes in Chronic HIV Infection. J Interf Cytokine Res. 2017;37 : 541–549. doi: 10.1089/jir.2017.0076 29252127
21. Stacey AR, Norris PJ, Qin L, Haygreen EA, Taylor E, Heitman J, et al. Induction of a striking systemic cytokine cascade prior to peak viremia in acute human immunodeficiency virus type 1 infection, in contrast to more modest and delayed responses in acute hepatitis B and C virus infections. J Virol. American Society for Microbiology (ASM); 2009;83 : 3719–33. doi: 10.1128/JVI.01844-08 19176632
22. von SYDOW M, SÖNNERBORG A, GAINES H, STRANNEGÅRD Ö. Interferon-Alpha and Tumor Necrosis Factor-Alpha in Serum of Patients in Various Stages of HIV-1 Infection. AIDS Res Hum Retroviruses. 1991;7 : 375–380. doi: 10.1089/aid.1991.7.375 1906289
23. Cheng L, Yu H, Li G, Li F, Ma J, Li J, et al. Type I interferons suppress viral replication but contribute to T cell depletion and dysfunction during chronic HIV-1 infection. JCI Insight. 2017;2. doi: 10.1172/jci.insight.94366 28614789
24. Utay NS, Douek DC. Interferons and HIV Infection: The Good, the Bad, and the Ugly. Pathog Immun. 2016;1 : 107. doi: 10.20411/pai.v1i1.125 27500281
25. Kwaa AKR, Talana CAG, Blankson JN. Interferon Alpha Enhances NK Cell Function and the Suppressive Capacity of HIV-Specific CD8+ T Cells. 2019; doi: 10.1128/JVI.01541-18 30404799
26. Cheng L, Ma J, Li J, Li D, Li G, Li F, et al. Blocking type I interferon signaling enhances T cell recovery and reduces HIV-1 reservoirs. J Clin Invest. 2017;127 : 269–279. doi: 10.1172/JCI90745 27941247
27. Alston B, Ellenberg JH, Standiford HC, Muth K, Martinez A, Greaves W, et al. A multicenter, randomized, controlled trial of three preparations of low-dose oral alpha-interferon in HIV-infected patients with CD4+ counts between 50 and 350 cells/mm(3). Division of AIDS Treatment Research Initiative (DATRI) 022 Study Group. J Acquir Immune Defic Syndr. 1999;22 : 348–57. Available: http://www.ncbi.nlm.nih.gov/pubmed/10634196 doi: 10.1097/00126334-199912010-00005
28. Bosinger SE, Utay NS. Type I Interferon: Understanding Its Role in HIV Pathogenesis and Therapy. Curr HIV/AIDS Rep. Springer US; 2015;12 : 41–53. doi: 10.1007/s11904-014-0244-6 25662992
29. Katabira ET, Sewankambo NK, Mugerwa RD, Belsey EM, Mubiru FX, Othieno C, et al. Lack of eYcacy of low dose oral interferon alfa in symptomatic HIV-1 infection: a randomised, double blind, placebo controlled trial [Internet]. Available: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1758122/pdf/v074p00265.pdf
30. Doyle T, Goujon C, Malim MH. HIV-1 and interferons: Who’s interfering with whom? Nat Rev Microbiol. Nature Publishing Group; 2015;13 : 403–413. doi: 10.1038/nrmicro3449 25915633
31. Lavender KJ, Gibbert K, Peterson KE, Van Dis E, Verheyen J, Müller JA, et al. Interferon Alpha Subtype-Specific Suppression of HIV-1 Infection In Vivo. J Virol. 2016;90 : 6001–6013. doi: 10.1128/JVI.00451-16 27099312
32. Abraham S, Choi J-G, Ortega NM, Zhang J, Shankar P, Swamy NM. Gene therapy with plasmids encoding IFN-β or IFN-α14 confers long-term resistance to HIV-1 in humanized mice. Oncotarget. Impact Journals, LLC; 2016;7 : 78412–78420. doi: 10.18632/oncotarget.12512 27729616
33. Sutter K, Lavender KJ, Messer RJ, Widera M, Williams K, Race B, et al. Concurrent administration of IFNα14 and cART in TKO-BLT mice enhances suppression of HIV-1 viremia but does not eliminate the latent reservoir. Sci Rep. Nature Research; 2019;9. doi: 10.1038/s41598-019-54650-9 31792317
34. Yoder AC, Guo K, Dillon SM, Phang T, Lee EJ, Harper MS, et al. The transcriptome of HIV-1 infected intestinal CD4+ T cells exposed to enteric bacteria. Desrosiers RC, editor. PLOS Pathog. Public Library of Science; 2017;13: e1006226. doi: 10.1371/journal.ppat.1006226 28241075
35. Killian MS, Fujimura SH, Sudhagoni RG. Increased expression of the Type i interferon receptor on CD4 + T lymphocytes in HIV-1-infected individuals. J Acquir Immune Defic Syndr. 2017;74 : 473–478. doi: 10.1097/QAI.0000000000001280 28009639
36. Howe R, Dillon S, Rogers L, Mccarter M, Kelly C, Madinger N, et al. Evidence for Dendritic Cell-Dependent CD4+ T Helper-1 Type Responses to Commensal Bacteria in Normal Human Intestinal Lamina Propria. Clini Immunol. 2010;131 : 317–332. doi: 10.1016/j.clim.2008.12.003.Evidence
37. Münch J, Rajan D, Schindler M, Specht A, Rücker E, Novembre FJ, et al. Nef-Mediated Enhancement of Virion Infectivity and Stimulation of Viral Replication Are Fundamental Properties of Primate Lentiviruses. J Virol. 2007;81 : 13852–13864. doi: 10.1128/JVI.00904-07 17928336
38. Papkalla A, Münch J, Otto C, Kirchhoff F. NOTES Nef Enhances Human Immunodeficiency Virus Type 1 Infectivity and Replication Independently of Viral Coreceptor Tropism. J Virol. 2002;76 : 8455–8459. doi: 10.1128/JVI.76.16.8455-8459.2002 12134048
39. Bauer A, Rudzki D, Auer M, Hegen H, Deisenhammer F. Expression of interferon type-I receptor isoforms, clinical response and development of neutralizing antibodies in multiple sclerosis patients–results of a prospective study. LaboratoriumsMedizin. De Gruyter; 2016;40 : 119–124. doi: 10.1515/labmed-2015-0020
40. Farmer JR, Altschaefl KM, O’Shea KS, Miller DJ. Activation of the Type I Interferon Pathway Is Enhanced in Response to Human Neuronal Differentiation. Vasilakis N, editor. PLoS One. Public Library of Science; 2013;8: e58813. doi: 10.1371/journal.pone.0058813 23505563
41. Marijanovic Z, Ragimbeau J, van der Heyden J, Uzé G, Pellegrini S. Comparable potency of IFNalpha2 and IFNbeta on immediate JAK/STAT activation but differential down-regulation of IFNAR2. Biochem J. Portland Press Ltd; 2007;407 : 141–51. doi: 10.1042/BJ20070605 17627610
42. Killian MS, Fujimura SH, Sudhagoni RG. Increased expression of the Type i interferon receptor on CD4+T lymphocytes in HIV-1-infected individuals. J Acquir Immune Defic Syndr. 2017;74 : 473–478. doi: 10.1097/QAI.0000000000001280 28009639
43. Tochizawa S, Akamatsu S, Sugiyama Y, Muraguchi M, Ohmoto Y, Ono Y, et al. A flow cytometric method for determination of the interferon receptor IFNAR2 subunit in peripheral blood leukocyte subsets. J Pharmacol Toxicol Methods. Elsevier; 2004;50 : 59–66. doi: 10.1016/J.VASCN.2004.02.003 15233969
44. Tomasello E, Pollet E, Vu Manh TP, Uzé G, Dalod M. Harnessing mechanistic knowledge on beneficial versus deleterious IFN-I effects to design innovative immunotherapies targeting cytokine activity to specific cell types. Front Immunol. 2014;5 : 1–27. doi: 10.3389/fimmu.2014.00001 24474949
45. Xia C, Vijayan M, Pritzl CJ, Fuchs SY, McDermott AB, Hahm B. Hemagglutinin of Influenza A Virus Antagonizes Type I Interferon (IFN) Responses by Inducing Degradation of Type I IFN Receptor 1. J Virol. 2016;90 : 2403–2417. doi: 10.1128/JVI.02749-15 26676772
46. Jia D, Rahbar R, Chan RWY, Lee SMY, Chan MCW, Wang BX, et al. Influenza virus non-structural protein 1 (NS1) disrupts interferon signaling. PLoS One. 2010;5. doi: 10.1371/journal.pone.0013927 21085662
47. Samarajiwa SA, Mangan NE, Hardy MP, Najdovska M, Dubach D, Braniff S-J, et al. TLR4-Mediated Septic Shock Type I IFN Signaling and Exacerbates Soluble IFN Receptor Potentiates In Vivo. 2014;.
48. Fatakdawala T, Skawinski M, Ferriera J, Stauffer T, Lavoie T. Soluble Type I Interferon Receptor 2 Is Elevated By Interferon Treatment and In Certain Autoimmune Diseases—ACR Meeting Abstracts [Internet]. 2013 [cited 2 Jun 2019]. Available: https://acrabstracts.org/abstract/soluble-type-i-interferon-receptor-2-is-elevated-by-interferon-treatment-and-in-certain-autoimmune-diseases/
49. Órpez-Zafra T, Pavía J, Hurtado-Guerrero I, Pinto-Medel MJ, Rodriguez Bada JL, Urbaneja P, et al. Decreased soluble IFN-β receptor (sIFNAR2) in multiple sclerosis patients: A potential serum diagnostic biomarker. Mult Scler J. SAGE PublicationsSage UK: London, England; 2017;23 : 937–945. doi: 10.1177/1352458516667564 27613121
50. Abudulai L, CHa L, Fernandez S, French M. INCREASED INTERFERON-ALPHA ACTIVITY MAY CONTRIBUTE TO DEFECTS OF B CELLS AND ANTIBODY PRODUCTION CAUSED BY HIV-1 INFECTION. In: Jornal of Virus Eradication, Abstratcs of the IAS 2016 Towards and HIV Cure Symposium [Internet]. 2016 [cited 2 Jun 2019]. http://viruseradication.com/abstract-details.php?abstract_id=1002
51. Fuchs SY. Hope and Fear for Interferon: The Receptor-Centric Outlook on the Future of Interferon Therapy. J Interf Cytokine Res. Mary Ann Liebert, Inc.; 2013;33 : 211. doi: 10.1089/JIR.2012.0117 23570388
52. Lavoie TB, Kalie E, Crisafulli-Cabatu S, Abramovich R, DiGioia G, Moolchan K, et al. Binding and activity of all human alpha interferon subtypes. Cytokine. Elsevier Ltd; 2011;56 : 282–289. doi: 10.1016/j.cyto.2011.07.019 21856167
53. Jaks E, Gavutis M, Uzé G, Martal J, Piehler J. Differential Receptor Subunit Affinities of Type I Interferons Govern Differential Signal Activation. J Mol Biol. 2007;366 : 525–539. doi: 10.1016/j.jmb.2006.11.053 17174979
54. Katlinski K V., Gui J, Katlinskaya Y V., Ortiz A, Chakraborty R, Bhattacharya S, et al. Inactivation of Interferon Receptor Promotes the Establishment of Immune Privileged Tumor Microenvironment. Cancer Cell. 2017; doi: 10.1016/j.ccell.2017.01.004 28196594
55. Ragimbeau J, Dondi E, Alcover A, Eid P, Uzé G, Pellegrini S. The tyrosine kinase Tyk2 controls IFNAR1 cell surface expression. EMBO J. 2003;22 : 537–547. doi: 10.1093/emboj/cdg038 12554654
Článek Disparate effects of antibiotic-induced microbiome change and enhanced fitness in Daphnia magnaČlánek Phanerochaete chrysosporium strain B-22, a nematophagous fungus parasitizing Meloidogyne incognitaČlánek Effects of Transcranial Direct Current Stimulation on GABA and Glx in Children: A pilot studyČlánek Evaluating risk prediction models for adults with heart failure: A systematic literature reviewČlánek Patient perceived value of teleophthalmology in an urban, low income US population with diabetesČlánek A study to better understand under-utilization of laboratory tests for antenatal care in SenegalČlánek Phylogeographic analyses point to long-term survival on the spot in micro-endemic Lycian salamandersČlánek Genlisea hawkingii (Lentibulariaceae), a new species from Serra da Canastra, Minas Gerais, BrazilČlánek Design and evaluation of a laboratory-based wheelchair castor testing protocol using community dataČlánek Role of ecology in shaping external nasal morphology in bats and implications for olfactory trackingČlánek Influence of light on the infection of Aureococcus anophagefferens CCMP 1984 by a “giant virus”Článek Effects of Allium hookeri on gut microbiome related to growth performance in young broiler chickensČlánek Age and altitude of residence determine anemia prevalence in Peruvian 6 to 35 months old childrenČlánek A network analysis revealed the essential and common downstream proteins related to inguinal herniaČlánek Low risk pregnancies after a cesarean section: Determinants of trial of labor and its failureČlánek Identification and characterization of miRNAs involved in cold acclimation of zebrafish ZF4 cellsČlánek Research on motion planning for an indoor spray arm based on an improved potential field methodČlánek Eye-gaze information input based on pupillary response to visual stimulus with luminance modulationČlánek Disruption in daily eating-fasting and activity-rest cycles in Indian adolescents attending schoolČlánek The earliest farming communities north of the Carpathians: The settlement at Gwoździec site 2Článek Eligibility for hepatitis B antiviral therapy among adults in the general population in ZambiaČlánek Characterization of the visceral and neuronal phenotype of 4L/PS-NA mice modeling Gaucher diseaseČlánek Umbilical cord separation time, predictors and healing complications in newborns with dry careČlánek Analysis of attitudinal components towards statistics among students from different academic degreesČlánek Forecasting stock prices with long-short term memory neural network based on attention mechanismČlánek Enzyme response of activated sludge to a mixture of emerging contaminants in continuous exposureČlánek Comparison of Monocyte Distribution Width (MDW) and Procalcitonin for early recognition of sepsisČlánek Transcriptome analysis of Actinidia chinensis in response to Botryosphaeria dothidea infectionČlánek Head impulse compensatory saccades: Visual dependence is most evident in bilateral vestibular lossČlánek Sofosbuvir-based regimen for genotype 2 HCV infected patients in Taiwan: A real world experienceČlánek The virulence domain of Shigella IcsA contains a subregion with specific host cell adhesion functionČlánek Influence of flow on phosphorus-dynamics and particle size in agricultural drainage ditch sedimentsČlánek An information-based approach to handle various types of uncertainty in fuzzy bodies of evidenceČlánek The impact of rehabilitation frequency on the risk of stroke in patients with rheumatoid arthritisČlánek Vascularization and biocompatibility of poly(ε-caprolactone) fiber mats for rotator cuff tear repairČlánek Disease-specific out-of-pocket healthcare expenditure in urban Bangladesh: A Bayesian analysisČlánek Characterization of black patina from the Tiber River embankments using Next-Generation SequencingČlánek Structure-function analyses of candidate small molecule RPN13 inhibitors with antitumor propertiesČlánek Predictive factors of first dosage intravenous immunoglobulin-related adverse effects in childrenČlánek Prevalence of antiphospholipid antibodies in Behçet's disease: A systematic review and meta-analysisČlánek Genetic characterization of Bacillus anthracis strains circulating in Italy from 1972 to 2018Článek Regional versus local wind speed and direction at a narrow beach with a high and steep foreduneČlánek Do atmospheric events explain the arrival of an invasive ladybird (Harmonia axyridis) in the UK?Článek Growth behavior and glyphosate resistance level in 10 populations of Echinochloa colona in AustraliaČlánek Early conservation benefits of a de facto marine protected area at San Clemente Island, CaliforniaČlánek Computational analysis of functional single nucleotide polymorphisms associated with SLC26A4 geneČlánek Monitoring the ‘diabetes epidemic’: A framing analysis of United Kingdom print news 1993-2013Článek Trophic ecology of Mexican Pacific harbor seal colonies using carbon and nitrogen stable isotopesČlánek Models of protein production along the cell cycle: An investigation of possible sources of noiseČlánek Fecal transplant prevents gut dysbiosis and anxiety-like behaviour after spinal cord injury in ratsČlánek MLST-based genetic relatedness of Campylobacter jejuni isolated from chickens and humans in PolandČlánek Modelling the impact of migrants on the success of the HIV care and treatment program in BotswanaČlánek Does squatting need attention?