-
Články
Top novinky
Reklama- Vzdělávání
- Časopisy
Top články
- Témata
Top novinky
Reklama- Kongresy
- Videa
- Podcasty
Nové podcasty
Reklama- Volná místa
Doporučené pozice
Reklama- Praxe
Top novinky
ReklamaAccelerated brain aging towards transcriptional inversion in a zebrafish model of the K115fs mutation of human PSEN2
Authors: Nhi Hin aff001; Morgan Newman aff002; Jan Kaslin aff003; Alon M. Douek aff003; Amanda Lumsden aff004; Seyed Hani Moussavi Nik aff001; Yang Dong aff001; Xin-Fu Zhou aff005; Noralyn B. Mañucat-Tan aff005; Alastair Ludington aff001; David L. Adelson aff006; Stephen Pederson aff001; Michael Lardelli aff002
Authors place of work: Bioinformatics Hub, School of Biological Sciences, University of Adelaide, Adelaide, South Australia, Australia aff001; Alzheimer’s Disease Genetics Laboratory, School of Biological Sciences, University of Adelaide, Adelaide, South Australia, Australia aff002; Australian Regenerative Medicine Institute, Monash University, Clayton, Victoria, Australia aff003; College of Medicine and Public Health, and Centre for Neuroscience, Flinders University, Adelaide, South Australia, Australia aff004; School of Pharmacy and Medical Sciences, University of South Australia, Adelaide, South Australia, Australia aff005; Centre for Bioinformatics and Computational Genetics, School of Bioogical Sciences, Adelaide, South Australia, Australia aff006
Published in the journal: PLoS ONE 15(1)
Category: Research Article
doi: https://doi.org/10.1371/journal.pone.0227258Summary
Background
The molecular changes involved in Alzheimer’s disease (AD) progression remain unclear since we cannot easily access antemortem human brains. Some non-mammalian vertebrates such as the zebrafish preserve AD-relevant transcript isoforms of the PRESENILIN genes lost from mice and rats. One example is PS2V, the alternative transcript isoform of the PSEN2 gene. PS2V is induced by hypoxia/oxidative stress and shows increased expression in late onset, sporadic AD brains. A unique, early onset familial AD mutation of PSEN2, K115fs, mimics the PS2V coding sequence suggesting that forced, early expression of PS2V-like isoforms may contribute to AD pathogenesis. Here we use zebrafish to model the K115fs mutation to investigate the effects of forced PS2V-like expression on the transcriptomes of young adult and aged adult brains.
Methods
We edited the zebrafish genome to model the K115fs mutation. To explore its effects at the molecular level, we analysed the brain transcriptome and proteome of young (6-month-old) and aged (24-month-old) wild type and heterozygous mutant female sibling zebrafish. Finally, we used gene co-expression network analysis (WGCNA) to compare molecular changes in the brains of these fish to human AD.
Results
Young heterozygous mutant fish show transcriptional changes suggesting accelerated brain aging and increased glucocorticoid signalling. These early changes precede a transcriptional ‘inversion’ that leads to glucocorticoid resistance and other likely pathological changes in aged heterozygous mutant fish. Notably, microglia-associated immune responses regulated by the ETS transcription factor family are altered in both our zebrafish mutant model and in human AD. The molecular changes we observe in aged heterozygous mutant fish occur without obvious histopathology and possibly in the absence of Aβ.
Conclusions
Our results suggest that forced expression of a PS2V-like isoform contributes to immune and stress responses favouring AD pathogenesis. This highlights the value of our zebrafish genetic model for exploring molecular mechanisms involved in AD pathogenesis.
Keywords:
Gene expression – Genetic networks – Mutation – Immune response – Polymerase chain reaction – Alzheimer's disease – Neural networks – Zebrafish
Introduction
Alzheimer’s disease (AD) is the leading cause of dementia, a condition characterised by the progressive decline of memory and cognition. Like other neurodegenerative diseases, AD affects diverse cellular processes in the brain, including mitochondrial function [1, 2], metal ion homeostasis [3–5], lipid metabolism [6–8], immune responses [9, 10], synaptic transmission [11], and protein folding and trafficking [12, 13]. Dysregulation of these processes eventually results in severe atrophy of several brain regions (reviewed by Braak and Braak [14] and Masters et al. [15]). Consequently, late stages of AD are likely to be much more difficult to treat than earlier stages of AD, contributing to our failure to discover ameliorative drugs [16].
The pathological processes that result in AD are likely to initiate decades before clinical symptoms arise. Decreased levels of soluble amyloid beta (Aβ) peptides in the cerebrospinal fluid is one of the earliest markers of both sporadic and familial forms of AD, preceding disease onset by 20–30 years [17, 18], while vascular changes are likely to occur even earlier [19]. Individuals possessing highly penetrant, dominant mutations in genes linked to the familial form of AD (fAD) such as PSEN1 show structural and functional changes in their brains as early as 9 years of age, despite being cognitively normal [20, 21]. Similar findings are evident in young adults carrying the ε4 allele of APOE, the major risk gene for the sporadic form of AD [22]. To prevent AD, we must identify the stresses underlying these early pathological changes. However, detailed molecular analysis of the brains of asymptomatic young adult fAD mutation carriers is currently impossible.
Analysing high-throughput ‘omics data (e.g. transcriptomic, proteomic) is a comprehensive and relatively unbiased approach for studying complex diseases like AD. Over the past decade, numerous post-mortem AD brains have been profiled using microarray and RNA-seq technologies, exposing an incredibly complex and interconnected network of cellular processes implicated in the disease [23, 24]. Unfortunately, analysing post-mortem AD brains does not discern which cellular processes are responsible for initiating the cascade of events leading to AD.
Animal models can assist exploration of the early molecular changes that promote AD. However, early “knock-in” mouse models that attempted to model the genetic state of human fAD showed no obvious histopathology [25–27]. Modern ‘omics technologies provide molecular-level descriptions of disease states, but these technologies were not available when the early knock-in models were made. Subsequent transgenic models of AD constructed with multiple genes and/or mutations have displayed what are assumed to be AD-related histopathologies and these have also been analysed by ‘omics methods. However recent analysis of brain transcriptomes from five different transgenic AD models showed little concordance with human, late onset, sporadic AD brain transcriptomes. Worse still, none of the models were concordant with each other [28].
The overwhelming majority of fAD mutations are present in a heterozygous state in human patients. Despite this, there has been a lack of detailed molecular investigation of the young adult brains of any animal model closely imitating the human fAD genetic state–i.e. heterozygous for a fAD-like mutation in a single, endogenous gene. Previously, we used zebrafish to analyse the unique, frameshifting fAD mutation of human PRESENILIN2 (PSEN2), K115fs, that inappropriately mimics expression of a hypoxia-induced truncated isoform of PSEN2 protein, PS2V [29–32]. Mice and rats have lost the ability to express PS2V [33] (and the fAD genes of these rodents are evolving more rapidly than in many other mammals [33]), but in zebrafish, this isoform is expressed from the animal’s psen1 gene [32]. Consequently, to model and explore early changes in the brain contributing to AD pathogenesis, we have now used gene-editing technology to introduce a K115fs-equivalent mutation into the zebrafish psen1 gene, K97fs. In this paper, we analyse data collected from young adult (6-month-old) and aged (24-month-old) adult heterozygous mutant and wild type zebrafish brains to comprehensively assess gene and protein expression changes in the brain due to aging and this mutation. At the molecular level, we find that the young heterozygous mutant brains show elements of accelerated aging while aged heterozygous mutant brains appear to ‘invert’ into a distinct, and presumably pathological, state. Our results highlight the important role that non-transgenic models of fAD mutations in a heterozygous state play in elucidating mechanisms of AD pathogenesis.
Results
Gene editing in zebrafish to produce the psen1 K97fs mutation is described in the Materials and Methods and in Fig A in S1 File. To confirm that the K97fs mutation of psen1 forces measurable expression of a PS2V-like transcript under normoxic conditions we performed digital quantitative PCR (dqPCR) specifically detecting either heterozygous mutant or wild type transcript sequences in cDNA synthesised from the brains of female 6-month-old (young) and 24-month-old (aged) psen1K97fs/+ (heterozygous mutant) and psen1+/+ (wild type) zebrafish (Fig 1). We only included female fish to reduce variability between samples and minimise confounding by potential gender-specific gene expression patterns, given that females are more vulnerable to AD and that gender-specific changes have been documented in AD [34, 35]. K97fs transcripts constitute approximately 30% of the psen1 transcripts detected in young brains and over 70% of the detected transcripts in aged brains. Despite these different biases in heterozygous mutant and wild type transcript expression, the total levels of psen1 transcript appeared similar between heterozygous mutant and wild type fish at either age. This supports that the K97fs mutant transcript (like PS2V transcripts in humans) is not completely degraded by nonsense mediated decay despite possession of a premature termination codon [29]. PCR tests on cDNA from heterozygous mutant brains did not detect aberrant splicing of the psen1 gene due to the K97fs mutation. We currently have no explanation for the observed bias, or its age-dependent change, between the expression of the heterozygous mutant versus wild type psen1 transcripts. The extent of the decrease in the wild type psen1 transcript in the aged heterozygous mutant brains means that this may contribute to any molecular phenotype caused by heterozygosity for the K97fs mutation in addition to the effects of the PS2V-like transcripts.
Fig. 1. Quantification of heterozygous mutant and wild type allele relative transcript expression. Digital quantitative PCRs specifically detecting transcripts from the heterozygous mutant (K97fs) or wild type (+) alleles of psen1 were performed using cDNA synthesised from total brain mRNA from fish at 6 and 24 months of age. Means and standard error of the means are indicated, and p-values are from two-sample t-tests assuming unequal variances. To determine whether the K97fs mutation in the zebrafish psen1 gene induces changes in the expression of other genes and proteins, we removed entire brains of heterozygous mutant and wild type adult zebrafish for total RNA sequencing (RNA-seq) and label-free tandem mass spectroscopy (LC-MS/MS) when zebrafish were 6 months (young adult) and 24 months (aged adult) old. We used three biological replicates to represent each of the four experimental conditions (young wild type, young heterozygous mutant, aged wild type, aged heterozygous mutant), and performed pairwise comparisons between experimental conditions to determine differentially expressed (DE) genes and differentially abundant (DA) proteins (Fig 2). Full lists of DE genes and DA proteins are provided in S1 and S2 Tables.