—A dual-task study on cognitive resources in resistance exerciseČlánek pyKNEEr: An image analysis workflow for open and reproducible research on femoral knee cartilageČlánek Allergic inflammation is initiated by IL-33–dependent crosstalk between mast cells and basophilsČlánek Combined fiscal policies to promote healthier diets: Effects on purchases and consumer welfareČlánek Manual dexterity of mice during food-handling involves the thumb and a set of fast basic movementsČlánek Quantum isomer searchČlánek Optimization of tissue sampling for Borrelia burgdorferi in white-footed mice (Peromyscus leucopus)Článek Mothers’ oral health literacy and children’s oral health status in Pikine, Senegal: A pilot studyČlánek Increased inflammation and endothelial markers in patients with late severe post-thrombotic syndromeČlánek Management of veterinary anaesthesia in small animals: A survey of current practice in QuebecČlánek Quantitative PCR provides a simple and accessible method for quantitative microbiota profilingČlánek Niche modeling reveals life history shifts in birds at La Brea over the last twenty millenniaČlánek Distributed flux balance analysis simulations of serial biomass fermentation by two organismsČlánek Short treatment with antalarmin alters adrenal gland receptors in the rat model of endometriosisČlánek Self-esteem and other risk factors for depressive symptoms among adolescents in United Arab EmiratesČlánek Novel method to measure temporal windows based on eye movements during viewing of the Necker cubeČlánek Reassortment and adaptive mutations of an emerging avian influenza virus H7N4 subtype in ChinaČlánek Occupational gender segregation and economic growth in U.S. local labor markets, 1980 through 2010Článek Accuracy of intraocular lens power calculation formulas using a swept-source optical biometerČlánek Impact of long-term storage and freeze-thawing on eight circulating microRNAs in plasma samplesČlánek Redefining transcriptional regulation of the APOE gene and its association with Alzheimer’s diseaseČlánek Obesity, smoking habits, and serum phosphate levels predicts mortality after life-style interventionČlánek Allele specific expression of Dof genes responding to hormones and abiotic stresses in sugarcaneČlánek Multiple fragmented habitat-patch use in an urban breeding passerine, the Short-toed TreecreeperČlánek And the nominees are: Using design-awards datasets to build computational aesthetic evaluation modelČlánek Effects of rejection intensity and rejection sensitivity on social approach behavior in womenČlánek The implementation of community-based diabetes and hypertension management care program in IndonesiaČlánek Optimization of cytotoxic activity of Nocardia sp culture broths using a design of experimentsČlánek Investigating Italian disinformation spreading on Twitter in the context of 2019 European electionsČlánek Modelling zero-truncated overdispersed antenatal health care count data of women in BangladeshČlánek Common mental illness among epilepsy patients in Bahir Dar city, Ethiopia: A cross-sectional studyČlánek Adverse reproductive effects of S100A9 on bovine sperm and early embryonic development in vitroČlánek Influence of inflammasome NLRP3, and IL1B and IL2 gene polymorphisms in periodontitis susceptibilityČlánek CNP mediated selective toxicity on melanoma cells is accompanied by mitochondrial dysfunctionČlánek Factors for starting biosimilar TNF inhibitors in patients with rheumatic diseases in the real worldČlánek Revisits, readmissions, and outcomes for pediatric traumatic brain injury in California, 2005-2014Článek Use of magnetic resonance imaging to determine laterality of meniscal size in healthy volunteersČlánek Correction: Mutation spectrums of TSC1 and TSC2 in Chinese women with lymphangioleiomyomatosis (LAM)Článek Young women’s reproductive health conversations: Roles of maternal figures and clinical practicesČlánek Dominant negative effects by inactive Spa47 mutants inhibit T3SS function and Shigella virulenceČlánek ICOS-deficient and ICOS YF mutant mice fail to control Toxoplasma gondii infection of the brain
Článek vyšel v časopisePLOS One
Nejčtenější tento týden
2020 Číslo 1- Bezpečnost dlouhodobé terapie osteoporózy – aktuální data
- Máj pod bílým pláštěm aneb když mezi směnami vykvete láska
- Perorální semaglutid ve formě tablet k léčbě DM 2. typu nyní dostupný i v Česku
- Dlouhodobá recidiva a komplikace spojené s elektivní operací břišní kýly
- Naděje budí časná diagnostika Parkinsonovy choroby založená na pachu kůže
-
Všechny články tohoto čísla
- ETAPOD: A forecast model for prediction of black pod disease outbreak in Nigeria
- Disparate effects of antibiotic-induced microbiome change and enhanced fitness in Daphnia magna
- Deliver on Your Own: Disrespectful Maternity Care in rural Kenya
- Quantification of microaerobic growth of Geobacter sulfurreducens
- Number of days required to estimate physical activity constructs objectively measured in different age groups: Findings from three Brazilian (Pelotas) population-based birth cohorts
- Identifying site- and stimulation-specific TMS-evoked EEG potentials using a quantitative cosine similarity metric
- Design and assessment of TRAP-CSP fusion antigens as effective malaria vaccines
- Best compromise nutritional menus for childhood obesity
- Phanerochaete chrysosporium strain B-22, a nematophagous fungus parasitizing Meloidogyne incognita
- Non-disclosure of tuberculosis diagnosis by patients to their household members in south western Uganda
- Patch testing in Lao medical students
- A competence-regulated toxin-antitoxin system in Haemophilus influenzae
- Bund removal to re-establish tidal flow, remove aquatic weeds and restore coastal wetland services—North Queensland, Australia
- Exploring the mechanism of olfactory recognition in the initial stage by modeling the emission spectrum of electron transfer
- Risk of complications among diabetics self-reporting oral health status in Canada: A population-based cohort study
- Family Health Days program contributions in vaccination of unreached and under-immunized children during routine vaccinations in Uganda
- Calcium dobesilate reduces VEGF signaling by interfering with heparan sulfate binding site and protects from vascular complications in diabetic mice
- Predicting factors for long-term survival in patients with out-of-hospital cardiac arrest – A propensity score-matched analysis
- HIV infection does not alter interferon α/β receptor 2 expression on mucosal immune cells
- The impact of body posture on intrinsic brain activity: The role of beta power at rest
- Retraction: DJ-1 Modulates α-Synuclein Aggregation State in a Cellular Model of Oxidative Stress: Relevance for Parkinson's Disease and Involvement of HSP70
- Practical considerations in the use of a porcine model (Sus scrofa domesticus) to assess prevention of postoperative peritubal adhesions
- Do atmospheric events explain the arrival of an invasive ladybird (Harmonia axyridis) in the UK?
- Transcriptional Differences in Peanut (Arachis hypogaea L.) Seeds at the Freshly Harvested, After-ripening and Newly Germinated Seed Stages: Insights into the Regulatory Networks of Seed Dormancy Release and Germination
- First adaptation of quinoa in the Bhutanese mountain agriculture systems
- Identifying maintenance hosts for infection with Dichelobacter nodosus in free-ranging wild ruminants in Switzerland: A prevalence study
- Model order reduction for left ventricular mechanics via congruency training
- The use of mixed collagen-Matrigel matrices of increasing complexity recapitulates the biphasic role of cell adhesion in cancer cell migration: ECM sensing, remodeling and forces at the leading edge of cancer invasion
- Hyponatraemia reversibly affects human myometrial contractility. An in vitro pilot study
- Production, purification and evaluation of biodegradation potential of PHB depolymerase of Stenotrophomonas sp. RZS7
- The impact of a wireless audio system on communication in robotic-assisted laparoscopic surgery: A prospective controlled trial
- Towards a bottom-up understanding of antimicrobial use and resistance on the farm: A knowledge, attitudes, and practices survey across livestock systems in five African countries
- Geographical origin determines responses to salinity of Mediterranean caddisflies
- Non-redundant roles in sister chromatid cohesion of the DNA helicase DDX11 and the SMC3 acetyl transferases ESCO1 and ESCO2
- Seroprevalence of viral and vector-borne bacterial pathogens in domestic dogs (Canis familiaris) in northern Botswana
- Global reach of ageism on older persons’ health: A systematic review
- Musical expertise generalizes to superior temporal scaling in a Morse code tapping task
- Cross-cultural adaptation and psychometric evaluation of the Yoruba version of Oswestry disability index
- Growth behavior and glyphosate resistance level in 10 populations of Echinochloa colona in Australia
- Analysis of the lineage of Phytophthora infestans isolates using mating type assay, traditional markers, and next generation sequencing technologies
- Post-transcriptional regulation of Rad51c by miR-222 contributes cellular transformation
- Targeting chondroitinase ABC to axons enhances the ability of chondroitinase to promote neurite outgrowth and sprouting
- First eight residues of apolipoprotein A-I mediate the C-terminus control of helical bundle unfolding and its lipidation
- Repeated noninvasive stimulation of the ventromedial prefrontal cortex reveals cumulative amplification of pleasant compared to unpleasant scene processing: A single subject pilot study
- Can scientists fill the science journalism void? Online public engagement with science stories authored by scientists
- Retention and predictors of attrition among patients who started antiretroviral therapy in Zimbabwe’s national antiretroviral therapy programme between 2012 and 2015
- Prognostics for pain in osteoarthritis: Do clinical measures predict pain after total joint replacement?
- Infants without health insurance: Racial/ethnic and rural/urban disparities in infant households’ insurance coverage
- HY5 is not integral to light mediated stomatal development in Arabidopsis
- Effects of Transcranial Direct Current Stimulation on GABA and Glx in Children: A pilot study
- Hypertension testing and treatment in Uganda and Kenya through the SEARCH study: An implementation fidelity and outcome evaluation
- Whole genome sequence analysis reveals the broad distribution of the RtxA type 1 secretion system and four novel putative type 1 secretion systems throughout the Legionella genus
- Evaluation of rice wild relatives as a source of traits for adaptation to iron toxicity and enhanced grain quality
- The Malaysian Workplace Bullying Index (MWBI): A new measure of workplace bullying in Eastern countries
- Brief communication: Long-term absence of Langerhans cells alters the gene expression profile of keratinocytes and dendritic epidermal T cells
- APOBEC3B reporter myeloma cell lines identify DNA damage response pathways leading to APOBEC3B expression
- Morphological diversity within a core collection of subterranean clover (Trifolium subterraneum L.): Lessons in pasture adaptation from the wild
- Feasibility of real-time in vivo 89Zr-DFO-labeled CAR T-cell trafficking using PET imaging
- Repository-based plasmid design
- A LAMP at the end of the tunnel: A rapid, field deployable assay for the kauri dieback pathogen, Phytophthora agathidicida
- A new method of recording from the giant fiber of Drosophila melanogaster shows that the strength of its auditory inputs remains constant with age
- Early conservation benefits of a de facto marine protected area at San Clemente Island, California
- Evaluating risk prediction models for adults with heart failure: A systematic literature review
- Age, period and cohort analysis of age-specific maternal mortality trend in Ethiopia: A secondary analysis
- Aberrant cervical innate immunity predicts onset of dysbiosis and sexually transmitted infections in women of reproductive age
- Performance of Qure.ai automatic classifiers against a large annotated database of patients with diverse forms of tuberculosis
- Closed circuit xenon delivery for 72h in neonatal piglets following hypoxic insult using an ambient pressure automated control system: Development, technical evaluation and pulmonary effects
- Safe mobility, socioeconomic inequalities, and aging: A 12-year multilevel interrupted time-series analysis of road traffic death rates in a Latin American country
- THAP11F80L cobalamin disorder-associated mutation reveals normal and pathogenic THAP11 functions in gene expression and cell proliferation
- Lesion of striatal patches disrupts habitual behaviors and increases behavioral variability
- A clinical method for estimating the modulus of elasticity of the human cornea in vivo
- Gamma gap thresholds and HIV, hepatitis C, and monoclonal gammopathy
- Infective endocarditis post-transcatheter aortic valve implantation (TAVI), microbiological profile and clinical outcomes: A systematic review
- Potentiation of curing by a broad-host-range self-transmissible vector for displacing resistance plasmids to tackle AMR
- An acceleration in hypertension-related mortality for middle-aged and older Americans, 1999-2016: An observational study
- Two common disease-associated TYK2 variants impact exon splicing and TYK2 dosage
- Patient perceived value of teleophthalmology in an urban, low income US population with diabetes
- Real-world cost-effectiveness of rivaroxaban compared with vitamin K antagonists in the context of stroke prevention in atrial fibrillation in France
- Spatial risk assessment of global change impacts on Swedish seagrass ecosystems
- The effects of low-carbohydrate diets on cardiovascular risk factors: A meta-analysis
- Computational analysis of functional single nucleotide polymorphisms associated with SLC26A4 gene
- Evidence in support of chromosomal sex influencing plasma based metabolome vs APOE genotype influencing brain metabolome profile in humanized APOE male and female mice
- Accelerated sparsity based reconstruction of compressively sensed multichannel EEG signals
- A multicenter case control study of association of vitamin D with breast cancer among women in Karachi, Pakistan
- Microvesicles from Lactobacillus reuteri (DSM-17938) completely reproduce modulation of gut motility by bacteria in mice
- Chemical profiling of Curatella americana Linn leaves by UPLC-HRMS and its wound healing activity in mice
- “Yellow” laccase from Sclerotinia sclerotiorum is a blue laccase that enhances its substrate affinity by forming a reversible tyrosyl-product adduct
- Dense carbon-nanotube coating scaffolds stimulate osteogenic differentiation of mesenchymal stem cells
- Gamma Knife radiosurgery for vestibular schwannomas: Evaluation of planning using the sphericity degree of the target volume
- Variants in ADIPOQ gene are linked to adiponectin levels and lung function in young males independent of obesity
- Purification and molecular characterization of phospholipase, antigen 5 and hyaluronidases from the venom of the Asian hornet (Vespa velutina)
- Clinical state tracking in serious mental illness through computational analysis of speech
- Why are animal source foods rarely consumed by 6-23 months old children in rural communities of Northern Ethiopia? A qualitative study
- A study to better understand under-utilization of laboratory tests for antenatal care in Senegal
- Monitoring the ‘diabetes epidemic’: A framing analysis of United Kingdom print news 1993-2013
- Heart rate variability helps to distinguish the intensity of menopausal symptoms: A prospective, observational and transversal study
- Physicians’ perspectives regarding non-medical switching of prescription medications: Results of an internet e-survey
- Trophic ecology of Mexican Pacific harbor seal colonies using carbon and nitrogen stable isotopes
- Effectiveness of information technology–enabled ‘SMART Eating’ health promotion intervention: A cluster randomized controlled trial
- Cauda Equina Syndrome Core Outcome Set (CESCOS): An international patient and healthcare professional consensus for research studies
- Incidence and prediction of intraoperative and postoperative cardiac arrest requiring cardiopulmonary resuscitation and 30-day mortality in non-cardiac surgical patients
- Microscopic distance from tumor invasion front to serosa might be a useful predictive factor for peritoneal recurrence after curative resection of T3-gastric cancer
- A new species of Macrocypraea (Gastropoda, Cypraeidae) from Trindade Island, Brazil, including phenotypic differentiation from remaining congeneric species
- The evolving topology of the Lightning Network: Centralization, efficiency, robustness, synchronization, and anonymity
- Avoid jumping to conclusions under uncertainty in Obsessive Compulsive Disorder
- Tanopicobia gen. nov., a new genus of quill mites, its phylogenetic placement in the subfamily Picobiinae (Acariformes: Syringophilidae) and picobiine relationships with avian hosts
- Large-scale spatial variation of chronic stress signals in moose
- Complex situations: Economic insecurity, mental health, and substance use among pregnant women who consider – but do not have – abortions
- Well-being and entrepreneurship: Using establishment size to identify treatment effects and transmission mechanisms
- Models of protein production along the cell cycle: An investigation of possible sources of noise