Fig. 2. Summary of experimental groups, differentially expressed (DE) genes and differentially abundant (DA) proteins. Three biological replicates (entire zebrafish brains) were subjected to RNA-seq and LC-MS/MS for each of the four experimental conditions. Arrows indicate pairwise comparisons (to identify DE genes and DA proteins) between experimental conditions. The numbers of DE genes and DA proteins determined from RNA-seq and LC-MS/MS analyses are indicated underneath the arrow for each comparison. We considered genes to be DE and proteins to be DA if the False Discovery Rate [FDR]-adjusted p-value of their moderated t-test (limma) was below 0.05. All zebrafish of the same age are siblings raised in the same tank. Gene expression changes in the heterozygous mutant zebrafish reveal accelerated brain aging followed by inversion into a presumably pathological state
The brains of children or young adults carrying fAD mutations display morphological and functional differences compared to age-matched individuals without these mutations [20, 21]. Consequently, we hypothesised that gene expression in the brains of young adult (6-month-old) zebrafish carrying this K115fs-like mutation would also be altered when compared to wild type zebrafish siblings. Overall, we find supporting evidence for 105 genes that are differentially expressed in young heterozygous mutant brains relative to wild type brains (65 up-regulated, 40 down-regulated; FDR-adjusted p-value < 0.05) (Fig B in S1 File). Of these 105 genes, 65 have an estimated log2 fold change greater than 0.5 (or less than -0.5) in the ‘young heterozygous mutant vs. young wild type’ comparison (Fig 3A). By examining the expression of these genes in the other three comparisons described in Fig 2, we observe two important phenomena:
Accelerated aging genes are associated with increased immune response: 62% (65/105) of the genes that are DE in 6-month-old heterozygous mutant brains (‘young heterozygous mutant vs. young wild type’) show the same direction of expression change during normal aging (‘aged wild type vs. young wild type’). However, far more genes are DE during normal aging (1,795 compared to 105). This suggests that the 6-month-old heterozygous mutant brains may demonstrate accelerated aging for a subset of cellular functions. As an initial step to explore these altered cellular functions, we applied functional enrichment analysis on these 65 genes and discovered significant enrichment in an MSigDB gene set relating to immune response genes that are up-regulated following lipopolysaccharide treatment “GSE9988 LPS VS VEHICLE TREATED MONOCYTE UP” (Bonferroni adjusted p-value 0.000948) (S3 Table).
Age-dependent ‘inversion’ pattern: A subset of 63 genes with increased expression in 6-month-old heterozygous mutant brains (‘young heterozygous mutant vs. young wild type’) show decreased expression in 24-month-old heterozygous mutant brains (‘aged heterozygous mutant vs. aged wild type’). We call this expression pattern an age-dependent ‘inversion’ between heterozygous mutant and wild type brains, and explore the biological relevance of the genes involved in this inversion pattern later.
Fig. 3. Differential gene expression between heterozygous mutant (psen1K97fs/+) and wild type (psen1+/+) zebrafish brains at 6 months (young) and 24 months (aged). By comparing gene expression in 24-month-old heterozygous mutant and wild type zebrafish brains, we can gain insight into a putatively pathological transcriptomic state present in the brains of aged zebrafish carrying this mutation. We find supporting evidence for 177 genes that are differentially expressed in heterozygous mutant brains relative to wild type brains (139 down-regulated, 38 up-regulated; FDR-adjusted p-value < 0.05) (Fig 3B; Fig B in S1 File). Note that not all of these genes are shown in Fig 3B, which only includes genes with log2 fold change values greater than 0.5 or less than -0.5. To allow for easier interpretation of these 177 genes, we used hierarchical clustering to separate them into groups with distinct expression patterns based on all four brain-types:
Inverted (63 genes): Defined as genes showing opposite fold-changes in young heterozygous mutant brains (‘young heterozygous mutant vs. young wild type’) compared to aged heterozygous mutant brains (‘aged heterozygous mutant vs. aged wild type’). To be included in this group, genes were required to have an FDR-adjusted p-value < 0.05 in either the ‘young heterozygous mutant vs. young wild type’ or ‘aged heterozygous mutant vs. aged wild type’ comparison and an unadjusted p-value < 0.05 in the other comparison.
Inappropriately down-regulated (57 genes): Defined as genes that are down-regulated in the ‘aged heterozygous mutant vs. young heterozygous mutant’ and ‘aged heterozygous mutant vs. aged wild type’ comparisons (FDR-adjusted p-value < 0.05 in both).
Failure to up-regulate (94 genes): Defined as genes that are up-regulated during normal aging (FDR-adjusted p-value < 0.05 in the ‘aged wild type vs. young wild type’ comparison) but not up-regulated in the ‘aged heterozygous mutant vs. aged wild type’ comparison.
Failure to down-regulate (26 genes): Defined as genes that are down-regulated during normal aging (FDR-adjusted p-value < 0.05 in the ‘aged wild type vs. young wild type’ comparison) but not down-regulated in the ‘aged heterozygous mutant vs. aged wild type’ comparison.
To determine whether these different component groups of the gene expression patterns are biologically relevant, we assessed each group’s functional enrichment using Gene Ontology terms, MSigDB gene sets, and Reactome and Interpro pathways (summarised in S3 Table; full results in S4 Table. Overall, we find statistically significant enrichment (Bonferroni adjusted p-value < 0.05) for all groups except for the ‘failure to down-regulate’ group. The ‘inverted’ group is significantly enriched in several gene sets related to stress and immune response; the ‘inappropriately down-regulated’ group is significantly enriched in developmental transcription factors including homeobox genes; the ‘failure to up-regulate’ group is significantly enriched in immune responses.
Gene expression changes during aging of the heterozygous mutant zebrafish brains partially overlap with normal brain aging
Gene expression changes associated with aging in the wild type and heterozygous mutant zebrafish brains only partially overlap. When comparing 24-month-old and 6-month-old wild type zebrafish brains, 1,795 genes show differential expression. However, when comparing 24-month-old and 6-month-old heterozygous mutant zebrafish brains, 1,072 genes show altered expression (FDR-adjusted p-value < 0.05). When comparing these two sets of genes, only 525 genes show fold-changes in the same direction during wild type and heterozygous mutant aging. These genes can be considered an ‘aging signature’ and are functionally enriched in gene ontology terms relating to immune function (S3 Table). This suggests that the heterozygous mutant fish still preserve some immune-related gene expression changes that occur during normal aging.
Gene expression changes are likely not due to changes in proportions of brain cell types
It is possible that changes in the proportions of different cell types in the brain could result in genes being falsely interpreted as differentially expressed. As a preliminary test to see whether our observations of differential gene expression were artefacts of change in the proportions of major brain cell types (e.g. astrocytes, microglia, neurons, oligodendrocytes), we checked for noticeable changes in the average expression for sets of marker genes characteristic of each of the major brain cell types across the samples in each experimental condition (young wild type, young heterozygous mutant, aged wild type, aged heterozygous mutant). Representative marker genes for microglia were obtained from Oosterhof et al. [36] while gene markers for astrocytes, neurons, and oligodendrocytes were obtained from Lein et al. [37] The number of genes used to calculate the average gene expression (in logCPM) was 41 (astrocyte), 99 (microglia), 77 (neuron) and 78 (oligodendrocyte). Although this method is limited in that it does not account for the significant diversity within these broader cell types nor regional brain differences, this level of analysis suggests that broadly, the average expression of gene markers for the major neural cell types does not appear to change much across experimental conditions. In addition, no obvious outlier samples were evident (Fig C in S1 File).
Regulation of gene expression in the heterozygous mutant zebrafish brains differs from normal brain aging
A transcription factor can regulate gene expression by binding to a specific DNA motif in the promoter region of a gene. We hypothesised that changes in gene expression during normal aging or differences in gene expression between heterozygous mutant and wild type brains could be driven by differences in transcription factor activity. To test this, we examined gene promoter regions for enriched motifs corresponding to known transcription factor binding sites (summarised in S5 Table; full results in S6 Table). Overall, we find:
Numerous known transcription factors likely drive the gene expression changes that occur during normal zebrafish brain aging. As wild type brains age, the genes which are differentially expressed are significantly enriched in many known motifs. These motifs correspond to binding sites for interferon regulatory factors (e.g. IRF1, IRF2, IRF8); a binding site for the PU.1-IRF8 complex; an interferon-stimulated response element (ISRE); and binding sites for various transcription factors important for essential cellular processes like proliferation, differentiation, and apoptosis (Atf3, Fra2, Ets-distal, AP-1, Fra1, JunB, BATF, and ZNF264).
Altered glucocorticoid signalling in heterozygous mutant zebrafish brains is likely to contribute to a pathological state. Promoters of genes that are differentially expressed in the ‘aged heterozygous mutant vs. aged wild type’ comparison are significantly enriched in the glucocorticoid receptor element motif (GRE) (Bonferroni p-value = 0.0057). Interestingly, the subset of genes showing inappropriate downregulation (down-regulated in the ‘aged heterozygous mutant vs. young heterozygous mutant’ and ‘aged heterozygous mutant vs. aged wild type’ comparisons) is more strongly enriched again in the GRE motif (Bonferroni p-value = 0.0001), suggesting that genes that are normally activated by glucocorticoid signalling during aging may not be activated in aged heterozygous mutant brains. This altered glucocorticoid signalling appears to be present even in young zebrafish brains, as genes showing inverted behaviour (opposite direction of differential expression in ‘young heterozygous mutant vs. young wild type’ and ‘aged heterozygous mutant vs. aged wild type’ comparisons) are also enriched in the GRE motif (Bonferroni p-value = 0.0047). Because these inverted genes tend to show high expression in young heterozygous mutant brains (i.e. up-regulated in the ‘young heterozygous mutant vs. young wild type’ comparison) and low expression in aged heterozygous mutant brains (i.e. down-regulated in the ‘aged heterozygous mutant vs. aged wild type’ comparison), this suggests that young heterozygous mutant zebrafish brains may initially exhibit abnormally increased glucocorticoid signalling, while aged heterozygous mutant brains later exhibit abnormally decreased glucocorticoid signalling. Notably, the inverted genes containing a GRE motif in their promoters include COQ10A (encodes Coenzyme Q10, a key component of the electron transport chain and free-radical scavenging antioxidant); pik3r3a (encodes regulatory subunit gamma of phosphoinositide 3-kinase, an enzyme that interacts with insulin growth factor 1 receptor among other proteins); mmadhc (encodes a protein involved in an early and essential step of vitamin B12 metabolism), plk3 (polo-like kinase 3, involved in stress response and double-stranded DNA repair), and fkbp5 (encodes FK506 binding protein, involved in regulating immune and stress responses, protein trafficking and folding, and glucocorticoid receptor regulation). A list of zebrafish genes containing the GRE promoter motif is provided in S7 Table.
Gene expression changes in the heterozygous mutant zebrafish indicate vast changes to cellular processes and pathways
A gene set is a group of genes that contribute to a known biological function, pathway, or state. A gene set test is an analysis used to evaluate whether a particular gene set is differentially expressed for a particular comparison. We used the FRY method to test whether ‘Hallmark’ gene sets from the Molecular Signatures Database, MSigDB [38] were associated with differential expression in each of the four comparisons (Fig 4 and S8 Table). Using an FDR-adjusted p-value < 0.05 to define a gene set as differentially expressed, we find:
50 gene sets are differentially expressed during normal brain aging (‘aged wild type vs. young wild type’) (middle row of heatmap, Fig 4A). This supports that many biological functions and pathways are altered during normal aging. For some gene sets, the proportion of genes that are up-regulated and down-regulated is similar (e.g. interferon alpha response, E2F targets, early estrogen response). However, other gene sets contain a predominance of up-regulated genes (e.g. epithelial mesenchymal transition, TNFA signalling via NFKB) or down-regulated genes (e.g. coagulation, reactive oxygen species pathway).