- Protein-protein interactions underlying the behavioral and psychological symptoms of dementia (BPSD) and Alzheimer’s disease
- Assessing the feasibility of a life history calendar to measure HIV risk and health in older South Africans
- Prevalence of anaemia and low intake of dietary nutrients in pregnant women living in rural and urban areas in the Ashanti region of Ghana
- Enhancing performance of subject-specific models via subject-independent information for SSVEP-based BCIs
- Perceptions of and interest in HIV pre-exposure prophylaxis use among adolescent girls and young women in Lilongwe, Malawi
- Long term conjugated linoleic acid supplementation modestly improved growth performance but induced testicular tissue apoptosis and reduced sperm quality in male rabbit
- A new approach to the temporal significance of house orientations in European Early Neolithic settlements
- Meta-analysis of the radiological and clinical features of Usual Interstitial Pneumonia (UIP) and Nonspecific Interstitial Pneumonia (NSIP)
- Extreme mortality and reproductive failure of common murres resulting from the northeast Pacific marine heatwave of 2014-2016
- Persistence of chikungunya ECSA genotype and local outbreak in an upper medium class neighborhood in Northeast Brazil
- Fecal transplant prevents gut dysbiosis and anxiety-like behaviour after spinal cord injury in rats
- In vivo elongation of thin filaments results in heart failure
- High resolution respirometry to assess function of mitochondria in native homogenates of human heart muscle
- Disparity in depressive symptoms between heterosexual and sexual minority men in China: The role of social support
- Effect of classroom intervention on student food selection and plate waste: Evidence from a randomized control trial
- Cytomegalovirus-specific CD8+ T-cell responses are associated with arterial blood pressure in people living with HIV
- In-depth hepatoprotective mechanistic study of Phyllanthus niruri: In vitro and in vivo studies and its chemical characterization
- Content shared on social media for national cancer survivors day 2018
- Cost-effectiveness of alectinib compared to crizotinib for the treatment of first-line ALK+ advanced non-small-cell lung cancer in France
- Mating strategy is determinant of adenovirus prevalence in European bats
- Preventing HIV and HSV-2 through knowledge and attitudes: A replication study of a multi-component community-based intervention in Zimbabwe
- MLST-based genetic relatedness of Campylobacter jejuni isolated from chickens and humans in Poland
- Unraveling the polychromy and antiquity of the Pachacamac Idol, Pacific coast, Peru
- Randomized clinical trial analyzing maintenance of peripheral venous catheters in an internal medicine unit: Heparin vs. saline
- Hypertension prevalence but not control varies across the spectrum of risk in patients with atrial fibrillation: A RE-LY atrial fibrillation registry sub-study
- Valuing natural habitats for enhancing coastal resilience: Wetlands reduce property damage from storm surge and sea level rise
- Universal coverage but unmet need: National and regional estimates of attrition across the diabetes care continuum in Thailand
- Patient-related factors may influence nursing perception of sleep in the Intensive Care Unit
- A systematic review and meta-analysis of acute kidney injury in the intensive care units of developed and developing countries
- Phylogeographic analyses point to long-term survival on the spot in micro-endemic Lycian salamanders
- A randomized trial of a behavioral intervention to decrease hospital length of stay by decreasing bedrest
- Genlisea hawkingii (Lentibulariaceae), a new species from Serra da Canastra, Minas Gerais, Brazil
- Structural variation and its potential impact on genome instability: Novel discoveries in the EGFR landscape by long-read sequencing
- Assessment of forest cover and carbon stock changes in sub-tropical pine forest of Azad Jammu & Kashmir (AJK), Pakistan using multi-temporal Landsat satellite data and field inventory
- Color image segmentation using adaptive hierarchical-histogram thresholding
- The association between nonalcoholic fatty liver disease and esophageal, stomach, or colorectal cancer: National population-based cohort study
- Effects in spite of tough constraints - A theory of change based investigation of contextual and implementation factors affecting the results of a performance based financing scheme extended to malnutrition in Burundi
- Comparison of motif-based and whole-unique-sequence-based analyses of phage display library datasets generated by biopanning of anti-Borrelia burgdorferi immune sera
- Identification of the cleavage sites leading to the shed forms of human and mouse anti-aging and cognition-enhancing protein Klotho
- Research performance and age explain less than half of the gender pay gap in New Zealand universities
- Do bumblebees have signatures? Demonstrating the existence of a speed-curvature power law in Bombus terrestris locomotion patterns
- A primary healthcare information intervention for communicating cardiovascular risk to patients with poorly controlled hypertension: The Education and Coronary Risk Evaluation (Educore) study—A pragmatic, cluster-randomized trial
- “I did not know it was a medical condition”: Predictors, severity and help seeking behaviors of women with female sexual dysfunction in the Volta region of Ghana
- The role of services content for manufacturing competitiveness: A network analysis
- Mortality and demographic recovery in early post-black death epidemics: Role of recent emigrants in medieval Dijon
- Modelling the impact of migrants on the success of the HIV care and treatment program in Botswana
- Does squatting need attention?—A dual-task study on cognitive resources in resistance exercise
- A human mission to Mars: Predicting the bone mineral density loss of astronauts
- The role of demographic history and selection in shaping genetic diversity of the Galápagos penguin (Spheniscus mendiculus)
- Attitudes towards animal study registries and their characteristics: An online survey of three cohorts of animal researchers
- Risk perception and behavioral change during epidemics: Comparing models of individual and collective learning
- Drug-target interaction prediction using Multi Graph Regularized Nuclear Norm Minimization
- A preliminary study of resting brain metabolism in treatment-resistant depression before and after treatment with olanzapine-fluoxetine combination
- Use of serum KL-6 level for detecting patients with restrictive allograft syndrome after lung transplantation
- Gait asymmetry in glucocerebrosidase mutation carriers with Parkinson’s disease
- Radioiodine therapy and Graves’ disease – Myths and reality
- pyKNEEr: An image analysis workflow for open and reproducible research on femoral knee cartilage
- Creatinine versus cystatin C for renal function-based mortality prediction in an elderly cohort: The Northern Manhattan Study
- Risk factors for third-generation cephalosporin resistant Enterobacteriaceae in gestational urine cultures: A retrospective cohort study based on centralized electronic health records
- Population-based estimates of humoral autoimmunity from the U.S. National Health and Nutrition Examination Surveys, 1960–2014
- Residential neighbourhood greenspace is associated with reduced risk of cardiovascular disease: A prospective cohort study
- Circulating CTRP9 correlates with the prevention of aortic calcification in renal allograft recipients
- Potential socioeconomic impacts from ocean acidification and climate change effects on Atlantic Canadian fisheries
- Prevention and control of cholera with household and community water, sanitation and hygiene (WASH) interventions: A scoping review of current international guidelines
- Kinematic analysis of motor learning in upper limb body-powered bypass prosthesis training
- The treeness of the tree of historical trees of life
- Female finches prefer courtship signals indicating male vigor and neuromuscular ability
- The effect of spatial position and age within an egg-clutch on embryonic development and key metabolic enzymes in two clownfish species, Amphiprion ocellaris and Amphiprion frenatus
- Egg donors’ motivations, experiences, and opinions: A survey of egg donors in South Africa
- Polymer-free sirolimus-eluting stent use in Europe and Asia: Ethnic differences in demographics and clinical outcomes
- How “simple” methodological decisions affect interpretation of population structure based on reduced representation library DNA sequencing: A case study using the lake whitefish
- The impact of translated reminder letters and phone calls on mammography screening booking rates: Two randomised controlled trials
- Application of a genetic algorithm to the keyboard layout problem
- Design and evaluation of a laboratory-based wheelchair castor testing protocol using community data
- Relationship between diabetic macular edema and choroidal layer thickness
- Evaluation of the predictive ability of ultrasound-based assessment of breast cancer using BI-RADS natural language reporting against commercial transcriptome-based tests
- A Comprehensive Data Gathering Network Architecture in Large-Scale Visual Sensor Networks
- Recovery of health-related quality of life after burn injuries: An individual participant data meta-analysis
- Modeling aggressive market order placements with Hawkes factor models
- Higher prevalence of splenic artery aneurysms in hereditary hemorrhagic telangiectasia: Vascular implications and risk factors
- Measuring the diffusion of innovations with paragraph vector topic models
- Role of ecology in shaping external nasal morphology in bats and implications for olfactory tracking
- Neandertals on the beach: Use of marine resources at Grotta dei Moscerini (Latium, Italy)
- Allergic inflammation is initiated by IL-33–dependent crosstalk between mast cells and basophils
- High expression of olfactomedin-4 is correlated with chemoresistance and poor prognosis in pancreatic cancer
- Wattpad as a resource for literary studies. Quantitative and qualitative examples of the importance of digital social reading and readers’ comments in the margins
- Constructing and influencing perceived authenticity in science communication: Experimenting with narrative
- Development and validation of a prognostic model predicting symptomatic hemorrhagic transformation in acute ischemic stroke at scale in the OHDSI network
- Immune recovery markers in a double blind clinical trial comparing dolutegravir and raltegravir based regimens as initial therapy (SPRING-2)
- A non-canonical role for p27Kip1 in restricting proliferation of corneal endothelial cells during development
- Combined fiscal policies to promote healthier diets: Effects on purchases and consumer welfare
- Estimating the impact of drug use on US mortality, 1999-2016
- Complex patterns of cell growth in the placenta in normal pregnancy and as adaptations to maternal diet restriction
- Tofu intake is inversely associated with risk of breast cancer: A meta-analysis of observational studies
- Digging the diversity of Iberian bait worms Marphysa (Annelida, Eunicidae)
- Influence of light on the infection of Aureococcus anophagefferens CCMP 1984 by a “giant virus”
- MESSAR: Automated recommendation of metabolite substructures from tandem mass spectra
- Temporal ordering of input modulates connectivity formation in a developmental neuronal network model of the cortex
- Healthy lifestyle index and its association with hypertension among community adults in Sri Lanka: A cross-sectional study
- Manual dexterity of mice during food-handling involves the thumb and a set of fast basic movements
- Research on an evolutionary game model and simulation of a cluster innovation network based on fairness preference
- Reconstructing Krassilovia mongolica supports recognition of a new and unusual group of Mesozoic conifers
- Selection of memory clinic patients for CSF biomarker assessment can be restricted to a quarter of cases by using computerized decision support, without compromising diagnostic accuracy
- From organ to cell: Multi-level telomere length assessment in patients with idiopathic pulmonary fibrosis
- Training interval in cardiopulmonary resuscitation
- Quantum isomer search
- Ultrastructure of light-activated axons following optogenetic stimulation to produce late-phase long-term potentiation
- Optimization of tissue sampling for Borrelia burgdorferi in white-footed mice (Peromyscus leucopus)
- How do critical care staff respond to organisational challenge? A qualitative exploration into personality types and cognitive processing in critical care
- Symmetric core-cohesive blockmodel in preschool children’s interaction networks
- Effects of supplemental creatine and guanidinoacetic acid on spatial memory and the brain of weaned Yucatan miniature pigs
- Predicting antibacterial activity from snake venom proteomes
- Community-Based Health Planning and Services Plus programme in Ghana: A qualitative study with stakeholders in two Systems Learning Districts on improving the implementation of primary health care
- An investigation of transportation practices in an Ontario swine system using descriptive network analysis
- Comparison of gridded precipitation datasets for rainfall-runoff and inundation modeling in the Mekong River Basin
- Functional interactions in patients with hemianopia: A graph theory-based connectivity study of resting fMRI signal
- PCR for the detection of pathogens in neonatal early onset sepsis
- Mercury and selenium concentrations in fishes of the Upper Colorado River Basin, southwestern United States: A retrospective assessment
- The effects of dual-task cognitive interference on gait and turning in Huntington’s disease
- Effects of Allium hookeri on gut microbiome related to growth performance in young broiler chickens
- Novel imaging biomarkers for mapping the impact of mild mitochondrial uncoupling in the outer retina in vivo
- Hyperkalemia treatment modalities: A descriptive observational study focused on medication and healthcare resource utilization
- Age and altitude of residence determine anemia prevalence in Peruvian 6 to 35 months old children
- Web service QoS prediction using improved software source code metrics
- Long term impact of PositiveLinks: Clinic-deployed mobile technology to improve engagement with HIV care
- Comparison of post-transplantation diabetes mellitus incidence and risk factors between kidney and liver transplantation patients
- Mothers’ oral health literacy and children’s oral health status in Pikine, Senegal: A pilot study
- A definition-by-example approach and visual language for activity patterns in engineering disciplines
- A network analysis revealed the essential and common downstream proteins related to inguinal hernia
- Use of conventional cardiac troponin assay for diagnosis of non-ST-elevation myocardial infarction: ‘The Ottawa Troponin Pathway’
- Low risk pregnancies after a cesarean section: Determinants of trial of labor and its failure
- Exploratory analysis of the potential for advanced diagnostic testing to reduce healthcare expenditures of patients hospitalized with meningitis or encephalitis
- Airway epithelial specific deletion of Jun-N-terminal kinase 1 attenuates pulmonary fibrosis in two independent mouse models
- Identification and characterization of miRNAs involved in cold acclimation of zebrafish ZF4 cells
- Research on motion planning for an indoor spray arm based on an improved potential field method
- Camera-traps are a cost-effective method for surveying terrestrial squamates: A comparison with artificial refuges and pitfall traps
- Detailed analysis of the transverse arch of hallux valgus feet with and without pain using weightbearing ultrasound imaging and precise force sensors
- The role of survivin in the progression of pancreatic ductal adenocarcinoma (PDAC) and a novel survivin-targeted therapeutic for PDAC
- Filling the human resource gap through public-private partnership: Can private, community-based skilled birth attendants improve maternal health service utilization and health outcomes in a remote region of Bangladesh?
- HIV antiretroviral drugs, dolutegravir, maraviroc and ritonavir-boosted atazanavir use different pathways to affect inflammation, senescence and insulin sensitivity in human coronary endothelial cells
- Still standing: Recent patterns of post-fire conifer refugia in ponderosa pine-dominated forests of the Colorado Front Range
- Surrogate R-spondins for tissue-specific potentiation of Wnt Signaling
- Biogeographic study of human gut-associated crAssphage suggests impacts from industrialization and recent expansion
- Apolipoprotein-AI mimetic peptides D-4F and L-5F decrease hepatic inflammation and increase insulin sensitivity in C57BL/6 mice
- Treating patients with driving phobia by virtual reality exposure therapy – a pilot study
- The impact of race relations on NFL attendance: An econometric analysis
- The potential impact of the Affordable Care Act and Medicaid expansion on reducing colorectal cancer screening disparities in African American males
- Efficient processing of raster and vector data
- Rewilding with large herbivores: Positive direct and delayed effects of carrion on plant and arthropod communities
- Early life experience and alterations of group composition shape the social grooming networks of former pet and entertainment chimpanzees (Pan troglodytes)
- Muscarinic modulation of M and h currents in gerbil spherical bushy cells
- Therapeutic hypothermia after out of hospital cardiac arrest improve 1-year survival rate for selective patients
- Carotid plaques and neurological impairment in patients with acute cerebral infarction
- Deep learning based image reconstruction algorithm for limited-angle translational computed tomography
- Subterranean Deuteraphorura Absolon, 1901, (Hexapoda, Collembola) of the Western Carpathians — Troglomorphy at the northern distributional limit in Europe
- Fragmentation and inefficiencies in US equity markets: Evidence from the Dow 30
- Association between coffee drinking and telomere length in the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial
- Hyperbaric oxygen preconditioning and the role of NADPH oxidase inhibition in postischemic acute kidney injury induced in spontaneously hypertensive rats
- Rad51 paralogs and the risk of unselected breast cancer: A case-control study
- Aqueous ethanol extract of Libidibia ferrea (Mart. Ex Tul) L.P. Queiroz (juca) exhibits antioxidant and migration-inhibiting activity in human gastric adenocarcinoma (ACP02) cells
- Diagnostic differences in respiratory breathing patterns and work of breathing indices in children with Duchenne muscular dystrophy
- The role of narrative in collaborative reasoning and intelligence analysis: A case study
- Proportions of CD4 test results indicating advanced HIV disease remain consistently high at primary health care facilities across four high HIV burden countries
- Modelling of amino acid turnover in the horse during training and racing: A basis for developing a novel supplementation strategy
- Single-modal and multi-modal false arrhythmia alarm reduction using attention-based convolutional and recurrent neural networks
- Eye-gaze information input based on pupillary response to visual stimulus with luminance modulation
- Predictive value of comb-push ultrasound shear elastography for the differentiation of reactive and metastatic axillary lymph nodes: A preliminary investigation
- Type 1 diabetes is associated with an increased risk of venous thromboembolism: A retrospective population-based cohort study
- Trends of litter decomposition and soil organic matter stocks across forested swamp environments of the southeastern US
- Post mortem evaluation of inflammation, oxidative stress, and PPARγ activation in a nonhuman primate model of cardiac sympathetic neurodegeneration
- Were ancient foxes far more carnivorous than recent ones?—Carnassial morphological evidence
- Disruption in daily eating-fasting and activity-rest cycles in Indian adolescents attending school
- Plasma proteome profiling of freshwater and seawater life stages of rainbow trout (Oncorhynchus mykiss)
- Association between baseline abundance of Peptoniphilus, a Gram-positive anaerobic coccus, and wound healing outcomes of DFUs
- The earliest farming communities north of the Carpathians: The settlement at Gwoździec site 2
- Trends of the prevalence and incidence of hypertrophic cardiomyopathy in Korea: A nationwide population-based cohort study
- Percent amplitude of fluctuation: A simple measure for resting-state fMRI signal at single voxel level
- Antimicrobial activity of Asteraceae species against bacterial pathogens isolated from postmenopausal women
- Designing information provision to serve as a reminder of altruistic benefits: A case study of the risks of air pollution caused by industrialization
- Are changes in depressive symptoms, general health and residential area socio-economic status associated with trajectories of waist circumference and body mass index?
- Extracellular vesicles of U937 macrophage cell line infected with DENV-2 induce activation in endothelial cells EA.hy926
- FlexGraph: Flexible partitioning and storage for scalable graph mining
- Post-weaning infant-to-mother bonding in nutritionally independent female mice
- A little good is good enough: Ethical consumption, cheap excuses, and moral self-licensing
- Link-centric analysis of variation by demographics in mobile phone communication patterns
- Multimodal hand gesture recognition using single IMU and acoustic measurements at wrist
- Variance based weighting of multisensory head rotation signals for verticality perception
- Eligibility for hepatitis B antiviral therapy among adults in the general population in Zambia
- Tobacco smoking and health-related quality of life among university students: Mediating effect of depression
- Drivers of the opioid crisis: An appraisal of financial conflicts of interest in clinical practice guideline panels at the peak of opioid prescribing
- Nutritional inadequacies in commercial vegan foods for dogs and cats
- LTA1 and dmLT enterotoxin-based proteins activate antigen-presenting cells independent of PKA and despite distinct cell entry mechanisms
- The Shapley value for a fair division of group discounts for coordinating cooling loads
- Comparison and evaluation of the morphology of crowns generated by biogeneric design technique with CEREC chairside system
- Assessing risk factors and impact of cyberbullying victimization among university students in Myanmar: A cross-sectional study
- Incidence of hospital-acquired pressure ulcers in patients with "minimal risk" according to the "Norton-MI" scale
- Intra-host symbiont diversity in eastern Pacific cold seep tubeworms identified by the 16S-V6 region, but undetected by the 16S-V4 region
- Lipoprotein(a) plasma levels are not associated with survival after acute coronary syndromes: An observational cohort study
- Use of Nanotrap particles for the capture and enrichment of Zika, chikungunya and dengue viruses in urine
- Pancreatic secretory trypsin inhibitor reduces multi-organ injury caused by gut ischemia/reperfusion in mice
- The effect of diet on the gastrointestinal microbiome of juvenile rehabilitating green turtles (Chelonia mydas)
- Biochemical characterization of Ty1 retrotransposon protease
- Lateral pressure equalisation as a principle for designing support surfaces to prevent deep tissue pressure ulcers
- Immunomodulatory function of the cystic fibrosis modifier gene BPIFA1
- The validation of the Beijing version of the Montreal Cognitive Assessment in Chinese patients undergoing hemodialysis
- All of gene expression (AOE): An integrated index for public gene expression databases
- Characterization of the visceral and neuronal phenotype of 4L/PS-NA mice modeling Gaucher disease
- Inflammasome expression is higher in ovarian tumors than in normal ovary
- HCV genotype profile in Brazil of mono-infected and HIV co-infected individuals: A survey representative of an entire country
- Engaging with change: Information and communication technology professionals’ perspectives on change at the mid-point in the UK/EU Brexit process
- Adherence to iron-folic acid supplement and associated factors among antenatal care attending pregnant mothers in governmental health institutions of Adwa town, Tigray, Ethiopia: Cross-sectional study
- Flower, seed, and fruit development in three Tunisian species of Polygonum: Implications for their taxonomy and evolution of distyly in Polygonaceae
- Development of a risk score for prediction of poor treatment outcomes among patients with multidrug-resistant tuberculosis
- Preclinical evaluation of AT-527, a novel guanosine nucleotide prodrug with potent, pan-genotypic activity against hepatitis C virus
- Aqueous extract from Mangifera indica Linn. (Anacardiaceae) leaves exerts long-term hypoglycemic effect, increases insulin sensitivity and plasma insulin levels on diabetic Wistar rats
- Marine seafood production via intense exploitation and cultivation in China: Costs, benefits, and risks
- Signatures of medical student applicants and academic success
- Discovery of Jogalong virus, a novel hepacivirus identified in a Culex annulirostris (Skuse) mosquito from the Kimberley region of Western Australia
- The effects of extended photoperiod and warmth on hair growth in ponies and horses at different times of year
- Modeling the effect of prolonged ethanol exposure on global gene expression and chromatin accessibility in normal 3D colon organoids
- Clinical, cytogenetic and molecular genetic characterization of a tandem fusion translocation in a male Holstein cattle with congenital hypospadias and a ventricular septal defect
- Severity of misophonia symptoms is associated with worse cognitive control when exposed to misophonia trigger sounds
- Detection of Torque Teno Virus (TTV) and TTV-Like Minivirus in patients with presumed infectious endophthalmitis in India
- CD4 rate of increase is preferred to CD4 threshold for predicting outcomes among virologically suppressed HIV-infected adults on antiretroviral therapy
- The evolution of secondary flow phenomena and their effect on primary shock conditions in shock tubes: Experimentation and numerical model
- Estimating the basic reproduction number of a pathogen in a single host when only a single founder successfully infects
- What drugs modify the risk of iatrogenic impulse-control disorders in Parkinson’s disease? A preliminary pharmacoepidemiologic study
- Evaluating emotional distress and health-related quality of life in patients with heart failure and their family caregivers: Testing dyadic dynamics using the Actor-Partner Interdependence Model
- Community- and trophic-level responses of soil nematodes to removal of a non-native tree at different stages of invasion
- Association of ECG parameters with late gadolinium enhancement and outcome in patients with clinical suspicion of acute or subacute myocarditis referred for CMR imaging
- Sonographic measurement of normal common bile duct diameter and associated factors at the University of Gondar comprehensive specialized hospital and selected private imaging center in Gondar town, North West Ethiopia
- Catchment-scale export of antibiotic resistance genes and bacteria from an agricultural watershed in central Iowa
- Impact of multi-drug resistant bacteria on economic and clinical outcomes of healthcare-associated infections in adults: Systematic review and meta-analysis
- Characterization of a universal screening approach for congenital CMV infection based on a highly-sensitive, quantitative, multiplex real-time PCR assay
- Proof-of-concept for a non-invasive, portable, and wireless device for cardiovascular monitoring in pediatric patients
- On PTV definition for glioblastoma based on fiber tracking of diffusion tensor imaging data
- Multiregional origins of the domesticated tetraploid wheats
- Racism against Totonaco women in Veracruz: Intercultural competences for health professionals are necessary
- Increased inflammation and endothelial markers in patients with late severe post-thrombotic syndrome
- Genes associated with body weight gain and feed intake identified by meta-analysis of the mesenteric fat from crossbred beef steers
- Intraoperative computed tomography imaging for dose calculation in intraoperative electron radiation therapy: Initial clinical observations
- Multiple paedomorphic lineages of soft-substrate burrowing invertebrates: parallels in the origin of Xenocratena and Xenoturbella
- Human lung epithelial BEAS-2B cells exhibit characteristics of mesenchymal stem cells
- Simple non-mydriatic retinal photography is feasible and demonstrates retinal microvascular dilation in Chronic Obstructive Pulmonary Disease (COPD)
- Evaluating poverty alleviation strategies in a developing country
- RNAmountAlign: Efficient software for local, global, semiglobal pairwise and multiple RNA sequence/structure alignment
- Maternal depressive symptoms and children’s cognitive development: Does early childcare and child’s sex matter?
- Pan-cancer analysis of somatic mutations and epigenetic alterations in insulated neighbourhood boundaries
- Evaluation of a bioengineered ACL matrix’s osteointegration with BMP-2 supplementation
- Psychosocial profiles of physical activity fluctuation in office employees: A latent profile analysis
- Prevalence and characteristics of Livestock-Associated Methicillin-Resistant Staphylococcus aureus (LA-MRSA) isolated from chicken meat in the province of Quebec, Canada
- HIV treatment response among female sex workers participating in a treatment as prevention demonstration project in Cotonou, Benin
- Soluble AXL as a marker of disease progression and survival in melanoma
- Using machine learning methods to determine a typology of patients with HIV-HCV infection to be treated with antivirals
- Quantifying tourism booms and the increasing footprint in the Arctic with social media data
- Gender differences influence over insomnia in Korean population: A cross-sectional study
- Impact of scion/rootstock reciprocal effects on metabolomics of fruit juice and phloem sap in grafted Citrus reticulata
- Adapting cognitive diagnosis computerized adaptive testing item selection rules to traditional item response theory
- Usability assessment of seven HIV self-test devices conducted with lay-users in Johannesburg, South Africa
- Autumn shifts in cold tolerance metabolites in overwintering adult mountain pine beetles
- Management of veterinary anaesthesia in small animals: A survey of current practice in Quebec
- Genetic structure of the European hedgehog (Erinaceus europaeus) in Denmark
- Molecular karyotyping of Siberian wild rye (Elymus sibiricus L.) with oligonucleotide fluorescence in situ hybridization (FISH) probes
- Umbilical cord separation time, predictors and healing complications in newborns with dry care
- The strain distribution in the lumbar anterior longitudinal ligament is affected by the loading condition and bony features: An in vitro full-field analysis
- Marine resource congestion in China: Identifying, measuring, and assessing its impact on sustainable development of the marine economy
- Analysis of attitudinal components towards statistics among students from different academic degrees
- Effects of fatigue induced by repeated-sprint on kicking accuracy and velocity in female soccer players
- A pre-clinical validation plan to evaluate analytical sensitivities of molecular diagnostics such as BD MAX MDR-TB, Xpert MTB/Rif Ultra and FluoroType MTB
- Leadership for success in transforming medical abortion policy in Canada
- Clinical correlates associated with the long-term response of bipolar disorder patients to lithium, valproate or lamotrigine: A retrospective study
- Determinants of change in long-acting or permanent contraceptives use in Ethiopia; A multivariate decomposition analysis of data from the Ethiopian demographic and health survey
- Forecasting stock prices with long-short term memory neural network based on attention mechanism
- On the genus Crossaster (Echinodermata: Asteroidea) and its distribution
- Intracellular and in vivo evaluation of imidazo[2,1-b]thiazole-5-carboxamide anti-tuberculosis compounds
- Serum amyloid P component promotes formation of distinct aggregated lysozyme morphologies and reduces toxicity in Drosophila flies expressing F57I lysozyme
- Optogenetically induced cellular habituation in non-neuronal cells
- An integrated vitamin E-coated polymer hybrid nanoplatform: A lucrative option for an enhanced in vitro macrophage retention for an anti-hepatitis B therapeutic prospect
- The effect of strontium and silicon substituted hydroxyapatite electrochemical coatings on bone ingrowth and osseointegration of selective laser sintered porous metal implants
- Modeling the Theory of Planned Behaviour to predict adherence to preventive dental visits in preschool children
- Molecular prevalence of Bartonella, Babesia, and hemotropic Mycoplasma species in dogs with hemangiosarcoma from across the United States
- Color discrimination and gas chromatography-mass spectrometry fingerprint based on chemometrics analysis for the quality evaluation of Schizonepetae Spica
- Comparisons of recurrence-free survival and overall survival between microwave versus radiofrequency ablation treatment for hepatocellular carcinoma: A multiple centers retrospective cohort study with propensity score matching
- Transcriptome-wide identification of novel circular RNAs in soybean in response to low-phosphorus stress
- Oral misoprostol, low dose vaginal misoprostol, and vaginal dinoprostone for labor induction: Randomized controlled trial
- The association between dietary patterns before and in early pregnancy and the risk of gestational diabetes mellitus (GDM): Data from the Malaysian SECOST cohort
- Gene expression noise in a complex artificial toxin expression system
- Dynamic Extreme Aneuploidy (DEA) in the vegetable pathogen Phytophthora capsici and the potential for rapid asexual evolution
- Assertive, trainable and older dogs are perceived as more dominant in multi-dog households
- Prediction of Uropathogens by Flow Cytometry and Dip-stick Test Results of Urine Through Multivariable Logistic Regression Analysis
- Accelerated brain aging towards transcriptional inversion in a zebrafish model of the K115fs mutation of human PSEN2
- Copper to Tuscany – Coals to Newcastle? The dynamics of metalwork exchange in early Italy
- The Brazilian TP53 mutation (R337H) and sarcomas
- Interleukin 6 is increased in preclinical HNSCC models of acquired cetuximab resistance, but is not required for maintenance of resistance
- Detection of amitraz resistance and reduced treatment efficacy in the Varroa Mite, Varroa destructor, within commercial beekeeping operations
- Impact of viral disease hypophagia on pig jejunal function and integrity
- Enzyme response of activated sludge to a mixture of emerging contaminants in continuous exposure
- Molecular evidence for horizontal transmission of chelonid alphaherpesvirus 5 at green turtle (Chelonia mydas) foraging grounds in Queensland, Australia
- Technology anxiety and resistance to change behavioral study of a wearable cardiac warming system using an extended TAM for older adults
- Evaluation and validation of 2D biomechanical models of the knee for radiograph-based preoperative planning in total knee arthroplasty
- Soil-Transmitted Helminth infections reduction in Bhutan: A report of 29 years of deworming
- Age-related differences in the temporal dynamics of spectral power during memory encoding
- cagA gene EPIYA motif genetic characterization from Colombian Helicobacter pylori isolates: Standardization of a molecular test for rapid clinical laboratory detection
- Mugharat an-Nachcharini: A specialized sheep-hunting camp reveals high-altitude habitats in the earliest Neolithic of the Central Levant
- Spectral characteristics of urine from patients with end-stage kidney disease analyzed using Raman Chemometric Urinalysis (Rametrix)
- Clinicians’ communication with patients receiving a MCI diagnosis: The ABIDE project
- Quantitative PCR provides a simple and accessible method for quantitative microbiota profiling
- Fast quantitative time lapse displacement imaging of endothelial cell invasion
- Two novel mutations in MSX1 causing oligodontia
- 7,200 years old constructions and mudbrick technology: The evidence from Tel Tsaf, Jordan Valley, Israel
- Tuberculosis recurrences and predictive factors in a vulnerable population in Catalonia
- Dome-shaped macula in children and adolescents
- Barriers in the access, diagnosis and treatment completion for tuberculosis patients in central and western Nepal: A qualitative study among patients, community members and health care workers
- Evaluation of KRAS, NRAS and BRAF mutations detection in plasma using an automated system for patients with metastatic colorectal cancer
- Targeted transcriptomic study of the implication of central metabolic pathways in mannosylerythritol lipids biosynthesis in Pseudozyma antarctica T-34
- Preliminary evidences of the presence of extracellular DNA single stranded forms in soil
- A comparison of quality of life between patients treated with different dialysis modalities in Taiwan
- The effectiveness of substance use interventions for homeless and vulnerably housed persons: A systematic review of systematic reviews on supervised consumption facilities, managed alcohol programs, and pharmacological agents for opioid use disorder
- Spatiotemporal characteristics and driving forces of construction land expansion in Yangtze River economic belt, China
- Comparison of Monocyte Distribution Width (MDW) and Procalcitonin for early recognition of sepsis
- Morphological association between the muscles and bones in the craniofacial region
- Transcriptome analysis of Actinidia chinensis in response to Botryosphaeria dothidea infection
- Evaluating two decision aids for Australian men supporting informed decisions about prostate cancer screening: A randomised controlled trial
- Serum galectins as potential biomarkers of inflammatory bowel diseases
- Linguistic Z-number weighted averaging operators and their application to portfolio selection problem
- Comparative study on skin protection activity of polyphenol-rich extract and polysaccharide-rich extract from Sargassum vachellianum
- Real-world data about emotional stress, disability and need for social care in a German IBD patient cohort
- The regenerative compatibility: A synergy between healthy ecosystems, environmental attitudes, and restorative experiences
- Fusion of augmented reality imaging with the endoscopic view for endonasal skull base surgery; a novel application for surgical navigation based on intraoperative cone beam computed tomography and optical tracking
- Functional characterization of NK cells in Mexican pediatric patients with acute lymphoblastic leukemia: Report from the Mexican Interinstitutional Group for the Identification of the Causes of Childhood Leukemia
- Radiomics signature for prediction of lateral lymph node metastasis in conventional papillary thyroid carcinoma
- Antenatal depression and its association with adverse birth outcomes in low and middle-income countries: A systematic review and meta-analysis
- Perceptions of risk and influences of choice in pregnant women with obesity. An evidence synthesis of qualitative research
- The role of refugee and migrant migration status on medication adherence: Mediation through illness perceptions
- Job stress and emotional exhaustion at work in Spanish workers: Does unhealthy work affect the decision to drive?