22 gene sets are differentially expressed in young heterozygous mutant brains (‘young heterozygous mutant vs. young wild type’) (top row of heatmap, Fig 4A). These 22 gene sets may represent earlier functional changes in the brain that occur due to this mutation. The gene sets implicate diverse processes including Wnt/β-catenin signalling, early estrogen response, DNA repair, hedgehog signalling and fatty acid metabolism. Similar to the pattern of accelerated aging observed in Fig 3, we also observe that most of the gene sets up-regulated in young heterozygous mutant brains are regulated in the same direction during normal aging. This is consistent with the idea that the biological changes in young heterozygous mutant brains may partially recapitulate those that occur during normal brain aging.
44 gene sets are differentially expressed between aged heterozygous mutant and aged wild type brains (bottom row, Fig 4A). These differentially expressed gene sets may represent the pathological state of aged zebrafish brains bearing this mutation. Importantly, 21 of the 22 gene sets that were differentially expressed in young heterozygous mutant brains (‘young heterozygous mutant vs. young wild type’) remain altered also when these are aged (‘aged heterozygous mutant vs. aged wild type’). However, the proportions of up - and down-regulated genes tend to differ; notably, several gene sets containing a predominance of up-regulated genes in the young heterozygous mutant brains contain a predominance of down-regulated genes in the old heterozygous mutant brains. These ‘inverted’ gene sets include biological functions and pathways as diverse as Wnt/β-catenin signalling, early estrogen response, hedgehog signalling, androgen response, epithelial mesenchymal transition, DNA repair, apical surface, and TGF-β signalling.
Aging in the heterozygous mutant brains is similar but distinct from aging in wild type brains. The 50 gene sets differentially expressed during normal brain aging are also differentially expressed during heterozygous mutant brain aging (‘aged heterozygous mutant vs. young heterozygous mutant’) (Fig 4B). However, proportions of up - and down-regulated genes differ from those in normal brain aging. This suggests that zebrafish brains bearing this mutation may not properly regulate certain gene sets during aging (e.g. cholesterol homeostasis, adipogenesis, DNA repair, hypoxia, Wnt/β-catenin signalling).
Fig. 4. Differential gene set expression in heterozygous mutant (psen1K97fs/+) zebrafish brains compared to wild type siblings. Values in each cell are the estimated proportions of up- and down-regulated genes for each gene set, for any particular pairwise comparison shown to the left of the cells. A missing cell indicates that the particular gene set is not differentially expressed for that particular pairwise comparison. Colours of cells are proportional to the difference between the proportion of up- and down-regulated genes in a gene set. Differentially expressed gene sets have Mixed FDR below 0.05, indicating genes within the gene set show statistically significantly altered (up and/or down) expression for a particular comparison. The genes in each gene set are defined using the “Hallmark” gene set collection at the Molecular Signatures Database (MSigDB). (A) Gene sets showing differential expression between heterozygous mutant (psen1K97fs/+) and wild type (psen1+/+) zebrafish brains at 6 months (young) and 24 months (aged). The comparison representing normal aging (aged wild type vs. young wild type) is also shown to highlight the ‘accelerated aging’ phenomenon in the young heterozygous mutants. (B) Gene sets showing differential expression during normal aging. The aged K97fs/+ vs. young K97fs/+) comparison is also shown to highlight the phenomenon of aberrant aging in the heterozygous mutants. Altered protein abundance in the heterozygous mutant zebrafish brains
Despite its high sensitivity, estimating gene expression does not capture regulatory processes or post-transcriptional modifications that might affect the amount of active protein. Correlation between gene expression and protein abundance in samples from multicellular organisms has been notoriously low [39], but analysing proteomics data alongside gene expression data has been shown to be an effective complementary approach [40]. Because of this, we decided to use LC-MS/MS to compare protein abundance in heterozygous mutant zebrafish brains relative to wild type siblings. Overall, 323 proteins were reliably quantified across all samples aged 6 or 24 months. Testing for differential protein abundance was done analogously to testing for differential gene expression, with differences at FDR-adjusted p-value < 0.05 considered statistically significant. 22 proteins were differentially abundant between 6-month-old heterozygous mutant and wild type brains, while 65 proteins were differentially abundant between 24-month-old heterozygous mutant and wild type brains (Fig 5; Fig D in S1 File). Unexpectedly, three proteins found to be differentially abundant between 6-month-old heterozygous mutant and wild type zebrafish have causative roles in human neurodegenerative diseases: apolipoprotein Eb (encoded by the zebrafish apoeb gene, orthologous to the major human genetic risk factor for sporadic AD, APOE), superoxide dismutase (encoded by the zebrafish sod1 gene, orthologous to the human SOD1 gene mutated in familial amyotrophic lateral sclerosis), and protein DJ-1 (encoded by the zebrafish park7 gene, orthologous to the human PARK7 gene mutated in familial Parkinson’s disease). Overall, correlation between gene expression and protein abundance was low with rs = 0.4 at 6 months of age and rs = 0.28 at 24 months of age (Figs E and F in S1 File). However, this is overall consistent with previously reported correlation coefficients in multicellular organisms that range from 0.09 to 0.68 [39]).
Fig. 5. Protein abundance changes in the brains of heterozygous mutant (psen1K97fs/+) zebrafish compared to wild type (psen1+/+) siblings at 6 months (young) and 24 months (aged). Protein abundance was quantified at the peptide-level with LC-MS/MS (liquid chromatography tandem mass spectrometry) and differential abundance was assessed using moderated t-tests (limma). Differentially abundant proteins are defined as those with FDR-adjusted p-value < 0.05. Protein names were used to retrieve equivalent gene symbols for display purposes on these heatmaps. (A) Differentially abundant proteins between young heterozygous mutant and wild type zebrafish brains. (B) Differentially abundant proteins between aged heterozygous mutant and wild type zebrafish brains. The proteins have been clustered according to their abundance changes across the four comparisons. Gene expression changes in the heterozygous mutant zebrafish brains can be compared to those in human AD
Our results indicate that gene expression changes involving diverse cellular processes occur in aged heterozygous mutant zebrafish brains. The K115fs mutation is a human fAD mutation, but the majority of human AD cases are sporadic, arise from diverse environmental and genetic risk factors, and can involve heterogenous pathological changes in the brain. Nevertheless, it may be informative to explore the extent to which the changes in aged heterozygous mutant zebrafish can model those in human AD.
To assess the similarity of these changes to human brains with AD, we compared gene expression patterns in our zebrafish RNA-seq dataset and an independent human RNA-seq dataset from the Mayo RNA-seq study. The Mayo RNA-seq dataset includes not only patients with AD (defined as having dementia symptoms, Braak neurofibrillary tangle stage IV or greater, and presence of amyloid pathology) and similarly aged controls, but also patients with other brain afflictions that recapitulate aspects of AD (“pathological aging” patients possessing amyloid pathology without dementia symptoms, and progressive supranuclear palsy patients possessing neurofibrillary tangle pathology but no amyloid pathology) [41].
We constructed separate gene co-expression networks from the zebrafish and human RNA-seq datasets. Each network only included genes that were orthologs in humans and zebrafish. Whilst there are many methods for constructing a co-expression network of gene expression [42], we used the weighted gene co-expression network analysis (WGCNA) method [43], which has previously been used to group genes expressed in the brain into “modules” associated with biological functions or activities [44–48]. The zebrafish brain co-expression network is shown in Fig 6, and the human brain co-expression network is provided in Fig G in S1 File.
Fig. 6. Zebrafish brain gene co-expression network. We identified 30 modules (i.e. groupings of genes) in the zebrafish brain co-expression network containing between 54 and 1221 genes each and 27 modules in the human brain co-expression network containing between 62 and 921 genes each. We used two methods to confirm that most modules represented functional relationships between genes: enrichment analysis (for identifying enriched biological functions and enriched promoter motifs), and correlating modules with particular traits of interest (age and/or psen1 genotype). By correlating modules with particular zebrafish traits (age and psen1 genotype), we identified 13 (out of 30) modules showing evidence of altered expression patterns in heterozygous mutant zebrafish brains (Fig 6B). Using enrichment analysis, we identified the biological relevance of each module in the zebrafish co-expression network (see Table 1 for a summary, and full enrichment analysis results are shown in S9–S11 Tables). Overall, the majority of modules in the zebrafish and human networks show significant enrichment in known functional annotations (e.g. Gene ontology terms, MSigDB gene sets, KEGG pathways, with Bonferroni-adjusted p-value < 0.05), supporting the idea that these modules are likely to represent biologically relevant groupings of genes. Some of the biological functions represented by different modules in the zebrafish brain include: G-protein coupled receptor signalling pathway (represented by module 13), TGF-β and Wnt/β-catenin signaling (represented by module 15), PI3K/AKT activation (represented by module 18), immune response (represented by module 20), regulation of MAPK cascade (represented by module 26), and oxidative phosphorylation (represented by module 27). The genes in several modules in the zebrafish network were also significantly enriched in promoter motifs including the glucocorticoid receptor element (GRE) motif (for genes in module 18), GATA3 motif (for genes in module 23), and numerous ETS transcription factor motifs (for genes in module 20) (Bonferroni-adjusted p-values < 0.05) (S12 Table).
Tab. 1. Summary of modules in a co-expression gene expression network constructed from zebrafish RNA-seq data and their preservation in an independent human brain microarray data set. Several pathological changes in the heterozygous mutant zebrafish brains are similar to those in human AD brains
There are several methods for assessing whether modules are preserved across two independent gene co-expression networks constructed using the same genes [49]. The most easily interpretable method is to compare directly the assignment of equivalent genes to modules identified in each network. The resulting overlap in gene co-expression patterns across the two networks can be visualised using a Sankey diagram (Fig 7). Overall, the gene co-expression patterns in the zebrafish brain appear to be broadly similar to the gene co-expression patterns in the human brain, despite differences in RNA-seq platform and brain regions used, which would be expected to make the networks less comparable. A more sophisticated method of assessing module preservation involves using permutation-based Z-statistics to test whether certain properties of modules (e.g. density, connectivity) defined in one co-expression network are preserved in another network [49]. Z-statistics for each module property can be summarised into a Z-summary score, with Z-summary scores less than 2 indicating no module preservation, scores between 2 and 10 indicating weak to moderate module preservation, and scores above 10 indicating strong preservation [49]. When comparing zebrafish and human brain co-expression networks, four of the 30 zebrafish modules (16, 20, 13, 26) have Z-summary scores between 2 and 10, indicating weak to moderate preservation in the human co-expression network (Table 1, S9 Table). While modules 16 (enriched in functions relating to ribosome and nonsense mediated decay) and 13 (enriched in G-protein coupled receptor activity) do not show significant differences between heterozygous mutant and wild-type brains as they age, modules 20 and 26 display distinct coordinated changes in expression during aging of wild-type brains. Module 20 genes are enriched in immune response functional terms and tend to be up-regulated with aging (correlation p-value 0.01), while module 26 genes are enriched in terms relating to regulation of the MAPK cascade and tend to be down-regulated with aging (correlation p-value 0.05, Fig 6). Importantly, these coordinated gene expression changes appear to be lost in aged heterozygous mutant brains (correlation p-values of 0.3 and 0.3 respectively), suggesting the K97fs mutation in psen1 may contribute to alterations in at least these biological functions. Notably, module 26 which is enriched in immune response functions also displays significant enrichment in ETS and IRF promoter motifs (see Table 1, all FDR-adjusted p-values < 0.05). The equivalent module in the human co-expression network also displays enrichment in these particular motifs, suggesting that the regulation of immune and microglial gene expression responses is likely well conserved between aged zebrafish and human brains.
Fig. 7. Module overlap between co-expression networks constructed using zebrafish and human brain gene expression data. Aged heterozygous mutant brains possess increased abundance of microglia
The changes we observed in immune-microglia gene co-expression in the aged heterozygous mutant brains prompted us to ask whether differences might be observable in microglial form or even abundance. We used immunostaining for the pan-leukocyte marker L-plastin to detect microglia on sections of fixed brain material from 24-month-old wild type and heterozygous mutant zebrafish (Fig 8). An increased abundance of cells expressing L-plastin was evident in psen1K97fs/+ heterozygotes in both ventricular (Fig 8C.i and 8E.i) and parenchymal (Fig 8C.ii and 8F.i) regions compared to wild type brains (Fig 8D.i and 8D.ii). We observed significant differences in mean fluorescent intensity (MFI) of the image in the L-plastin channel indicating increased abundance of cells expressing L-plastin in the forebrain, midbrain and hindbrain regions of heterozygous mutant and wild type fish (Fig 8G, p = 0.0048, p = 0.0005, p<0.0001 respectively; two-way ANOVA with Sidak’s multiple comparisons test). This immunostaining was also capable of distinguishing between distinct morphologies of microglia in the ventricular (amoeboid “activated” morphology) and parenchymal (ramified morphology) regions in the zebrafish brain (Fig H in S1 File) although there was no obvious variation in morphology observed between heterozygous mutant and wild type brains.
Fig. 8. Cells expressing L-plastin are more abundant across the heterozygous mutant (psen1K97fs/+) zebrafish brain than in wild type siblings at 24 months. Immunostaining for the pan-leukocyte marker L-plastin supports increased numbers of microglia in the forebrain (A-B), midbrain (C-D) and hindbrain (E-F). Increased microglial abundance is evident in psen1K97fs/+ heterozygotes in both ventricular (D.i, F.i) and parenchymal (D.ii) regions compared to wild types (C, E). (G) Significant differences in MFI were observed between the forebrain, midbrain and hindbrain of psen1K97fs/+ and psen1+/+ fish; **p = 0.0048, ***p = 0.0005, ****p < 0.0001; two-way ANOVA with Sidak’s multiple comparisons test. Data presented as means with SEM. Scale bar 50 μm in all images. Molecular changes in the aged heterozygous mutant zebrafish brains occur without obvious histopathology
Teleosts (bony fish) such as the zebrafish show impressive regenerative ability following tissue damage that includes repair of nervous tissue. Previous attempts to model neurodegenerative diseases in adult zebrafish have failed to show cellular phenotypes [50]. Also, zebrafish are thought unlikely to produce the Aβ peptide [51] that many regard as central to AD pathological mechanisms [52]. The analyses described in this paper support that a fAD mutation mimicking PS2V formation may accelerate aspects of brain aging and promote a shift in aged heterozygous mutant brains towards an altered, pathological state of gene and protein expression. We therefore made histopathological comparisons of aged (24 months) wild type and heterozygous mutant brains equivalent to those used in our ‘omics analyses. Analysis of various brain regions using markers of aging, senescence and amyloid accumulation (lipofuscin, senescence-associated β-galactosidase, and Congo Red staining respectively) revealed no discernible differences (see Materials and methods and Figs I-K in S1 File). This is consistent with the lack of neurodegenerative histopathology observed in a heterozygous knock-in model of a PSEN1 fAD mutation in mice [25].
Discussion
Fig 9 summarises the main molecular changes that occur with aging and heterozygous mutation.
Fig. 9. Summary of the molecular changes in the brains of zebrafish due to aging and/or the K115fs-like mutation (psen1K97fs/+). For each of the four pairwise comparisons shown, the summarised molecular changes (↑ = overall increased, ↓ = overall decreased, • = significant alterations but not in an overall direction) were inferred from a combination of the following analyses: functional enrichment analysis of differentially expressed genes and proteins, promoter motif enrichment analysis of differentially expressed genes, gene set enrichment analysis of differentially expressed genes, and weighted co-expression network analysis of the gene expression data. Evidence of increased stress long preceding AD
We identified a subset of ‘inverted’ genes that are up-regulated in young heterozygous mutant brains, but down-regulated in aged heterozygous mutant brains. Although this pattern might be overlooked, similar patterns have been observed in human cases. Patients with Mild Cognitive Impairment, pre-clinical AD, or Down Syndrome (who often develop AD in adulthood) initially display increased expression of particular genes, which show decreased expression when AD symptoms become more severe [23, 53–55]. Collectively, results from these studies and our heterozygous mutant zebrafish suggest that early increases in brain activity likely precede AD symptoms in both PSEN1-mutation carriers and more general cases of AD. Evidently, to find strategies for preventing AD progression while patients are still asymptomatic, it is important to understand the causes of this increased gene activity in the brain.
Our results suggest that stress responses likely contribute to early increases in brain activity for fAD mutation carriers. In heterozygous mutant zebrafish, the inverted gene expression pattern seems to arise from altered glucocorticoid signalling. In humans, chronically increased glucocorticoid signalling in the brain can lead to glucocorticoid resistance, whereby the brain is unable to increase glucocorticoid signalling even during stressful conditions [56, 57]. We did not confirm whether glucocorticoid signalling and cortisol levels were altered in zebrafish brains in vivo. However, many of the inverted genes possess glucocorticoid receptor elements in their promoters, with one particular inverted gene (fkbp5) encoding a protein which is known to bind directly to the glucocorticoid receptor to negatively regulate its activity. Previous studies in humans demonstrate that fkbp5 levels are highly responsive to chronic stress and stress-related diseases (e.g. bipolar disorder; depression in AD [58]), implying that fkbp5 expression is a sensitive marker of glucocorticoid signalling. Our analysis supports this idea, with fkbp5 mRNAs showing a significant difference in expression between heterozygous mutant and wild type brains (logFC = 2.1, FDRp = 1.77e-06 in young heterozygous mutant vs wild type; logFC = -3.9, FDRp = 3.16e-08 in aged heterozygous mutant vs wild type). Aside from altered glucocorticoid signalling, we also found altered gene expression patterns associated with diverse biological changes in heterozygous mutant zebrafish brains. If we assume that these heterozygous mutant zebrafish model some aspects of human AD, then these alterations may offer insight into early changes in the brains of human fAD-mutation carriers and, potentially, other individuals predisposed to AD. The brains of young heterozygous mutant zebrafish exhibit changes relating to developmental signalling pathways (Wnt/β-catenin signalling, hedgehog signalling, TGF-β signalling), stress and immune responses (DNA repair, IL2-STAT5 signalling, complement system, IFN-γ response, inflammatory response), hormonal changes (early and late estrogen responses, androgen response), and energy metabolism (glycolysis, oxidative phosphorylation). Appropriate regulation of these biological processes is critical for brain function, so it is unsurprising that disruption of these processes in the brain has been linked previously to various pathological states, including early stages of neurodegeneration [59–62].
Quantifying protein abundance in young heterozygous mutant zebrafish brains revealed additional sources of early-life stress. In young heterozygous mutant zebrafish brains, proteins associated with oxidative stress responses and energy metabolism in mitochondria already demonstrated altered abundance. Overall, stress responses were increased, consistent with the RNA-seq data, and decreased abundance of metabolic and antioxidant proteins imply mitochondrial function was likely already impaired. Both increased oxidative stress and altered energy metabolism are known to be early events in AD [2, 63–69], consistent with the idea that these events may contribute to early stress responses in the brain.
Involvement of microglia-mediated immune responses in AD
Our analysis identified two modules with altered gene co-expression patterns in both the aged heterozygous mutant zebrafish brains and post-mortem human AD brains. These modules demonstrated significant functional enrichment in immune and microglial responses (module 20 in the zebrafish network) and regulation of the MAPK cascade (module 26 in the zebrafish network), consistent with their well-established dysfunction in human AD [9, 36, 70, 71]. Gene co-expression changes associated with the immune-microglia responses and the MAPK cascade were evident in aged but not young heterozygous mutant brains, suggesting that these changes are likely to occur in later stages of AD pathogenesis. Our results are consistent with two independent studies involving co-expression analysis of AD brains by Miller et al. [47] and Zhang et al. [48] which also identified a prominent immune-microglia module demonstrating similar changes in gene co-expression in AD patients, despite differences in patient cohorts used, brain regions and tissue types sampled, RNA-seq or microarray platforms, and methodology used to construct the gene co-expression networks. Collectively, the results from these studies and our analysis support the involvement of microglia-mediated immune responses in late stages of AD pathogenesis.
Our analysis reveals additional insights that help explain the involvement of the immune-microglia module in AD. Promoter enrichment analysis of genes in the immune-microglia module indicates statistically significant enrichment in several known motifs. Interestingly, all of these motifs are binding sites for transcription factors from either the ETS (SpiB, ELF3, ELF5, PU.1, EHF) or IRF (IRF3, IRF8, IRF1) families. This finding is important, because 1) ETS and IRF transcription factor motifs are also enriched in the promoters of genes that are up-regulated with brain aging in wild type zebrafish, but not in genes that are up-regulated with brain aging in heterozygous mutant zebrafish. This suggests that the genes they regulate are important during normal brain aging and that their dysregulation may contribute to pathology. 2) ETS and IRF transcription factors are known to mediate critical biological functions, with ETS factors regulating cellular differentiation, proliferation, cell-cycle control, apoptosis, migration and mesenchymal-epithelial interactions [72, 73], and IRF factors mediating immune and other stress responses. Our results are consistent with those in a previous study by Gjoneska et al. [74] that analysed RNA-seq and ChIP-seq (chromatin immunoprecipitation sequencing) data from mouse and human brain tissues, which found that immune response genes were up-regulated in both the CK-p25 mouse model and in human sporadic AD, that these genes were enriched in ChIP-seq peaks corresponding to ETS and IRF transcription factor motifs, and that microglia-specific activation was likely responsible for these gene expression changes.