- Correction: Amphibians on the hotspot: Molecular biology and conservation in the South American Atlantic Rainforest
- Sexual risk classes among youth experiencing homelessness: Relation to childhood adversities, current mental symptoms, substance use, and HIV testing
- Time for change is now: Experiences of participants in a community-based approach for iron and folic acid supplementation in a rural county in Kenya, a qualitative study
- Non-invasive genetic monitoring for the threatened valley elderberry longhorn beetle
- Statistical learning for turboshaft helicopter accidents using logistic regression
- Vegetation change over seven years in the largest protected Pacific Northwest Bunchgrass Prairie remnant
- The effect of various metal-salts on the sedimentation of soil in a water-based suspension
- Using electronic health record system triggers to target delivery of a patient-centered intervention to improve venous thromboembolism prevention for hospitalized patients: Is there a differential effect by race?
- Effects of CK2β subunit down-regulation on Akt signalling in HK-2 renal cells
- Novel broad-spectrum activity-based probes to profile malarial cysteine proteases
- Health-related quality of life in cancer patients treated with immune checkpoint inhibitors: A systematic review on reporting of methods in randomized controlled trials
- Environmental tobacco smoke (ETS) and hyperlipidemia modified by perceived work stress
- Association between opioid analgesic therapy and initiation of buprenorphine management: An analysis of prescription drug monitoring program data
- Effect of a community-based approach of iron and folic acid supplementation on compliance by pregnant women in Kiambu County, Kenya: A quasi-experimental study
- Radiocarbon dating of two old African baobabs from India
- Improvement project in higher education institutions: A BPEP-based model
- An updated evaluation of serum sHER2, CA15.3, and CEA levels as biomarkers for the response of patients with metastatic breast cancer to trastuzumab-based therapies
- Genome-wide association study of metabolic syndrome in Korean populations
- The diagnostic accuracy of liver fibrosis in non-viral liver diseases using acoustic radiation force impulse elastography: A systematic review and meta-analysis
- Drug therapy problems and treatment satisfaction among ambulatory patients with epilepsy in a specialized hospital in Ethiopia
- Short- & long-term effects of monetary and non-monetary incentives to cooperate in public good games: An experiment
- Niche modeling reveals life history shifts in birds at La Brea over the last twenty millennia
- Morphological consequences of artificial cranial deformation: Modularity and integration
- Distributed flux balance analysis simulations of serial biomass fermentation by two organisms
- Plasma kynurenines and prognosis in patients with heart failure
- Occurrence and distribution of anthropogenic persistent organic pollutants in coastal sediments and mud shrimps from the wetland of central Taiwan
- Intensified visual clutter induces increased sympathetic signalling, poorer postural control, and faster torsional eye movements during visual rotation
- Restoration of cortical symmetry and binaural function: Cortical auditory evoked responses in adult cochlear implant users with single sided deafness
- A smartphone-enabled wireless and batteryless implantable blood flow sensor for remote monitoring of prosthetic heart valve function
- Gut microbiota composition alterations are associated with the onset of diabetes in kidney transplant recipients
- Shock index and TIMI risk index as valuable prognostic tools in patients with acute coronary syndrome complicated by cardiogenic shock
- Merit overrules theory of mind when young children share resources with others
- Economic burden of maternal morbidity – A systematic review of cost-of-illness studies
- Comparison of balance changes after inspiratory muscle or Otago exercise training
- Correction: Escherichia coli and Salmonella spp. isolated from Australian meat chickens remain susceptible to critically important antimicrobial agents
- Metabolic analysis of amino acids and vitamin B6 pathways in lymphoma survivors with cancer related chronic fatigue
- Cell-free DNA donor fraction analysis in pediatric and adult heart transplant patients by multiplexed allele-specific quantitative PCR: Validation of a rapid and highly sensitive clinical test for stratification of rejection probability
- Immunopathogenesis of canine chronic ulcerative stomatitis
- Correction: Quantification of speech and synchrony in the conversation of adults with autism spectrum disorder
- Efficacy and safety of ultrasonic circular cyclocoagulation with second-generation probe in glaucoma: A retrospective study
- Generalizing findings from a randomized controlled trial to a real-world study of the iLookOut, an online education program to improve early childhood care and education providers’ knowledge and attitudes about reporting child maltreatment
- Self-selection of food ingredients and agricultural by-products by the house cricket, Acheta domesticus (Orthoptera: Gryllidae): A holistic approach to develop optimized diets
- Machine learning detection of Atrial Fibrillation using wearable technology
- Comparative proteomic analysis of different stages of breast cancer tissues using ultra high performance liquid chromatography tandem mass spectrometer
- A cross-sectional study of psychopathy and khat abuse among prisoners in the correctional institution in Jimma, Ethiopia
- Head impulse compensatory saccades: Visual dependence is most evident in bilateral vestibular loss
- Complementarity of empirical and process-based approaches to modelling mosquito population dynamics with Aedes albopictus as an example—Application to the development of an operational mapping tool of vector populations
- Pepsin promotes laryngopharyngeal neoplasia by modulating signaling pathways to induce cell proliferation
- When and what to test for: A cost-effectiveness analysis of febrile illness test-and-treat strategies in the era of responsible antibiotic use
- Comparison of effects and safety in providing controlled hypotension during surgery between dexmedetomidine and magnesium sulphate: A meta-analysis of randomized controlled trials
- The gene encoding the ketogenic enzyme HMGCS2 displays a unique expression during gonad development in mice
- Seroepidemiological study of rubella in Vojvodina, Serbia: 24 years after the introduction of the MMR vaccine in the national immunization programme
- Efficacy of a mitochondrion-targeting agent for reducing the level of urinary protein in rats with puromycin aminonucleoside-induced minimal-change nephrotic syndrome
- Association of endothelial nitric oxide synthase (NOS3) gene polymorphisms with primary open-angle glaucoma in a Saudi cohort
- Antitrust analysis with upward pricing pressure and cost efficiencies
- Machine learning models for identifying preterm infants at risk of cerebral hemorrhage
- Natural selection contributes to food web stability
- Pyramiding QTLs controlling tolerance against drought, salinity, and submergence in rice through marker assisted breeding
- Diversity and plant growth-promoting functions of diazotrophic/N-scavenging bacteria isolated from the soils and rhizospheres of two species of Solanum
- Sustainability effects of motor control stabilisation exercises on pain and function in chronic nonspecific low back pain patients: A systematic review with meta-analysis and meta-regression
- Sofosbuvir-based regimen for genotype 2 HCV infected patients in Taiwan: A real world experience
- The virulence domain of Shigella IcsA contains a subregion with specific host cell adhesion function
- Sequencing artifacts derived from a library preparation method using enzymatic fragmentation
- Analysis of the Rdr1 gene family in different Rosaceae genomes reveals an origin of an R-gene cluster after the split of Rubeae within the Rosoideae subfamily
- Concomitant phytonutrient and transcriptome analysis of mature fruit and leaf tissues of tomato (Solanum lycopersicum L. cv. Oregon Spring) grown using organic and conventional fertilizer
- Quantitative analysis of adsorption and desorption of volatile organic compounds on reusable zeolite filters using gas chromatography
- Comparing bioinformatic pipelines for microbial 16S rRNA amplicon sequencing
- TMEM98 is a negative regulator of FRAT mediated Wnt/ß-catenin signalling
- Modeling migration patterns in the USA under sea level rise
- Quo vadis Pantanal? Expected precipitation extremes and drought dynamics from changing sea surface temperature
- Cloud-computing and machine learning in support of country-level land cover and ecosystem extent mapping in Liberia and Gabon
- An exploratory study on the quality of patient screening and counseling for hypertension management in Tanzania
- Relation of fibroblast growth factor receptor 2 expression to hepatocellular carcinoma recurrence after liver resection
- The Brief Measure of Emotional Preoperative Stress (B-MEPS) as a new predictive tool for postoperative pain: A prospective observational cohort study
- The impact of diabetes mellitus medication on the incidence of endogenous endophthalmitis
- Correction: Chl1 DNA helicase and Scc2 function in chromosome condensation through cohesin deposition
- Clinical and pathological features of thrombotic microangiopathy influencing long-term kidney transplant outcomes
- Multidisciplinary investigation of two Egyptian child mummies curated at the University of Tartu Art Museum, Estonia (Late/Graeco-Roman Periods)
- Occupational exposure to particulate matter from air pollution in the outdoor workplaces in Almaty during the cold season
- Morphological adjustment in free-living Steinernema feltiae infective juveniles to increasing concentration of Nemafric-BL phytonematicide
- Murine Surf4 is essential for early embryonic development
- Using mHealth to improve health care delivery in India: A qualitative examination of the perspectives of community health workers and beneficiaries
- Algorithmic handwriting analysis of the Samaria inscriptions illuminates bureaucratic apparatus in biblical Israel
- Key necroptotic proteins are required for Smac mimetic-mediated sensitization of cholangiocarcinoma cells to TNF-α and chemotherapeutic gemcitabine-induced necroptosis
- Concurrent lipidomics and proteomics on malignant plasma cells from multiple myeloma patients: Probing the lipid metabolome
- Short treatment with antalarmin alters adrenal gland receptors in the rat model of endometriosis
- Is it really always only the others who are to blame? GP’s view on medical overuse. A questionnaire study
- Serum visfatin and vaspin levels in hepatocellular carcinoma (HCC)
- Retraction: SDR9C7 Promotes Lymph Node Metastases in Patients with Esophageal Squamous Cell Carcinoma
- iTRAQ proteomics reveals the regulatory response to Magnaporthe oryzae in durable resistant vs. susceptible rice genotypes
- A smartphone-based test for the assessment of attention deficits in delirium: A case-control diagnostic test accuracy study in older hospitalised patients
- Association between tuberculosis and depression on negative outcomes of tuberculosis treatment: A systematic review and meta-analysis
- Incidence and predictors of loss to follow up among adult HIV patients on antiretroviral therapy in University of Gondar Comprehensive Specialized Hospital: A competing risk regression modeling
- Point-of-care diagnostic (POCD) method for detecting Bursaphelenchus xylophilus in pinewood using recombinase polymerase amplification (RPA) with the portable optical isothermal device (POID)
- Bioluminescent imaging of Arabidopsis thaliana using an enhanced Nano-lantern luminescence reporter system
- Biosynthetic pathway of indole-3-acetic acid in ectomycorrhizal fungi collected from northern Thailand
- Clinical implications of elevated serum interleukin-6 in IgG4-related disease
- Downscaling NLDAS-2 daily maximum air temperatures using MODIS land surface temperatures
- Sex-specific and opposite modulatory aspects revealed by PPI network and pathway analysis of ischemic stroke in humans
- Plasma Trimethylamine-N-oxide and impaired glucose regulation: Results from The Oral Infections, Glucose Intolerance and Insulin Resistance Study (ORIGINS)
- Self-esteem and other risk factors for depressive symptoms among adolescents in United Arab Emirates
- Control of the microsporidian parasite Nosema ceranae in honey bees (Apis mellifera) using nutraceutical and immuno-stimulatory compounds
- The effect of storage conditions on microbial communities in stool
- Role of donor genotype in RT-QuIC seeding activity of chronic wasting disease prions using human and bank vole substrates
- Influence of flow on phosphorus-dynamics and particle size in agricultural drainage ditch sediments
- A prospective, randomized, double-blind trial to compare body weight-adjusted and fixed doses of palonosetron for preventing postoperative nausea and vomiting in obese female patients
- Application of computerized 3D-CT texture analysis of pancreas for the assessment of patients with diabetes
- Predictive validation and forecasts of short-term changes in healthcare expenditure associated with changes in smoking behavior in the United States
- An information-based approach to handle various types of uncertainty in fuzzy bodies of evidence