Immunohistochemistry on sections from aged brains to identify L-plastin-expressing cells, (thought to represent microglia), revealed an increased abundance of these cells in heterozygous mutant fish compared to wild type fish but no obvious genotype-dependent differences in cell morphologies. The concentration of these cells in ventricle-proximal regions suggests an involvement with neural cell proliferation [75] which might occur in the regenerative zebrafish brain if the rate of cell turnover was increased due to pathological processes and this deserves future investigation. The increased abundance of L-plastin-expressing cells was not reflected in a noticeable increase in the mean expression of multiple microglial marker genes from the RNA-seq data. However, the RNA-seq data was derived from entire zebrafish brains and this may have obscured region-specific differences in microglial abundance, morphology, and activation.
Heterozygous mutant zebrafish in our study overall appear to recapitulate partially certain transcriptional and molecular changes that occur in more general cases of sporadic AD. Although revealing valuable insights, our comparison of the gene co-expression patterns in the zebrafish and human datasets is limited by inherent differences in species-level gene expression, differences in the brain regions and tissues sampled in each dataset, and difference in the RNA-seq platforms used to collect data, which has been previously shown to affect network properties including connectivity and density of modules [42]. In addition, the heterogeneity of sporadic AD would likely result in variation in gene expression patterns which may also confound our ability to identify reliably gene modules showing similar expression patterns across all samples. All of these differences would likely have contributed to decreasing our ability to detect preservation of modules between the zebrafish and human co-expression networks.
AD-like gene expression changes can occur without amyloid pathology typically associated with AD
Somewhat surprisingly, the gene and protein expression changes observed in our aged heterozygous mutant zebrafish were not reflected in an obvious histopathology. However, this is consistent with an attempt to model neuronal ceroid lipofuscinosis in adult zebrafish [50] and with observations from heterozygous fAD mutation knock-in models in mice [25–27] (although, in general, mouse single heterozygous mutation brain histology phenotypes have not been reported). It is important to realise that differences in scale between the mass of a human brain and the brains of mice and zebrafish, (~1,000-fold and ~200,000 fold respectively) mean that any metabolic or other stresses in the small brains of the genetic models are likely exacerbated in the huge human brain [76]. Human brains also lack the regenerative ability of zebrafish, while mice and zebrafish both show sequence divergences in the Aβ regions of their APP orthologous genes greater than seen in most mammals [33, 77, 78]. Nevertheless, the heterozygous fAD-like mutation models of mice and (with this paper) zebrafish are probably the closest one can come to modelling AD in these organisms without subjectively imposing an opinion of what AD is by addition of further mutations or transgenes.
It is important to remember that the pathological role in AD of Aβ, neuritic plaques, and neurofibrillary tangles is still debated and that around one quarter of people clinically diagnosed with AD lack typical amyloid pathology upon post-mortem examination [79]. By the current definition, these people do not have AD [80] although this restrictive definition has been questioned [81, 82]. Many people also have brains containing high levels of Aβ [83] or Braak stage III to VI neurodegeneration [79] without obvious dementia. Thus the connection between amyloid pathology, histopathological neurodegeneration and Alzheimer’s disease dementia is unclear. Our data indicate that the AD cellular pathologies may occur subsequent to cryptic but dramatic changes in the brain’s molecular state (gene and protein expression) that are the underlying drivers of AD.
Finally, it is also important to acknowledge that the specific fAD mutation modelled in this study (K115fs of PSEN2) is an uncommon fAD mutation which produces novel alternative transcripts and splice isoforms, and it is unclear how pathogenic effects of this mutation might compare to other more common fAD mutations [84]. When beginning this research, we initially hypothesised that the alternative protein product PS2V (exon 6 deletion) produced from mutant K115fs PSEN2 played a pathogenic role in AD. PS2V has previously been detected in sAD brains [29], and our previous research suggested dominant-negative effects of the functionally similar PS2V-like protein product produced from zebrafish psen1 [32, 85]. Recent research suggests that some aberrant transcripts derived from the human K115fs mutant allele may, in fact, follow the "fAD mutation reading frame preservation rule" that is obeyed by all other fAD mutations in the PSEN genes [84]. If this is true, then our zebrafish model of K115fs is best regarded as illuminating the contribution that PS2V-mimicry by the K115fs mutation can make to its overall fAD phenotype. Nevertheless, our results indicate that the contribution made by such PS2V-mimicry is likely to be very significant. Our laboratory has been developing additional heterozygous mutant zebrafish modelling other forms of fAD mutation [86], and future analysis incorporating these zebrafish to produce a consensus co-expression network should help to identify and refine a “signature” of the transcriptome and proteome changes that cause fAD.
Materials and methods
Zebrafish husbandry and animal ethics
This study was approved under permits S-2014-108 and S-2017-073 issued by the Animal Ethics Committee of the University of Adelaide. Tübingen strain zebrafish were maintained in a recirculated water system.
Generation of TALEN coding sequences and single stranded oligonucleotide
TALEN coding sequences were designed by, and purchased from, Zgenebio (Taipai City, Taiwan). The DNA binding sites for the TALEN pair targeting psen1 were (5’ to 3’): left site, CAAATCTGTCAGCTTCT and right site, CCTCACAGCTGCTGTC (Fig A in S1 File). The coding sequences of the TALENs were provided in the pZGB2 vector for mRNA in-vitro synthesis. The single stranded oligonucleotide (ssoligo) sequence was designed such that the dinucleotide ‘GA’ deletion was in the centre of the sequence with 26 and 27 nucleotides of homology on either side of this site (Fig A in S1 File). The ssoligo was synthesized by Sigma-Aldrich (St. Louis, Missouri, USA) and HPLC purified. The oligo sequence was (5’ to 3’): CCATCAAATCTGTCAGCTTCTACACACAAGGACGGACAGCAGCTGTGAGGAGC (Fig A in S1 File).
In-vitro mRNA synthesis
Each TALEN plasmid was linearized with Not I. Purified linearized DNA was used as a template for in-vitro mRNA synthesis using the mMESSAGE mMACHINE SP6 transcription kit (Thermo Fisher, Waltham, USA) as per the manufacturer’s instructions as previously described [85].
Microinjection of zebrafish embryos
Embryos were collected from natural mating and, at the 1-cell stage, were microinjected with a ~3nl mixture of 250ng/μl of left and right TALEN mRNA and 200ng/μl of the ssoligo.
Genomic DNA extraction of zebrafish tissue
Embryos
A selection of 10–20 embryos were collected at 24 hpf and placed in 150μl of a 50mM NaOH 1xTE solution and then incubated at 95°C until noticeably dissolved (10-20mins). The lysis solution was cooled to 4°C and 50μl of Tris solution (pH 8) was added. The mixture was then centrifuged at maximum speed for 2 mins to pellet cellular debris. The supernatant was transferred into a fresh microfuge tube ready for subsequent PCR.
Adult fin clips
For fin clips, adult fish were first anesthetised in a 0.16 mg/mL tricaine solution and a small section of the caudal fin was removed with a sharp blade. Fin clips were placed in 50μl of a 1.7 μg/ml Proteinase K 1xTE solution and then incubated at 55°C until noticeably dissolved (2-3hours). The lysis solution was then placed at 95°C for 5mins to inactivate the Proteinase K.
Genomic DNA PCR and sequencing for mutation detection
To genotype by PCR amplification, 5 μl of the genomic DNA was used with the following primer pairs as relevant. Primers to detect wild type (WT) sequence at the mutation site: primer psen1WTF: (5’TCTGTCAGCTTCTACACACAGAAGG3’) (GA nucleotides in italics) with primer psen1WTR: (5’AGTAGGAGCAGTTTAGGGATGG3’). Primers to detect the presence of the GA dinucleotide deletion: primer psen1GAdelF: (5’AATCTGTCAGCTTCTACACACAAGG3’) with primer psen1WTR. To confirm the presence of the GA dinucleotide deletion mutation by sequencing of extracted genomic DNA, PCR primers were designed to amplify a 488 bp region around the GA mutation site: primer psen1GAsiteF: (5’GGCACACAAGCAGCACCG3’) with primer psen1GAsiteR: (5’TCCTTTCCTGTCATTCAGACCTGCGA3’). This amplified fragment was purified and sequenced using the primer psen1seqF: (5’ AGCCGTAATGAGGTGGAGC 3’). All primers were synthesized by Sigma-Aldrich. PCRs were performed using GoTaq polymerase (Promega, Madison, USA) for 30 cycles with an annealing temperature of 65°C (for the mutation-detecting PCR) or 61°C (for the WT sequence-detecting PCR) for 30 s, an extension temperature of 72°C for 30 s and a denaturation temperature of 95°C for 30 s. PCR products were assessed on 1% TAE agarose gels run at 90V for 30 mins and subsequently visualized under UV light.
Whole brain removal from adult zebrafish
Adult fish were euthanized by sudden immersion in an ice water slurry for at least ~30 seconds before decapitation and removal of the entire brain for immediate RNA or protein extraction. All fish brains were removed during late morning/noon to minimise any influence of circadian rhythms.
RNA extraction from whole brain
Total RNA was isolated from heterozygous mutant and WT siblings using the mirVana miRNA isolation kit (Thermo Fisher). RNA isolation was performed according to the manufacturer’s protocol. First a brain was lysed in a denaturing lysis solution. The lysate was then extracted once with acid-phenol:chloroform leaving a semi-pure RNA sample. The sample was then purified further over a glass-fiber filter to yield total RNA. This procedure was formulated specifically for miRNA retention to avoid the loss of small RNAs. Total RNA was then sent to the ACRF Cancer Genomics Facility (Adelaide, Australia) to assess RNA quality and for subsequent RNA sequencing on the Illumina NextSeq platform as paired-end 100bp reads.
RNA extraction and cDNA synthesis from entire brains for digital PCR
Total RNA was extracted using the QIAGEN RNeasy Mini Kit according to the manufacturer’s protocol. The RNA was DNase-treated using RQ1 DNase (Promega) according to the manufacturer’s protocol prior to cDNA synthesis. Equal concentrations of total RNA from each brain were used to synthesise first-strand cDNA by reverse transcription with random priming (Superscript III kit; Invitrogen). cDNA was RNaseH treated before use in 3D Quant Studio Digital PCR.
Allele-specific digital quantitative PCR
Digital PCR was performed on a QuantStudio™ 3D Digital PCR System (Life Technologies, Carlsbad, California, USA). 20μL reaction mixes were prepared containing 9 μL 1X QuantStudio™3D digital PCR Master Mix (Life Technologies), 2 μL of 20X Sybr® dye in TE buffer, 25ng cDNA per total reaction (determined from the RNA concentration under the assumption that single strand cDNA synthesis from total RNA was complete), 200nM of specific primers and 6.3 μL of nuclease-free water (Qiagen). 14.5μL of the reaction mixture was loaded onto a QuantStudio™3D digital PCR 20 K chip (Life Technologies) using an automatic chip loader (Life Technologies) according to manufacturer’s instructions. Loaded chips underwent thermo-cycling on the Gene Amp 9700 PCR system under the following conditions: 96°C for 10 min; 45 cycles of 60°C for 2 min and 98°C for 30 sec; followed by a final extension step at 60°C for 2 min. After thermo-cycling, the chips were imaged on a QuantStudio™ 3D instrument [87, 88]. Primers used for psen1 allele detection were: wild-type allele forward 5’ CTACACACAGAAGGACGGACAGC 3’, K97fs allele forward 5’ TCTGTCAGCTTCTACACACAAGGA 3’ and both were paired with a common reverse primer 5’ GCCAGGCTTGAATCACCTTGTA 3’.
PCR test for aberrant splicing in the region of the K97fs mutation in zebrafish psen1
Total RNA was extracted from each 24-month-old zebrafish brain using the QIAGEN RNeasy mini Kit (QIAGEN, Hilden, Germany). 250ng of total RNA from each brain was then used to synthesise 20μL of first-strand cDNA by reverse transcription (SuperScript III kit, Invitrogen, Camarillo, California, USA). 10ng of each cDNA preparation (a quantity calculated from the RNA concentration on the assumption that reverse transcription of RNA into cDNA was complete) was used to perform PCR using Phusion high-fidelity DNA polymerase (New England Biolabs, Ipswich, Massachusetts). Each 25μL PCR reaction contained 0.2mM of deoxyribonucleotide triphosphates (dNTPs), 0.4μM of each PCR primer, 1 unit of Phusion polymerase and 10ng of zebrafish brain cDNA template. PCR cycling was performed with 35 cycles of a denaturation temperature of 95°C for 30s, then an annealing temperature of 60°C for 30s and then an extension temperature of 72°C for 2 minutes. PCR products were electrophoresed through a 1% agarose gel in 1×TAE buffer for separation and identification.
Protein extraction and proteomic analysis of adult brain
Sample preparation
Freshly removed entire adult zebrafish brains were lysed under denaturing conditions in 7 M urea (Merck, Darmstadt, Germany) plus complete protease inhibitors (Roche) using a Bioruptor (Diagenode, Seraing, Belgium) in ice cold water. Samples were quantified using the EZQ protein assay (Life Technologies) and the extracts were trypsin-digested using the FASP method [89]. Protein samples were then sent to the Adelaide Proteomics Centre (Adelaide, Australia) for quantification and data acquisition.
Data acquisition
Nano-LC-ESI-MS/MS was performed using an Ultimate 3000 RSLC system (Thermo Fisher Scientific) coupled to an Impact HD™ QTOF mass spectrometer (Bruker Daltonics, Bremen, Germany) via an Advance Captive Spray source (Bruker Daltonics). Peptide samples were pre-concentrated onto a C18 trapping column (THC164535, Thermo Fisher) at a flow rate of 5 μL/min in 2% (v/v) ACN 0.1% (v/v) FA for 10 minutes. Peptide separation was performed using a 75μm ID 50 cm C18 column (THC164540, Thermo Fisher) at a flow rate of 0.2 μL/minute using a linear gradient from 5 to 45% B (A: 5% (v/v) ACN 0.1% (v/v) FA, B: 80% (v/v) ACN 0.1% (v/v) FA) over 180 minutes. MS scans were acquired in the mass range of 300 to 2,200 m/z in a data-dependent fashion using Bruker’s Shotgun Instant Expertise™ method (singly charged precursor ions excluded from acquisition, CID from 23% to 65% as determined by the m/z of the precursor ion).
Data analysis
The acquired peptide spectra were identified and quantified using the mass spectrometry software MaxQuant with the Andromeda search engine against all entries in the non-redundant UniProt database (protein and peptide false discovery rate set to 1%). The MaxQuant software allows for the accurate and robust proteomewide quantification of label-free mass spectrometry data [90].
RNA-seq analysis
Data processing
We used FastQC [91] to evaluate the quality of the raw paired-end reads. Using AdapterRemoval [92], we trimmed reads and removed adapter sequences. From the FastQC reports, some over-represented sequences in the raw and trimmed reads corresponded to ribosomal RNA, possibly from insufficient depletion during library preparation. We removed ribosomal RNA sequences in silico by aligning all trimmed reads to known zebrafish ribosomal RNA sequences and discarding all reads that aligned. Next, we used HISAT2 [93] to align reads to the Ensembl zebrafish genome assembly (GRCz10). Using Picard [94] and the MarkDuplicates function, we removed optical and PCR duplicates from the aligned reads. To quantify gene expression, we used FeatureCounts [95], resulting in a matrix of gene expression counts for 32,266 genes for the 12 RNA-seq libraries.
Differential gene expression analysis
Differential gene analysis was performed in R [96] using the packages edgeR [97] and limma [98–100]. We retained 18,296 genes with >1.5 cpm in at least 6 of the 12 RNA-seq libraries. We then calculated TMM-normalisation factors to account for differences in library sizes and applied the RUVs method from the RUVseq package [101] to account for a batch effect with one factor of unwanted variation (k = 1). Differential gene expression analysis was performed using limma. We considered genes differentially expressed if the FDR-adjusted p-value associated with their moderated t-test was below 0.05. We used the pheatmap R package [102] to produce all heatmaps.
Gene set testing
We downloaded the Hallmark gene set collection from MSigDB v6.1 [38]. Using biomaRt [103, 104], we converted human Entrezgene identifiers to zebrafish Entrezgene identifiers. To perform gene set testing, we applied the fast rotation gene set testing (FRY) method [105] for each comparison. We considered all gene sets with non-directional (Mixed) FDR < 0.05 as differentially expressed. To obtain estimates of the proportions of up-regulated and down-regulated genes for each significant gene set, we used the ROAST [106] method with 9,999 rotations with the ‘set.statistic’ option set to ‘mean’, to maintain consistency with the results obtained from FRY.
Promoter motif analysis
We performed promoter motif enrichment analysis using HOMER [107, 108] and downloaded a set of 364 zebrafish promoter motifs from published ChIP-seq experiments, as collated by HOMER authors, using the command ‘configureHomer.pl -install zebrafish-p’. We retained default parameters with the findMotifs.pl program with the following modifications: the 18,296 Ensembl genes considered as expressed in the differential gene expression analysis were specified as the background; and promoter regions were defined as 1500 bp upstream and 200 bp downstream of the transcription start site. We defined motifs as being significantly enriched in a set of genes if the Bonferroni-adjusted p-value was less than 0.05.
LC-MS/MS analysis
Data processing
Raw MS/MS spectra were analysed using MaxQuant (V. 1.5.3.17). A False Discovery Rate (FDR) of 0.01 for peptides and a minimum peptide length of 7 amino acids was specified. MS/MS spectra were searched against the zebrafish UniProt database. MaxQuant output files for the 6-month-old and 24-month-old samples were processed in separate batches with the MSStats R package [109] due to an unresolvable batch effect. Briefly, peptide intensities were log2-transformed and quantile normalised, followed by using an accelerated failure time model to impute censored peptides. Peptide-level intensities were summarised to protein-level intensities using Tukey’s median polish method. This resulted in 2,814 peptides (summarised to 534 proteins) for the 6-month-old data and 3,378 peptides (summarised to 582 proteins) for the 24-month-old data. After summarisation, both sets of protein intensities were combined, quantile normalised and filtered to retain the 323 proteins that were detected across all samples.
Differential protein analysis
Differential protein abundance analysis was performed using limma [110] using moderated t-tests. Proteins were identified as being differentially abundant if FDR-adjusted p-values were below 0.05. Over-representation analysis using the ‘goana’ and ‘kegga’ functions from limma were used to test for enriched gene ontology terms and KEGG pathways respectively.
Gene co-expression network analysis
Network construction
We used the WGCNA R package to construct co-expression networks for our zebrafish RNA-seq data and a processed human RNA-seq dataset from the Mayo RNAseq study [41]. The human RNA-seq data consists of 101 bp paired-end reads sequenced with the Illumina HiSeq 2000 platform and derived from cerebellum and temporal cortex samples from North American Caucasian subjects with either AD (n = 86), progressive supranuclear palsy (PSP, n = 84), pathological aging (PA, n = 28) or controls lacking neurodegeneration (n = 80). The Mayo RNAseq study authors performed read alignment and counting using the SNAPR software with the GRCh38 reference human genome and Ensembl v77 gene models, and provided TMM-normalised gene counts as output by the edgeR package [97, 111]. We matched zebrafish genes to human homologous genes via orthologous Ensembl gene identifiers and retained genes that were expressed in both the human and zebrafish datasets, leaving 8,396 genes for network construction. To reduce noise during network construction, we calculated connectivities for each gene in each dataset and retained 7,576 genes with connectivities above the 10th percentile of all connectivities. To construct approximately scale-free weighted networks, the Pearson correlation was calculated between each pair of genes, and the resulting correlation matrix was raised to the soft-thresholding power of 14 to produce a signed adjacency matrix for each dataset [43]. Next, we applied a transformation to obtain a measure of topological overlap for each pair of genes. Lastly, we hierarchically clustered genes in each dataset based on the measure 1—Topological Overlap. To identify modules of co-expressed genes, we used the Hybrid Tree Cut method from the dynamicTreeCut package [112] with default parameters except for the following modifications: minimum module size set at 40 genes, 0.90 as the maximum distance to assign previously unassigned genes to modules during PAM (Partioning Around Medoids) stage, and the deepSplit parameter to 1 for both the human and zebrafish datasets.
Network analysis
We assessed functional enrichment of each module using default settings in the anRichment R package. We assessed promoter motif enrichment using HOMER as described earlier. To calculate the correlation between modules and phenotypic traits, we calculated the hybrid-robust correlation between the first principal component of each module and four binary variables defining the experimental conditions [113]. We evaluated the preservation of zebrafish modules in the human network and vice versa using the modulePreservation function from WGCNA, which uses a permutation-based approach to determine whether module properties (e.g. density, connectivity) are preserved in another network [49]. We also used the Sankey diagram functionality in the networkD3 package to visualise overlap between zebrafish and human modules [114].