- Oral magnesium supplementation for leg cramps in pregnancy—An observational controlled trial
- Health care professionals’ knowledge of commonly used sedative, analgesic and neuromuscular drugs: A single center (Rambam Health Care Campus), prospective, observational survey
- Campylobacter portucalensis sp. nov., a new species of Campylobacter isolated from the preputial mucosa of bulls
- OGG1 deficiency alters the intestinal microbiome and increases intestinal inflammation in a mouse model
- Transgenic interleukin 11 expression causes cross-tissue fibro-inflammation and an inflammatory bowel phenotype in mice
- Novel method to measure temporal windows based on eye movements during viewing of the Necker cube
- Whole blood transcriptomic analysis of beef cattle at arrival identifies potential predictive molecules and mechanisms that indicate animals that naturally resist bovine respiratory disease
- Effects of smoke flavoring using different wood chips and barbecuing on the formation of polycyclic aromatic hydrocarbons and heterocyclic aromatic amines in salmon fillets
- Sleep quality and sex modify the relationships between trait energy and fatigue on state energy and fatigue
- The role of peer, parental, and school norms in predicting adolescents’ attitudes and behaviours of majority and different minority ethnic groups in Croatia
- Filtered beauty in Oslo and Tokyo: A spatial frequency analysis of facial attractiveness
- The impact of rehabilitation frequency on the risk of stroke in patients with rheumatoid arthritis
- Availability, prices and affordability of selected antibiotics and medicines against non-communicable diseases in western Cameroon and northeast DR Congo
- The effect of mutations derived from mouse-adapted H3N2 seasonal influenza A virus to pathogenicity and host adaptation
- Detection of posttraumatic pneumothorax using electrical impedance tomography—An observer-blinded study in pigs with blunt chest trauma
- Educators’ perceptions of organisational readiness for implementation of a pre-adolescent transdisciplinary school health intervention for inter-generational outcomes
- Beyond the heterodimer model for mineralocorticoid and glucocorticoid receptor interactions in nuclei and at DNA
- The effects of sport expertise and shot results on basketball players’ action anticipation
- Framework and algorithms for identifying honest blocks in blockchain
- Efficacy and safety of anti-viral therapy for Hepatitis B virus-associated glomerulonephritis: A meta-analysis
- Selective transmission of some HIV-1 subtype C variants might depend on Envelope stimulating dendritic cells to secrete IL-10
- Noise reduction and quantification of fiber orientations in greyscale images
- Exploring the impact of terminology differences in blood and organ donor decision making
- Ontogenetic similarities between giraffe and sauropod neck osteological mobility
- Load transfer mechanism and critical length of anchorage zone for anchor bolt
- Income inequalities in stroke incidence and mortality: Trends in stroke-free and stroke-affected life years based on German health insurance data
- Community’s perception, experiences and health seeking behavior towards newborn illnesses in Debre Libanos District, North Shoa, Oromia, Ethiopia: Qualitative study
- Platelet indices significantly correlate with liver fibrosis in HCV-infected patients
- Reanalysis of the Bridge et al. study of suicide following release of 13 Reasons Why
- Validation of the easyscreen flavivirus dengue alphavirus detection kit based on 3base amplification technology and its application to the 2016/17 Vanuatu dengue outbreak
- The nitrate content of fresh and cooked vegetables and their health-related risks
- Bioreactor for mobilization of mesenchymal stem/stromal cells into scaffolds under mechanical stimulation: Preliminary results
- Serotonin transporter dependent modulation of food-seeking behavior
- Implicit task switching in Parkinson’s disease is preserved when on medication
- Root treatment with oxathiapiprolin, benthiavalicarb or their mixture provides prolonged systemic protection against oomycete foliar pathogens
- Real-world effectiveness and safety of ranibizumab for the treatment of myopic choroidal neovascularization: Results from the LUMINOUS study
- Non-gradient and genotype-dependent patterns of RSV gene expression
- Multiplex real-time PCR for the detection of Clavibacter michiganensis subsp. michiganensis, Pseudomonas syringae pv. tomato and pathogenic Xanthomonas species on tomato plants
- The 24-hour urinary cortisol in post-traumatic stress disorder: A meta-analysis
- Parasites modulate the gut-microbiome in insects: A proof-of-concept study
- The dynamics of shapes of vesicle membranes with time dependent spontaneous curvature
- Vascularization and biocompatibility of poly(ε-caprolactone) fiber mats for rotator cuff tear repair
- The shield of self-compassion: A buffer against disordered eating risk from physical appearance perfectionism
- Disease-specific out-of-pocket healthcare expenditure in urban Bangladesh: A Bayesian analysis
- Advanced biofilm analysis in streams receiving organic deicer runoff
- Upregulation of long non-coding RNA ROR1-AS1 promotes cell growth and migration in bladder cancer by regulation of miR-504
- Method development and validation for rapid identification of epigallocatechin gallate using ultra-high performance liquid chromatography
- Neonatal sepsis in Iran: A systematic review and meta-analysis on national prevalence and causative pathogens
- Drug-eluting versus bare-metal stents for first myocardial infarction in patients with atrial fibrillation: A nationwide population-based cohort study
- Same-day antiretroviral therapy initiation for HIV-infected adults in South Africa: Analysis of routine data
- Health-related quality of life among patients with type 2 diabetes mellitus in Eastern Province, Saudi Arabia: A cross-sectional study
- Photocatalytic biocidal effect of copper doped TiO2 nanotube coated surfaces under laminar flow, illuminated with UVA light on Legionella pneumophila
- The interoceptive hippocampus: Mouse brain endocrine receptor expression highlights a dentate gyrus (DG)–cornu ammonis (CA) challenge–sufficiency axis
- Educational attainment and HIV testing and counselling service utilisation during antenatal care in Ghana: Analysis of Demographic and Health Surveys
- Dissection of flag leaf metabolic shifts and their relationship with those occurring simultaneously in developing seed by application of non-targeted metabolomics
- Centromeres of Cucumis melo L. comprise Cmcent and two novel repeats, CmSat162 and CmSat189
- Acute high-intensity and moderate-intensity interval exercise do not change corticospinal excitability in low fit, young adults
- “I like the way I am, but I feel like I could get a little bit bigger”: Perceptions of body image among adolescents and youth living with HIV in Durban, South Africa
- Nanoparticle-based ‘turn-on’ scattering and post-sample fluorescence for ultrasensitive detection of water pollution in wider window
- The relationship of moral sensitivity and patient safety attitudes with nursing students’ perceptions of disclosure of patient safety incidents: A cross-sectional study
- Insights into the strategy of micro-environmental adaptation: Transcriptomic analysis of two alvinocaridid shrimps at a hydrothermal vent
- Thirty-day readmission after medical-surgical hospitalization for people who experience imprisonment in Ontario, Canada: A retrospective cohort study
- The effect of long-term brine discharge from desalination plants on benthic foraminifera
- Hyper-spectral response and estimation model of soil degradation in Kenli County, the Yellow River Delta
- Prescribing trends of glaucoma drugs in six major cities of China from 2013 to 2017
- Significant changes in synovial fluid microRNAs after high tibial osteotomy in medial compartmental knee osteoarthritis: Identification of potential prognostic biomarkers
- Reassortment and adaptive mutations of an emerging avian influenza virus H7N4 subtype in China
- Ischemia and reperfusion injury in superficial inferior epigastric artery-based vascularized lymph node flaps
- High failure rates of protease inhibitor-based antiretroviral treatment in rural Tanzania – A prospective cohort study
- Switchable resolution in soft x-ray tomography of single cells
- Mitochondrial DNA variations and mitochondrial dysfunction in Fanconi anemia
- Extended-spectrum beta-lactamase (ESBL)-producing and non-ESBL-producing Escherichia coli isolates causing bacteremia in the Netherlands (2014 – 2016) differ in clonal distribution, antimicrobial resistance gene and virulence gene content
- Molecular characterization of blaKHM-1 encoding plasmid in an Enterobacter hormaechei subsp. hoffmannii isolate from blood culture
- PR3 levels are impaired in plasma and PBMCs from Arabs with cardiovascular diseases
- Sex differences in self-regulation in early, middle and late adolescence: A large-scale cross-sectional study
- Interaction between elevated temperature and different types of Na-salicylate treatment in Brachypodium dystachion
- A highway crash risk assessment method based on traffic safety state division
- A brain connectivity characterization of children with different levels of mathematical achievement based on graph metrics
- Quantifying the level of difficulty to treat major depressive disorder with antidepressants: Treatment Resistance to Antidepressants Evaluation Scale
- Occupational gender segregation and economic growth in U.S. local labor markets, 1980 through 2010
- The association of telomere length and telomerase activity with adverse outcomes in older patients with non-ST-elevation acute coronary syndrome
- Construction of a high-density genetic map and fine mapping of a candidate gene locus for a novel branched-spike mutant in barley
- Alterations of aqueous humor Aβ levels in Aβ-infused and transgenic mouse models of Alzheimer disease
- Parameters impacting the live birth rate per transfer after frozen single euploid blastocyst transfer
- Deep2Full: Evaluating strategies for selecting the minimal mutational experiments for optimal computational predictions of deep mutational scan outcomes
- Economic compensation interventions to increase uptake of voluntary medical male circumcision for HIV prevention: A systematic review and meta-analysis
- Distinctive effect of anesthetics on the effect of limb remote ischemic postconditioning following ischemic stroke
- Natural hybridization between Phyllagathis and Sporoxeia species produces a hybrid without reproductive organs
- Preliminary evaluation of a novel nine-biomarker profile for the prediction of autism spectrum disorder
- The impact of peer attachment on prosocial behavior, emotional difficulties and conduct problems in adolescence: The mediating role of empathy
- Spatial and climatic variables independently drive elevational gradients in ant species richness in the Eastern Himalaya
- What is the qualitative evidence concerning the risks, diagnosis, management and consequences of gastrointestinal infections in the community in the United Kingdom? A systematic review and meta-ethnography
- Naringenin protects AlCl3/D-galactose induced neurotoxicity in rat model of AD via attenuation of acetylcholinesterase levels and inhibition of oxidative stress
- Key barriers and enablers associated with uptake and continuation of oral pre-exposure prophylaxis (PrEP) in the public sector in Zimbabwe: Qualitative perspectives of general population clients at high risk for HIV
- Characterizing the University of California’s tenure-track teaching position from the faculty and administrator perspectives
- Restoration of Mal overcomes the defects of apoptosis in lung cancer cells
- Patient preferences for maintenance therapy in Crohn’s disease: A discrete-choice experiment
- Diagnostic performance of serum interferon gamma, matrix metalloproteinases, and periostin measurements for pulmonary tuberculosis in Japanese patients with pneumonia
- Hesperidin improves insulin resistance via down-regulation of inflammatory responses: Biochemical analysis and in silico validation
- Accuracy of intraocular lens power calculation formulas using a swept-source optical biometer
- Characterization of black patina from the Tiber River embankments using Next-Generation Sequencing
- Comparison of blood lactate and perceived exertion responses in two matched time-under-tension protocols
- Fibrin hydrogels are safe, degradable scaffolds for sub-retinal implantation
- Post-translational modifications of Drosophila melanogaster HOX protein, Sex combs reduced
- Problem gambling, associations with comorbid health conditions, substance use, and behavioural addictions: Opportunities for pathways to treatment
- Liganded T3 receptor β2 inhibits the positive feedback autoregulation of the gene for GATA2, a transcription factor critical for thyrotropin production
- Characterization of METTL16 as a cytoplasmic RNA binding protein
- Impact of long-term storage and freeze-thawing on eight circulating microRNAs in plasma samples
- Nanosheet wrapping-assisted coverslip-free imaging for looking deeper into a tissue at high resolution
- Assessment of dynamic cerebral autoregulation in humans: Is reproducibility dependent on blood pressure variability?