Network visualisation
To visualise networks, we imported edges and nodes into Gephi and applied the OpenOrd algorithm with default settings [115]. We coloured the nodes (genes) based on their assigned modules from WGCNA.
psen1K97fs/+ vs. wild type L-plastin immunostain
Anti-L-plastin immunostain
Frozen cryosections of adult psen1K97fs/+ (n = 3 fish) or psen1+/+ (n = 4 fish) brains were dried for >1hr at room temperature, then rehydrated in 1x PBS for >30 min. Sections were then washed twice with 0.3% Triton X-100 in 1x PBS (PBS-Tx 0.3%) for 15 min at room temperature (RT). Sections were subsequently incubated with polyclonal rabbit anti-L-plastin primary antibody [116, 117] (a kind gift from Prof. Dr. Michael Brand, Centre for Regenerative Therapies, Technische Universität Dresden) at 1 : 2500 concentration in PBS-Tx 0.3%, overnight at 4°C in a humid chamber. Sections were then washed 3 x 20 min in PBS-Tx 0.3% at RT, followed by 1 h incubation at RT with goat anti-rabbit Alexa 488 secondary antibody (Thermo Fisher, 1 : 750 in PBS-Tx 0.3%) alongside DAPI at 1 : 5000 concentration. Sections were subsequently washed once for 10 min with PBS-Tx 0.3%, then twice for 20 min with 1x PBS at RT, then mounted with 50% glycerol in 1 x PBS.
Imaging
Z-stacks of brain sections were acquired on a Leica TCS SP8 confocal microscope equipped with a HyD detector, and using the Leica LASX software suite. Stacks were captured at 1024 x 1024 resolution at scanning speed of 600, with bidirectional X scanning active. No averaging or accumulation was applied to stack acquisitions, and laser power and gain were kept constant throughout image acquisition. Overview stacks were captured with either a 10x dry objective (midbrain, hindbrain overviews) or a 20x oil-immersion objective (forebrain overviews), while higher magnification stacks were acquired with a 40x water-immersion objective. ~3 stacks were captured per fish (one of each forebrain, midbrain and hindbrain at approximately equal levels).
Image processing and statistical analysis
Stacks were opened in Fiji 2 (https://imagej.net/Fiji/Downloads), and split into individual channels. The green channel (corresponding to L-plastin in all stacks) was max-projected and the MFI of the entire image was recorded using the Measure function. Statistical analysis was conducted in Prism 7 (GraphPad); MFI between brain regions in psen1K97fs/+ and psen1+/+ fish was compared via two-way ANOVA with Sidak’s multiple comparisons test. Statistical significance was defined as p<0.05, with all data presented as means with SEMs.
Histological analysis
Tissue preparation
Two-year-old adult zebrafish heterozygous for the psen1K97fs mutation and their wild type siblings were sacrificed by immersion in ice-water, then tails were nicked to exsanguinate the fish and prevent blood clotting on neural tissue. The dorsal neurocranium was subsequently resected to expose the brain. Fish were then decapitated and heads were incubated in a decalcification solution (100 ml 0.5M EDTA, 22 g sucrose, 11 ml 10x phosphate buffered saline solution, PBS) for four hours on a slow shaker at room temperature. Decalcified heads were then fixed overnight in 4% paraformaldehyde in phosphate buffer (PFA in PB), at 4°C on a slow shaker. Heads were then embedded in a sucrose-gelatin medium (20% sucrose, 8% cold-water fish gelatin in 1x PBS), frozen on dry ice and cryosectioned at 16 μm thickness on a Leica CM3050-S cryostat. Serial sections were mounted on SuperFrost Plus microscope slides (Menzel-Gläser). Sections were subsequently dried at room temperature for four hours, and then stored at -20°C until staining. Prior to all stains, sections were retrieved from -20°C and brought to RT, then rehydrated in 1x PBS.
Senescence-associated β-galactosidase (saβgal) staining
Sections were prefixed with 4% PFA in PB for one hour in a humid chamber at room temperature, then washed twice for 15 minutes with 0.3% Triton X-100 in 1x PBS (PBS-Tx (0.3%)). The pH of sections was then equilibrated with two 30 minute washes with 1x PBS at pH 5.5 (all washes were performed in a humid chamber). Sections were then stained for 16 hours at 37°C in a humid chamber in staining solution (2 mM MgCl2, 5 mM K3Fe(CN)6, 5 mM K3Fe(CN)6·3H2O, 1 mg/ml X-gal, with the remaining volume made up of 1x PBS at pH 5.5). Following incubation, staining was arrested by a 20-minute wash in 4% PFA in PB at room temperature. Sections were then washed well in PBS at pH 5.5 and mounted in 50% glycerol. Sections were then imaged on an Olympus Provis AX70 widefield microscope with an Olympus DP70 camera, with images acquired at 4080x3072 resolution.
Congo Red staining for amyloid
Following rehydration in 1x PBS, sections were stained for 20 minutes in Congo Red staining solution (0.5% Congo Red in 50% ethanol). Sections were then rinsed in distilled water, and quickly differentiated by dipping five times in an alkaline alcohol solution (1% NaOH in 50% ethanol). Sections were rinsed for 1 minute in distilled water, then mounted in 50% glycerol. Sections were imaged in both brightfield and birefringence on a Leica Abrio polarising microscope at 1024x1024 resolution.
Autofluorescent detection of lipofuscin
Following rehydration in 1x PBS, sections were mounted in 50% glycerol and imaged confocally on a Leica TCS SP8 invert confocal laser scanning microscope with a Leica HyD hybrid detector using 20x and 63x oil-immersion objectives. Lipofuscin has an emission maximum at 590 nm when excited at 488 nm; samples were thus excited with a 488nm laser at power 5.00, and the detector was gated for emission wavelengths between 560–700 nm. Images were acquired at 1024x1024 resolution with gain at 137.8%.
Supporting information
S1 File [pdf]
Supporting figures and text.S1 Table [xlsx]
Differential gene expression results for each comparison.S2 Table [xlsx]
Differential protein abundance results for each comparison.S3 Table [pdf]
Summary of functional enrichment results for groups of genes identified in differential gene expression analysis.S4 Table [xlsx]
Full gene ontology analysis results for groups of genes identified in differential gene expression analysis.S5 Table [pdf]
Summary of promoter motif enrichment analysis in groups of genes identified from differential gene expression analysis.S6 Table [xlsx]
Full enrichment results of known zebrafish promoter motifs in groups of genes identified from differential gene expression analysis.S7 Table [xlsx]
List of zebrafish genes containing the GRE (glucocorticoid receptor element) motif.S8 Table [xlsx]
Differentially expressed Hallmark MSigDB gene sets for each comparison identified using the FRY (fast rotation) method.S9 Table [xlsx]
Zebrafish module functional enrichment results using anRichment R package.S10 Table [xlsx]
Zebrafish module promoter motif enrichment results using HOMER software.S11 Table [xlsx]
Human module functional enrichment results using anRichment R package.S12 Table [xlsx]
Promoter motif enrichment analysis of the immune-microglia enriched module in the zebrafish network.S13 Table [xlsx]
-score calculation results for preservation of zebrafish co-expression network properties in human co-expression network.
Zdroje
1. Cadonic C, Sabbir MG, Albensi BC. Mechanisms of Mitochondrial Dysfunction in Alzheimer’s Disease. Mol Neurobiol. 2015. doi: 10.1007/s12035-015-9515-5 26537901.
2. Castellani R, Hirai K, Aliev G, Drew KL, Nunomura A, Takeda A, et al. Role of mitochondrial dysfunction in Alzheimer’s disease. J Neurosci Res. 2002;70(3):357–60. Epub 2002/10/23. doi: 10.1002/jnr.10389 12391597.
3. Fedrizzi L, Carafoli E. Ca2+ dysfunction in neurodegenerative disorders: Alzheimer’s disease. Biofactors. 2011;37(3):189–96. Epub 2011/06/24. doi: 10.1002/biof.157 21698698.
4. Mills E, Dong XP, Wang F, Xu H. Mechanisms of brain iron transport: insight into neurodegeneration and CNS disorders. Future Med Chem. 2010;2(1):51–64. doi: 10.4155/fmc.09.140 20161623.
5. Moir RD, Atwood CS, Huang X, Tanzi RE, Bush AI. Mounting evidence for the involvement of zinc and copper in Alzheimer’s disease. Eur J Clin Invest. 1999;29(7):569–70. Epub 1999/07/20. doi: 10.1046/j.1365-2362.1999.00472.x 10411660.
6. Arimon M, Takeda S, Post KL, Svirsky S, Hyman BT, Berezovska O. Oxidative stress and lipid peroxidation are upstream of amyloid pathology. Neurobiol Dis. 2015;84 : 109–19. doi: 10.1016/j.nbd.2015.06.013 26102023.
7. Oresic M, Hyotylainen T, Herukka SK, Sysi-Aho M, Mattila I, Seppanan-Laakso T, et al. Metabolome in progression to Alzheimer’s disease. Transl Psychiatry. 2011;1:e57. Epub 2011/01/01. doi: 10.1038/tp.2011.55 22832349.
8. Poirier J, Miron J, Picard C, Gormley P, Theroux L, Breitner J, et al. Apolipoprotein E and lipid homeostasis in the etiology and treatment of sporadic Alzheimer’s disease. Neurobiol Aging. 2014;35 Suppl 2:S3–10. Epub 2014/06/29. doi: 10.1016/j.neurobiolaging.2014.03.037 24973118.
9. Heneka MT, Carson MJ, El Khoury J, Landreth GE, Brosseron F, Feinstein DL, et al. Neuroinflammation in Alzheimer’s disease. Lancet Neurol. 2015;14(4):388–405. Epub 2015/03/21. doi: 10.1016/S1474-4422(15)70016-5 25792098.
10. Zotova E, Nicoll JA, Kalaria R, Holmes C, Boche D. Inflammation in Alzheimer’s disease: relevance to pathogenesis and therapy. Alzheimers Res Ther. 2010;2(1):1. Epub 2010/02/04. doi: 10.1186/alzrt24 20122289.
11. Abramsson A, Kettunen P, Banote RK, Lott E, Li M, Arner A, et al. The zebrafish amyloid precursor protein-b is required for motor neuron guidance and synapse formation. Dev Biol. 2013;381(2):377–88. doi: 10.1016/j.ydbio.2013.06.026 23850871.
12. De Strooper B. Proteases and proteolysis in Alzheimer disease: a multifactorial view on the disease process. Physiol Rev. 2010;90(2):465–94. doi: 10.1152/physrev.00023.2009 20393191.
13. Hipp MS, Park SH, Hartl FU. Proteostasis impairment in protein-misfolding and -aggregation diseases. Trends Cell Biol. 2014. Epub 2014/06/21. doi: 10.1016/j.tcb.2014.05.003 24946960.
14. Braak H, Braak E. Diagnostic criteria for neuropathologic assessment of Alzheimer’s disease. Neurobiol Aging. 1997;18(4 Suppl):S85–8. Epub 1997/07/01. doi: 10.1016/s0197-4580(97)00062-6 9330992.
15. Masters CL, Bateman RJ, Blennow K, Rowe CC, Sperling RA, Cummings JL. Alzheimer’s disease. Nature reviews Disease Primers. 2015;1 : 1–8. doi: 10.1038/nrdp.2015.56 27188934
16. Mehta D, Jackson R, Paul G, Shi J, Sabbagh M. Why do trials for Alzheimer’s disease drugs keep failing? A discontinued drug perspective for 2010–2015. Expert Opin Investig Drugs. 2017;26(6):735–9. doi: 10.1080/13543784.2017.1323868 28460541.