- Early diagnosis of sepsis in emergency departments, time to treatment, and association with mortality: An observational study
- Validity of cerebrovascular ICD-9-CM codes in healthcare administrative databases. The Umbria Data-Value Project
- Tuberculoid leprosy: An in vivo microvascular evaluation of cutaneous lesions
- Neuromuscular blockers in the acute respiratory distress syndrome: A meta-analysis
- Identification of putative Type-I sex pheromone biosynthesis-related genes expressed in the female pheromone gland of Streltzoviella insularis
- Redefining transcriptional regulation of the APOE gene and its association with Alzheimer’s disease
- Disease-relevant mutations alter amino acid co-evolution networks in the second nucleotide binding domain of CFTR
- A bushel of viruses: Identification of seventeen novel putative viruses by RNA-seq in six apple trees
- Torque teno virus viral load is related to age, CMV infection and HLA type but not to Alzheimer's disease
- The variability of bacterial communities in both the endosphere and ectosphere of different niches in Chinese chives (Allium tuberosum)
- Tripartite factors leading to molecular divergence between human and murine smooth muscle
- Characterization of dermal skin innervation in fibromyalgia syndrome
- A neonatal nonhuman primate model of gestational Zika virus infection with evidence of microencephaly, seizures and cardiomyopathy
- A scoping review of importation and predictive models related to vector-borne diseases, pathogens, reservoirs, or vectors (1999–2016)
- Assessment of climate change impact on the malaria vector Anopheles hyrcanus, West Nile disease, and incidence of melanoma in the Vojvodina Province (Serbia) using data from a regional climate model
- Associations of cigarette smoking and burden of thoracic aortic calcification in asymptomatic individuals: A dose-response relationship
- Healthcare utilization of Mexican-American Medicare beneficiaries with and without Alzheimer’s disease and related dementias
- Evaluation of questionnaire as an instrument to measure the level of nutritional and weight gain knowledge in pregnant women in Poland. A pilot study
- TranCEP: Predicting the substrate class of transmembrane transport proteins using compositional, evolutionary, and positional information
- Non-Invasive Functional-Brain-Imaging with an OPM-based Magnetoencephalography System
- Expression of acyl-CoA-binding protein 5 from Rhodnius prolixus and its inhibition by RNA interference
- Transforming assessment of speech in children with cleft palate via online crowdsourcing
- High prevalence of off-label and unlicensed paediatric prescribing in a hospital in Indonesia during the period Aug.—Oct. 2014
- General practice management of rotator cuff related shoulder pain: A reliance on ultrasound and injection guided care
- Estimating the population size of female sex workers and transgender women in Sri Lanka
- Can helmet decrease mortality of craniocerebral trauma patients in a motorcycle accident?: A propensity score matching
- Obesity, smoking habits, and serum phosphate levels predicts mortality after life-style intervention
- Treatment of children under 4 years of age with medulloblastoma and ependymoma in the HIT2000/HIT-REZ 2005 trials: Neuropsychological outcome 5 years after treatment
- Can a semi-quantitative method replace the current quantitative method for the annual screening of microalbuminuria in patients with diabetes? Diagnostic accuracy and cost-saving analysis considering the potential health burden
- A two-arm parallel double-blind randomised controlled pilot trial of the efficacy of Omega-3 polyunsaturated fatty acids for the treatment of women with endometriosis-associated pain (PurFECT1)
- Association of benzodiazepines, opioids and tricyclic antidepressants use and falls in trauma patients: Conditional effect of age
- Burden and risk factors of cutaneous leishmaniasis in a peri-urban settlement in Kenya, 2016
- Predicting strike susceptibility and collision patterns of the common buzzard at wind turbine structures in the federal state of Brandenburg, Germany
- Embryonic thermal manipulation has short and long-term effects on the development and the physiology of the Japanese quail
- High-order radiomics features based on T2 FLAIR MRI predict multiple glioma immunohistochemical features: A more precise and personalized gliomas management
- Human-raptor conflict in rural settlements of Colombia
- Regional adaptations and parallel mutations in Feline panleukopenia virus strains from China revealed by nearly-full length genome analysis
- Long-term ecological research in southern Brazil grasslands: Effects of grazing exclusion and deferred grazing on plant and arthropod communities
- Assessment of peritoneal microbial features and tumor marker levels as potential diagnostic tools for ovarian cancer
- Survival analysis of 230 patients with unresectable hepatocellular carcinoma treated with bland transarterial embolization
- Adverse drug reaction reporting practice and associated factors among medical doctors in government hospitals in Addis Ababa, Ethiopia
- TaWAK6 encoding wall-associated kinase is involved in wheat resistance to leaf rust similar to adult plant resistance
- Deficiency syndromes in top predators associated with large-scale changes in the Baltic Sea ecosystem
- The inhibitor of apoptosis proteins antagonist Debio 1143 promotes the PD-1 blockade-mediated HIV load reduction in blood and tissues of humanized mice
- Allele specific expression of Dof genes responding to hormones and abiotic stresses in sugarcane
- Perceived relative social status and cognitive load influence acceptance of unfair offers in the Ultimatum Game
- Quantitative evaluation of choriocapillaris using optical coherence tomography and optical coherence tomography angiography in patients with central serous chorioretinopathy after half-dose photodynamic therapy
- Structure-function analyses of candidate small molecule RPN13 inhibitors with antitumor properties
- Extracting lung function measurements to enhance phenotyping of chronic obstructive pulmonary disease (COPD) in an electronic health record using automated tools
- Multiple fragmented habitat-patch use in an urban breeding passerine, the Short-toed Treecreeper
- Histological and immunohistochemical characterization of the porcine ocular surface
- Household environmental tobacco smoke exposure in healthy young children in Hong Kong: Prevalence and risk factors
- Wind energy development and wildlife conservation in Lithuania: A mapping tool for conflict assessment
- Characteristics and prognosis of primary treatment-naïve oral cavity squamous cell carcinoma in Norway, a descriptive retrospective study
- Effect of epoch length on intensity classification and on accuracy of measurement under controlled conditions on treadmill: Towards a better understanding of accelerometer measurement
- Peer distribution of HIV self-test kits to men who have sex with men to identify undiagnosed HIV infection in Uganda: A pilot study
- Error rates of human reviewers during abstract screening in systematic reviews
- Faecal analyses and alimentary tracers reveal the foraging ecology of two sympatric bats
- Urethral realignment with maximal urethral length and bladder neck preservation in robot-assisted radical prostatectomy: Urinary continence recovery
- Error metrics determination in functionally approximated circuits using SAT solvers
- Spatial movement pattern recognition in soccer based on relative player movements
- A novel visual ranking system based on arterial spin labeling perfusion imaging for evaluating perfusion disturbance in patients with ischemic stroke
- Prospective Validation of the Laboratory Risk Indicator for Necrotizing Fasciitis (LRINEC) Score for Necrotizing Fasciitis of the Extremities
- The importance of transporters and cell polarization for the evaluation of human stem cell-derived hepatic cells
- Incidence, trends, and outcomes of infection sites among hospitalizations of sepsis: A nationwide study
- Morphological and functional characteristics of mitral annular calcification and their relationship to stroke
- And the nominees are: Using design-awards datasets to build computational aesthetic evaluation model
- Service delivery interventions to increase uptake of voluntary medical male circumcision for HIV prevention: A systematic review
- Multidimensional Scales of Perceived Self-Efficacy (MSPSE): Measurement invariance across Italian and Colombian adolescents
- Diversity of Mycobacteriaceae from aquatic environment at the São Paulo Zoological Park Foundation in Brazil
- A graph-based algorithm for RNA-seq data normalization
- Parents’ underestimation of their child’s weight status. Moderating factors and change over time: A cross-sectional study
- Pharmacokinetics, absolute bioavailability and tolerability of ketamine after intranasal administration to dexmedetomidine sedated dogs
- Spatial variation in fertilizer prices in Sub-Saharan Africa
- Knowledge, beliefs, and concerns about bone health from a systematic review and metasynthesis of qualitative studies
- Successful isolation of Treponema pallidum strains from patients’ cryopreserved ulcer exudate using the rabbit model
- Effects of size and elasticity on the relation between flow velocity and wall shear stress in side-wall aneurysms: A lattice Boltzmann-based computer simulation study
- Pupil response to noxious corneal stimulation
- Incidence, risk factors and healthcare costs of central line-associated nosocomial bloodstream infections in hematologic and oncologic patients
- The impact of computed radiography and teleradiology on patients’ diagnosis and treatment in Mweso, the Democratic Republic of Congo
- Differential effects of synthetic psychoactive cathinones and amphetamine stimulants on the gut microbiome in mice
- Hepatitis B and C virus infection among HIV patients within the public and private healthcare systems in Chile: A cross-sectional serosurvey
- Increased episodes of aspiration on videofluoroscopic swallow study in children with nasogastric tube placement
- Obstructive sleep apnea and hypopnea syndrome in patients admitted in a tertiary hospital in Cameroon: Prevalence and associated factors
- Association of single nucleotide polymorphisms with dyslipidemia in antiretroviral exposed HIV patients in a Ghanaian population: A case-control study
- Sonic Hedgehog upregulation does not enhance the survival and engraftment of stem cell-derived cardiomyocytes in infarcted hearts
- The pharmacokinetic parameters and the effect of a single and repeated doses of memantine on gastric myoelectric activity in experimental pigs
- Blind method for discovering number of clusters in multidimensional datasets by regression on linkage hierarchies generated from random data
- Predictive factors of first dosage intravenous immunoglobulin-related adverse effects in children
- Description and characterization of the artisanal elasmobranch fishery on Guatemala’s Caribbean coast
- Individual and community level determinants of short birth interval in Ethiopia: A multilevel analysis
- Effects of rejection intensity and rejection sensitivity on social approach behavior in women
- The impact of IoT security labelling on consumer product choice and willingness to pay
- The development and validation of a measurement instrument to investigate determinants of health care utilisation for low back pain in Ethiopia
- Validity of the French version of the Autonomy Preference Index and its adaptation for patients with advanced cancer
- The epidemiological characteristics and spatio-temporal analysis of childhood hand, foot and mouth disease in Korea, 2011-2017
- Exponential random graph model parameter estimation for very large directed networks
- The implementation of community-based diabetes and hypertension management care program in Indonesia
- Effect of temperature variation on hospital admissions and outcomes in dogs with myxomatous mitral valve disease and new onset pulmonary edema
- The development of the Police Practices Scale: Understanding policing approaches towards street-based female sex workers in a U.S. City
- A capability approach to assess aquaculture sustainability standard compliance
- Pre-collecting lymphatic vessels form detours following obstruction of lymphatic flow and function as collecting lymphatic vessels
- Construct validity and reliability of the Talent Development Environment Questionnaire in Caribbean youth track and field athletes
- Optimization of cytotoxic activity of Nocardia sp culture broths using a design of experiments
- Tissue-resident macrophages can be generated de novo in adult human skin from resident progenitor cells during substance P-mediated neurogenic inflammation ex vivo
- Microbiota in foods from Inuit traditional hunting
- Investigating Italian disinformation spreading on Twitter in the context of 2019 European elections
- In vivo expression of peptidylarginine deiminase in Drosophila melanogaster
- Modelling zero-truncated overdispersed antenatal health care count data of women in Bangladesh
- Detection and density of breeding marsh birds in Iowa wetlands
- A lineage-specific rapid diagnostic test (Chagas Sero K-SeT) identifies Brazilian Trypanosoma cruzi II/V/VI reservoir hosts among diverse mammalian orders
- Aromatase deficiency in hematopoietic cells improves glucose tolerance in male mice through skeletal muscle-specific effects
- If host is refractory, insistent parasite goes berserk: Trypanosomatid Blastocrithidia raabei in the dock bug Coreus marginatus
- Antimicrobial resistance patterns and molecular resistance markers of Campylobacter jejuni isolates from human diarrheal cases
- Protective role of brain derived neurotrophic factor (BDNF) in obstructive sleep apnea syndrome (OSAS) patients
- An IL-18-centered inflammatory network as a biomarker for cerebral white matter injury
- Prevalence of antiphospholipid antibodies in Behçet's disease: A systematic review and meta-analysis
- Chemical analysis of snus products from the United States and northern Europe
- Effect of prednisolone on glyoxalase 1 in an inbred mouse model of aristolochic acid nephropathy using a proteomics method with fluorogenic derivatization-liquid chromatography-tandem mass spectrometry
- Impact of early-onset persistent stunting on cognitive development at 5 years of age: Results from a multi-country cohort study
- Aggregation of CAT tails blocks their degradation and causes proteotoxicity in S. cerevisiae
- Expression of concern: Compensatory increase of transglutaminase 2 is responsible for resistance to mTOR inhibitor treatment
- Common mental illness among epilepsy patients in Bahir Dar city, Ethiopia: A cross-sectional study
- Staging dementia based on caregiver reported patient symptoms: Implications from a latent class analysis
- Health-related quality of life and its determinants among ambulatory patients with epilepsy at Ambo General Hospital, Ethiopia: Using WHOQOL-BREF
- In silico analysis and high-risk pathogenic phenotype predictions of non-synonymous single nucleotide polymorphisms in human Crystallin beta A4 gene associated with congenital cataract
- Fungal diversity in canopy soil of silver beech, Nothofagus menziesii (Nothofagaceae)
- Referral decisions and its predictors related to orthopaedic care. A retrospective study in a novel primary care setting
- Readiness to prescribe: Using educational design to untie the Gordian Knot
- Influence of gelation on the retention of purple cactus pear extract in microencapsulated double emulsions
- Factors related to met needs for rehabilitation 6 years after stroke
- Association of cataract and sun exposure in geographically diverse populations of India: The CASE study. First Report of the ICMR-EYE SEE Study Group
- Investigation of injury severity in urban expressway crashes: A case study from Beijing
- Clinical outcomes of incident peritoneal dialysis patients coming from kidney transplantation program: A case-control study
- Evaluation of the factors influencing the housing safety awareness of residents in Shanghai
- Morphometric study of the diaphragmatic surface of the liver in the human fetus
- Food insecurity and dietary diversity among lactating mothers in the urban municipality in the mountains of Nepal
- Genetic characterization of Bacillus anthracis strains circulating in Italy from 1972 to 2018
- Promising antifungal activity of new oxadiazole against Candida krusei
- An atlas of personality, emotion and behaviour
- Long-term effects of intracranial islet grafting on cognitive functioning in a rat metabolic model of sporadic Alzheimer's disease-like dementia
- Compartmentalized profiling of amniotic fluid cytokines in women with preterm labor
- Comparison of the myometrial transcriptome from singleton and twin pregnancies by RNA-Seq
- Adverse reproductive effects of S100A9 on bovine sperm and early embryonic development in vitro
- Functional dynamics of bacterial species in the mouse gut microbiome revealed by metagenomic and metatranscriptomic analyses
- Astrocyte senescence promotes glutamate toxicity in cortical neurons
- Primary ciliary dyskinesia and psychological well-being in adolescence
- Dipeptidyl peptidase-4 is increased in the abdominal aortic aneurysm vessel wall and is associated with aneurysm disease processes
- Primary care physician knowledge, attitudes, and diagnostic testing practices for norovirus and acute gastroenteritis
- Microfluidic-prepared DOTAP nanoparticles induce strong T-cell responses in mice
- Intraocular scattering as a predictor of driving performance in older adults with cataracts
- Reduced bone mineral density among HIV infected patients on anti-retroviral therapy in Blantyre, Malawi: Prevalence and associated factors
- Correction: Extraversion personality, perceived health and activity participation among community-dwelling aging adults in Hong Kong
- A rainwater control optimization design approach for airports based on a self-organizing feature map neural network model
- Influence of inflammasome NLRP3, and IL1B and IL2 gene polymorphisms in periodontitis susceptibility
- 18F-FDG-PET/MRI in the diagnostic work-up of limbic encephalitis
- The socioeconomic impact of orthopaedic trauma: A systematic review and meta-analysis
- Treatment patterns among patients with moderate-to-severe ulcerative colitis in the United States and Europe
- City to city learning and knowledge exchange for climate resilience in southern Africa
- Nuclear translocation of Atox1 potentiates activin A-induced cell migration and colony formation in colon cancer
- Activity-dependent switches between dynamic regimes of extracellular matrix expression
- Molecular sequencing and morphological identification reveal similar patterns in native bee communities across public and private grasslands of eastern North Dakota
- A mathematical model for assessing the effectiveness of controlling relapse in Plasmodium vivax malaria endemic in the Republic of Korea
- Cryo-focused ion beam preparation of perovskite based solar cells for atom probe tomography
- Physiological and transcriptomic responses of Lanzhou Lily (Lilium davidii, var. unicolor) to cold stress
- Unusual genome expansion and transcription suppression in ectomycorrhizal Tricholoma matsutake by insertions of transposable elements
- Estimating associations between antidepressant use and incident mild cognitive impairment in older adults with depression
- The use of telephone communication between nurse navigators and their patients
- CNP mediated selective toxicity on melanoma cells is accompanied by mitochondrial dysfunction
- HIV RNA measurement in dried blood spots of HIV-infected patients in Thailand using Abbott m2000 system
- Retraction: Oncogenic Fibulin-5 Promotes Nasopharyngeal Carcinoma Cell Metastasis through the FLJ10540/AKT Pathway and Correlates with Poor Prognosis
- Ultra-rapid cooling of ibex sperm by spheres method does not induce a vitreous extracellular state and increases the membrane damages
- Some animals are more equal than others: Validation of a new scale to measure how attitudes to animals depend on species and human purpose of use
- Observation and quantification of the morphological effect of trypan blue rupturing dead or dying cells
- The visual perception of emotion from masks
- Hexavalent chromium removal and total chromium biosorption from aqueous solution by Quercus crassipes acorn shell in a continuous up-flow fixed-bed column: Influencing parameters, kinetics, and mechanism
- The predictive value of anthropometric indices for cardiometabolic risk factors in Chinese children and adolescents: A national multicenter school-based study
- Lean back and wait for the alarm? Testing an automated alarm system for nosocomial outbreaks to provide support for infection control professionals
- Regional disparities in health care resources in traditional Chinese medicine county hospitals in China
- Analysis on hydraulic characteristics of improved sandy soil with soft rock
- Development and use of a scale to assess gender differences in appraisal of mistreatment during childbirth among Ethiopian midwifery students
- Factors for starting biosimilar TNF inhibitors in patients with rheumatic diseases in the real world
- Correction: Force field generalization and the internal representation of motor learning
- Prevalence and foetomaternal effects of iron deficiency anaemia among pregnant women in Lagos, Nigeria
- Socioeconomic risk factors for fatal opioid overdoses in the United States: Findings from the Mortality Disparities in American Communities Study (MDAC)
- Microbiome signatures in neonatal central line associated bloodstream infections
- Interventions for incarcerated adults with opioid use disorder in the United States: A systematic review with a focus on social determinants of health
- Opening gap width influences distal tibial rotation below the osteotomy site following open wedge high tibial osteotomy
- The impact of lowbush blueberry (Vaccinium angustifolium Ait.) and cranberry (Vaccinium macrocarpon Ait.) pollination on honey bee (Apis mellifera L.) colony health status
- Surveys of knowledge and awareness of antibiotic use and antimicrobial resistance in general population: A systematic review
- Managerial capacity among district health managers and its association with district performance: A comparative descriptive study of six districts in the Eastern Region of Ghana
- Knee joint distraction in regular care for treatment of knee osteoarthritis: A comparison with clinical trial data
- Reconstruction of a regulated two-cell metabolic model to study biohydrogen production in a diazotrophic cyanobacterium Anabaena variabilis ATCC 29413
- Cochlear dysfunction is associated with styrene exposure in humans
- Intra-individual variation of particles in exhaled air and of the contents of Surfactant protein A and albumin
- Revisits, readmissions, and outcomes for pediatric traumatic brain injury in California, 2005-2014
- Enhanced handover mechanism using mobility prediction in wireless networks
- Association between regular exercise and asthma control among adults: The population-based Northern Finnish Asthma Study
- Pharyngeal microbiome alterations during Neisseria gonorrhoeae infection
- Assessment of the clinical utility of four NGS panels in myeloid malignancies. Suggestions for NGS panel choice or design
- Assessment of time management practice and associated factors among primary hospitals employees in north Gondar, northwest Ethiopia
- Genetic diversity and population structure of feral rapeseed (Brassica napus L.) in Japan
- Are the current gRNA ranking prediction algorithms useful for genome editing in plants?
- Difference between physical therapist estimation and psychological patient-reported outcome measures in patients with low back pain
- Heterogeneity in the distribution of 159 drug-response related SNPs in world populations and their genetic relatedness
- Metabolic and lipidomic profiling of steatotic human livers during ex situ normothermic machine perfusion guides resuscitation strategies
- Investigating cumulative effects of pre-performance routine interventions in beach volleyball serving
- Dispensing of antibiotics without prescription and associated factors in drug retail outlets of Eritrea: A simulated client method
- MicroRNA expression and DNA methylation profiles do not distinguish between primary and recurrent well-differentiated liposarcoma
- Assessment of acyl-CoA cholesterol acyltransferase (ACAT-1) role in ovarian cancer progression—An in vitro study
- Cytoplasmic factories, virus assembly, and DNA replication kinetics collectively constrain the formation of poxvirus recombinants
- The wavelet power spectrum of perfusion weighted MRI correlates with tumor vascularity in biopsy-proven glioblastoma samples
- Agreement between cardiovascular disease risk assessment tools: An application to the United Arab Emirates population
- Constructing HLM to examine multi-level poverty-contributing factors of farmer households: Why and how?
- Patterns of symptoms possibly indicative of cancer and associated help-seeking behaviour in a large sample of United Kingdom residents—The USEFUL study
- An automated alarm system for food safety by using electronic invoices
- Neural effects of acute stress on appetite: A magnetoencephalography study
- Use of magnetic resonance imaging to determine laterality of meniscal size in healthy volunteers
- Co-prevalence of extracranial carotid aneurysms differs between European intracranial aneurysm cohorts
- Thermal biology of two tropical lizards from the Ecuadorian Andes and their vulnerability to climate change
- When weight is an encumbrance; avoidance of stairs by different demographic groups
- Non-mycosis fungoides cutaneous lymphomas in a referral center in Taiwan: A retrospective case series and literature review
- From the host's point of view: Effects of variation in burying beetle brood care and brood size on the interaction with parasitic mites
- Kernel-based Gaussian process for anomaly detection in sparse gamma-ray data
- Unmet care needs of children with ADHD
- Accelerometer-assessed outdoor physical activity is associated with meteorological conditions among older adults: Cross-sectional results from the OUTDOOR ACTIVE study
- Identification of Korean cancer survivors’ unmet needs and desired psychosocial assistance: A focus group study
- Evaluation of inactivated Bordetella pertussis as a delivery system for the immunization of mice with Pneumococcal Surface Antigen A
- The role of moral reasoning & personality in explaining lyrical preferences
- Would you like to participate in this trial? The practice of informed consent in intrapartum research in the last 30 years
- Correction: Mutation spectrums of TSC1 and TSC2 in Chinese women with lymphangioleiomyomatosis (LAM)
- Forward lunge before and after anterior cruciate ligament reconstruction: Faster movement but unchanged knee joint biomechanics
- Challenges associated with homologous directed repair using CRISPR-Cas9 and TALEN to edit the DMD genetic mutation in canine Duchenne muscular dystrophy
- Integrated targeted serum metabolomic profile and its association with gender, age, disease severity, and pattern identification in acne
- A prospective case-control study on miRNA circulating levels in subjects born small for gestational age (SGA) evaluated from childhood into young adulthood
- Polymer-fiber-coupled field-effect sensors for label-free deep brain recordings
- Global depth perception alters local timing sensitivity
- How to detect a polytrauma patient at risk of complications: A validation and database analysis of four published scales
- Module for SWC neuron morphology file validation and correction enabled for high throughput batch processing
- Reduced gray matter volume and cortical thickness associated with traffic-related air pollution in a longitudinally studied pediatric cohort
- Recombinant human soluble thrombomodulin is associated with attenuation of sepsis-induced renal impairment by inhibition of extracellular histone release
- Human and climatic drivers affect spatial fishing patterns in a multiple-use marine protected area: The Galapagos Marine Reserve
- Correction: Leisure-time physical activity and sports in the Brazilian population: A social disparity analysis
- Application of the mixture item response theory model to the Self-Administered Food Security Survey Module for Children
- Numerical simulation of atmospheric CO2 concentration and flux over the Korean Peninsula using WRF-VPRM model during Korus-AQ 2016 campaign
- Feline irradiated diet-induced demyelination; a model of the neuropathology of sub-acute combined degeneration?
- Improved multi-parametric prediction of tissue outcome in acute ischemic stroke patients using spatial features
- Genome-wide association and epistatic interactions of flowering time in soybean cultivar
- Correction: Association between workplace bullying and burnout, professional quality of life, and turnover intention among clinical nurses
- Correction: Estimation of membrane bending modulus of stiffness tuned human red blood cells from micropore filtration studies
- Correction: Limited indirect effects of an infant pneumococcal vaccination program in an aging population
- Correction: Targeting of the Plzf Gene in the Rat by Transcription Activator-Like Effector Nuclease Results in Caudal Regression Syndrome in Spontaneously Hypertensive Rats
- Fieldwork-based determination of design priorities for point-of-use drinking water quality sensors for use in resource-limited environments
- Young women’s reproductive health conversations: Roles of maternal figures and clinical practices
- Correction: Differential recordings of local field potential: A genuine tool to quantify functional connectivity
- Survival of medial versus lateral unicompartmental knee arthroplasty: A meta-analysis
- Novel MscL agonists that allow multiple antibiotics cytoplasmic access activate the channel through a common binding site
- Is it time to stop sweeping data cleaning under the carpet? A novel algorithm for outlier management in growth data
- Changes in oak (Quercus robur) photosynthesis after winter moth (Operophtera brumata) herbivory are not explained by changes in chemical or structural leaf traits
- Mutual interaction between motor cortex activation and pain in fibromyalgia: EEG-fNIRS study
- Evaluation of liposomal ciprofloxacin formulations in a murine model of anthrax
- Analysis of cholesterol in mouse brain by HPLC with UV detection
- Sugar, amino acid and inorganic ion profiling of the honeydew from different hemipteran species feeding on Abies alba and Picea abies
- Exploring prior diseases associated with incident late-onset Alzheimer’s disease dementia
- Hypertension prevalence in patients attending tertiary pain management services, a registry-based Australian cohort study
- SRL pathogenicity island contributes to the metabolism of D-aspartate via an aspartate racemase in Shigella flexneri YSH6000
- Correction: Comprehensive genome-wide analysis of the pear (Pyrus bretschneideri) laccase gene (PbLAC) family and functional identification of PbLAC1 involved in lignin biosynthesis
- Epilepsy in a melanocyte-lineage mTOR hyperactivation mouse model: A novel epilepsy model
- Water consumption and prevalence of irritable bowel syndrome among adults
- Mixed evidence for the relationship between periodontitis and Alzheimer’s disease: A bidirectional Mendelian randomization study
- Correction: Health conditions associated with overweight in climacteric women
- Correction: Determining Glomerular Filtration Rate in Homozygous Sickle Cell Disease: Utility of Serum Creatinine Based Estimating Equations
- Modelling the number of antenatal care visits in Bangladesh to determine the risk factors for reduced antenatal care attendance
- Correction: Cumulative viral load as a predictor of CD4+ T-cell response to antiretroviral therapy using Bayesian statistical models
- Dominant negative effects by inactive Spa47 mutants inhibit T3SS function and Shigella virulence
- ICOS-deficient and ICOS YF mutant mice fail to control Toxoplasma gondii infection of the brain
- Diel patterns in swimming behavior of a vertically migrating deepwater shark, the bluntnose sixgill (Hexanchus griseus)
- Life history of northern Gulf of Mexico Warsaw grouper Hyporthodus nigritus inferred from otolith radiocarbon analysis
- Physiology education for intensive care medicine residents: A 15-minute interactive peer-led flipped classroom session
- Strengthening capacity for natural sciences research: A qualitative assessment to identify good practices, capacity gaps and investment priorities in African research institutions
- Systematic scoping review of the concept of ‘genetic identity’ and its relevance for germline modification
- Height of overburden fracture based on key strata theory in longwall face
- Laboratory strains of Bacillus anthracis lose their ability to rapidly grow and sporulate compared to wildlife outbreak strains
- Improvement of classification performance of Parkinson’s disease using shape features for machine learning on dopamine transporter single photon emission computed tomography
- Comparative pharmacokinetics and pharmacodynamics of the advanced Retinol-Binding Protein 4 antagonist in dog and cynomolgus monkey
- Correction: A handy method to remove bacterial contamination from fungal cultures
- Correction: Effect of statin on life prognosis in Japanese patients undergoing hemodialysis
- Retraction: Outer Membrane Protein A (OmpA) of Shigella flexneri 2a Induces TLR2-Mediated Activation of B Cells: Involvement of Protein Tyrosine Kinase, ERK and NF-κB
- Retraction: Biofabrication of streptomycin-conjugated calcium phosphate nanoparticles using red ginseng extract and investigation of their antibacterial potential
- Receiver operating characteristic curve analysis of clinical signs for screening of convergence insufficiency in young adults
- Correction: Drivers of deforestation in the basin of the Usumacinta River: Inference on process from pattern analysis using generalised additive models
- Efficacy of fertilizing method for different potash sources in cotton (Gossypium hirsutum L.) nutrition under arid climatic conditions
- Podocyte autophagy is associated with foot process effacement and proteinuria in patients with minimal change nephrotic syndrome
- Effect of Lactobacillus acidophilus D2/CSL (CECT 4529) supplementation in drinking water on chicken crop and caeca microbiome
- Retraction: MiR-30a-5p Antisense Oligonucleotide Suppresses Glioma Cell Growth by Targeting SEPT7
- Correction: Dynamics of plasma micronutrient concentrations and their correlation with serum proteins and thyroid hormones in patients with paracoccidioidomycosis
- Impact of lower limb osteoarthritis on health-related quality of life: A cross-sectional study to estimate the expressed loss of utility in the Spanish population
- Correction: Prevalence of damaged and missing teeth among women in the southern plains of Nepal: Findings of a simplified assessment tool
- Correction: Tissue-Specific Expressed Antibody Variable Gene Repertoires
- Retraction: Immunoglobulin G Expression in Lung Cancer and Its Effects on Metastasis
- Correction: Causal knowledge promotes behavioral self-regulation: An example using climate change dynamics
- Retraction: Use of Granulocyte Colony-Stimulating Factor for the Treatment of Thin Endometrium in Experimental Rats
- Correction: Dynamic mechanical and nanofibrous topological combinatory cues designed for periodontal ligament engineering
- Correction: Evaluating the foundations that help avert antimicrobial resistance: Performance of essential water sanitation and hygiene functions in hospitals and requirements for action in Kenya
- From seed to flour: Sowing sustainability in the use of cantaloupe melon residue (Cucumis melo L. var. reticulatus)
- Core Scientific Dataset Model: A lightweight and portable model and file format for multi-dimensional scientific data
- Accounting for measurement error to assess the effect of air pollution on omic signals
- Leucine zipper transcription factor-like 1 binds adaptor protein complex-1 and 2 and participates in trafficking of transferrin receptor 1
- Barriers for tuberculosis case finding in Southwest Ethiopia: A qualitative study
- Genetic predisposition to celiac disease in Kazakhstan: Potential impact on the clinical practice in Central Asia
- A lower psoas muscle volume was associated with a higher rate of recurrence in male clear cell renal cell carcinoma
- Two angles of overqualification-the deviant behavior and creative performance: The role of career and survival job
- Cost-utility analysis of de-escalating biological disease-modifying anti-rheumatic drugs in patients with rheumatoid arthritis
- Efficient estimation of stereo thresholds: What slope should be assumed for the psychometric function?
- Learning efficient haptic shape exploration with a rigid tactile sensor array
- Effects of dietary supplementation with a microalga (Schizochytrium sp.) on the hemato-immunological, and intestinal histological parameters and gut microbiota of Nile tilapia in net cages
- Regional versus local wind speed and direction at a narrow beach with a high and steep foredune
- Fragmented QRS complex in patients with systemic lupus erythematosus at the time of diagnosis and its relationship with disease activity
- Severe thiamine deficiency in eastern Baltic cod (Gadus morhua)
- Transfer entropy as a variable selection methodology of cryptocurrencies in the framework of a high dimensional predictive model
- Psychometric validation of Czech version of the Sport Motivation Scale
- Correction: Multiple innate antibacterial immune defense elements are correlated in diverse ungulate species
- Recognition of personality disorder and anxiety disorder comorbidity in patients treated for depression in secondary psychiatric care
- Correction: Strategies for achieving high sequencing accuracy for low diversity samples and avoiding sample bleeding using illumina platform
- PLOS One
- Archiv čísel
- Aktuální číslo
- Informace o časopisu
Nejčtenější v tomto čísle- Severity of misophonia symptoms is associated with worse cognitive control when exposed to misophonia trigger sounds
- Chemical analysis of snus products from the United States and northern Europe
- Calcium dobesilate reduces VEGF signaling by interfering with heparan sulfate binding site and protects from vascular complications in diabetic mice
- Effect of Lactobacillus acidophilus D2/CSL (CECT 4529) supplementation in drinking water on chicken crop and caeca microbiome
Kurzy
Zvyšte si kvalifikaci online z pohodlí domova
Autoři: MUDr. Petr Výborný, CSc., FEBO
Autoři: prof. MUDr. Vladimír Palička, CSc., Dr.h.c., doc. MUDr. Václav Vyskočil, Ph.D., MUDr. Petr Kasalický, CSc., MUDr. Jan Rosa, Ing. Pavel Havlík, Ing. Jan Adam, Hana Hejnová, DiS., Jana Křenková
Autoři: MDDr. Eleonóra Ivančová, PhD., MHA
Všechny kurzyPřihlášení#ADS_BOTTOM_SCRIPTS#Zapomenuté hesloZadejte e-mailovou adresu, se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.
- Vzdělávání