17. Villemagne VL, Burnham S, Bourgeat P, Brown B, Ellis KA, Salvado O, et al. Amyloid beta deposition, neurodegeneration, and cognitive decline in sporadic Alzheimer’s disease: a prospective cohort study. Lancet Neurol. 2013;12(4):357–67. Epub 2013/03/13. doi: 10.1016/S1474-4422(13)70044-9 23477989.
18. Bateman RJ, Xiong C, Benzinger TL, Fagan AM, Goate A, Fox NC, et al. Clinical and biomarker changes in dominantly inherited Alzheimer’s disease. N Engl J Med. 2012;367(9):795–804. doi: 10.1056/NEJMoa1202753 22784036.
19. Iturria-Medina Y, Sotero RC, Toussaint PJ, Mateos-Perez JM, Evans AC, Alzheimer’s Disease Neuroimaging I. Early role of vascular dysregulation on late-onset Alzheimer’s disease based on multifactorial data-driven analysis. Nat Commun. 2016;7 : 11934. doi: 10.1038/ncomms11934 27327500.
20. Quiroz YT, Schultz AP, Chen K, Protas HD, Brickhouse M, Fleisher AS, et al. Brain Imaging and Blood Biomarker Abnormalities in Children With Autosomal Dominant Alzheimer Disease: A Cross-Sectional Study. JAMA Neurol. 2015;72(8):912–9. doi: 10.1001/jamaneurol.2015.1099 26121081.
21. Reiman EM, Quiroz YT, Fleisher AS, Chen K, Velez-Pardo C, Jimenez-Del-Rio M, et al. Brain imaging and fluid biomarker analysis in young adults at genetic risk for autosomal dominant Alzheimer’s disease in the presenilin 1 E280A kindred: a case-control study. Lancet Neurol. 2012;11(12):1048–56. doi: 10.1016/S1474-4422(12)70228-4 23137948.
22. Reiman EM, Chen K, Alexander GE, Caselli RJ, Bandy D, Osborne D, et al. Functional brain abnormalities in young adults at genetic risk for late-onset Alzheimer’s dementia. Proc Natl Acad Sci U S A. 2004;101(1):284–9. Epub 2003/12/23. doi: 10.1073/pnas.2635903100 14688411
23. Berchtold NC, Sabbagh MN, Beach TG, Kim RC, Cribbs DH, Cotman CW. Brain gene expression patterns differentiate mild cognitive impairment from normal aged and Alzheimer’s disease. Neurobiol Aging. 2014;35(9):1961–72. doi: 10.1016/j.neurobiolaging.2014.03.031 24786631.
24. Antonell A, Llado A, Altirriba J, Botta-Orfila T, Balasa M, Fernandez M, et al. A preliminary study of the whole-genome expression profile of sporadic and monogenic early-onset Alzheimer’s disease. Neurobiol Aging. 2013;34(7):1772–8. Epub 2013/02/02. doi: 10.1016/j.neurobiolaging.2012.12.026 23369545.
25. Guo Q, Fu W, Sopher BL, Miller MW, Ware CB, Martin GM, et al. Increased vulnerability of hippocampal neurons to excitotoxic necrosis in presenilin-1 mutant knock-in mice. Nat Med. 1999;5(1):101–6. doi: 10.1038/4789 9883847.
26. Kawasumi M, Chiba T, Yamada M, Miyamae-Kaneko M, Matsuoka M, Nakahara J, et al. Targeted introduction of V642I mutation in amyloid precursor protein gene causes functional abnormality resembling early stage of Alzheimer’s disease in aged mice. Eur J Neurosci. 2004;19(10):2826–38. doi: 10.1111/j.0953-816X.2004.03397.x 15147316.
27. Siman R, Reaume AG, Savage MJ, Trusko S, Lin YG, Scott RW, et al. Presenilin-1 P264L knock-in mutation: differential effects on abeta production, amyloid deposition, and neuronal vulnerability. J Neurosci. 2000;20(23):8717–26. doi: 10.1523/JNEUROSCI.20-23-08717.2000 11102478.
28. Hargis KE, Blalock EM. Transcriptional signatures of brain aging and Alzheimer’s disease: What are our rodent models telling us? Behav Brain Res. 2017;322(Pt B):311–28. Epub 2016/05/04. doi: 10.1016/j.bbr.2016.05.007 27155503.
29. Sato N, Hori O, Yamaguchi A, Lambert JC, Chartier-Harlin MC, Robinson PA, et al. A novel presenilin-2 splice variant in human Alzheimer’s disease brain tissue. Journal of Neurochemistry. 1999;72(6):2498–505. doi: 10.1046/j.1471-4159.1999.0722498.x 10349860
30. Jayadev S, Leverenz JB, Steinbart E, Stahl J, Klunk W, Yu CE, et al. Alzheimer’s disease phenotypes and genotypes associated with mutations in presenilin 2. Brain. 2010;133 : 1143–54. doi: 10.1093/brain/awq033 20375137
31. Newman M, Wilson L, Verdile G, Lim A, Khan I, Moussavi Nik SH, et al. Differential, dominant activation and inhibition of Notch signalling and APP cleavage by truncations of PSEN1 in human disease. Hum Mol Genet. 2014;23(3):602–17. Epub 2013/10/09. doi: 10.1093/hmg/ddt448 24101600.
32. Moussavi Nik SH, Newman M, Wilson L, Ebrahimie E, Wells S, Musgrave I, et al. Alzheimer’s disease-related peptide PS2V plays ancient, conserved roles in suppression of the unfolded protein response under hypoxia and stimulation of gamma-secretase activity. Hum Mol Genet. 2015. Epub 2015/03/31. doi: 10.1093/hmg/ddv110 25814654.
33. Sharman MJ, Moussavi Nik SH, Chen MM, Ong D, Wijaya L, Laws SM, et al. The Guinea Pig as a Model for Sporadic Alzheimer’s Disease (AD): The Impact of Cholesterol Intake on Expression of AD-Related Genes. PLoS One. 2013;8(6):e66235. doi: 10.1371/journal.pone.0066235 23805206.
34. Seshadri S, Wolf PA, Beiser A, Au R, McNulty K, White R, et al. Lifetime risk of dementia and Alzheimer’s disease. The impact of mortality on risk estimates in the Framingham Study. Neurology. 1997;49(6):1498–504. doi: 10.1212/wnl.49.6.1498 9409336.
35. Gamberger D, Ženko B, Mitelpunkt A, Shachar N, Lavrač N. Clusters of male and female Alzheimer’s disease patients in the Alzheimer’s Disease Neuroimaging Initiative (ADNI) database. Brain Inform. 2016;3(3):169–79. Epub 2016/03/30. doi: 10.1007/s40708-016-0035-5 27525218.
36. Oosterhof N, Holtman IR, Kuil LE, van der Linde HC, Boddeke EW, Eggen BJ, et al. Identification of a conserved and acute neurodegeneration-specific microglial transcriptome in the zebrafish. Glia. 2017;65(1):138–49. Epub 2016/10/19. doi: 10.1002/glia.23083 27757989.
37. Lein ES, Hawrylycz MJ, Ao N, Ayres M, Bensinger A, Bernard A, et al. Genome-wide atlas of gene expression in the adult mouse brain. Nature. 2007;445(7124):168–76. Epub 2006/12/06. doi: 10.1038/nature05453 17151600.
38. Liberzon A, Birger C, Thorvaldsdottir H, Ghandi M, Mesirov JP, Tamayo P. The Molecular Signatures Database (MSigDB) hallmark gene set collection. Cell Syst. 2015;1(6):417–25. doi: 10.1016/j.cels.2015.12.004 26771021.
39. de Sousa Abreu R, Penalva LO, Marcotte EM, Vogel C. Global signatures of protein and mRNA expression levels. Mol Biosyst. 2009;5(12):1512–26. Epub 2009/10/01. doi: 10.1039/b908315d 20023718.
40. Kumar D, Bansal G, Narang A, Basak T, Abbas T, Dash D. Integrating transcriptome and proteome profiling: Strategies and applications. Proteomics. 2016;16(19):2533–44. Epub 2016/08/25. doi: 10.1002/pmic.201600140 27343053.
41. Allen M, Carrasquillo MM, Funk C, Heavner BD, Zou F, Younkin CS, et al. Human whole genome genotype and transcriptome data for Alzheimer’s and other neurodegenerative diseases. Sci Data. 2016;3 : 160089. Epub 2016/10/11. doi: 10.1038/sdata.2016.89 27727239.
42. Ballouz S, Verleyen W, Gillis J. Guidance for RNA-seq co-expression network construction and analysis: safety in numbers. Bioinformatics. 2015;31(13):2123–30. doi: 10.1093/bioinformatics/btv118 25717192.
43. Zhang B, Horvath S. A General Framework for Weighted Gene Co-Expression Network Analysis. Statistical Applications in Genetics and Molecular Biology2005.
44. Hawrylycz MJ, Lein ES, Guillozet-Bongaarts AL, Shen EH, Ng L, Miller JA, et al. An anatomically comprehensive atlas of the adult human brain transcriptome. Nature. 2012;489(7416):391–9. doi: 10.1038/nature11405 22996553.
45. Winden KD, Oldham MC, Mirnics K, Ebert PJ, Swan CH, Levitt P, et al. The organization of the transcriptional network in specific neuronal classes. Mol Syst Biol. 2009;5 : 291. doi: 10.1038/msb.2009.46 19638972.
46. Oldham MC, Horvath S, Geschwind DH. Conservation and evolution of gene coexpression networks in human and chimpanzee brains. Proceedings of the National Academy of Sciences. 2006;103(47):17973–8. doi: 10.1073/pnas.0605938103 17101986
47. Miller JA, Horvath S, Geschwind DH. Divergence of human and mouse brain transcriptome highlights Alzheimer disease pathways. Proceedings of the National Academy of Sciences. 2010;107(28):12698–703.
48. Zhang B, Gaiteri C, Bodea LG, Wang Z, McElwee J, Podtelezhnikov AA, et al. Integrated systems approach identifies genetic nodes and networks in late-onset Alzheimer’s disease. Cell. 2013;153(3):707–20. doi: 10.1016/j.cell.2013.03.030 23622250.
49. Langfelder P, Luo R, Oldham MC, Horvath S. Is my network module preserved and reproducible? PLoS Comput Biol. 2011;7(1):e1001057. doi: 10.1371/journal.pcbi.1001057 21283776.
50. Solchenberger B, Russell C, Kremmer E, Haass C, Schmid B. Granulin knock out zebrafish lack frontotemporal lobar degeneration and neuronal ceroid lipofuscinosis pathology. PLoS One. 2015;10(3):e0118956. doi: 10.1371/journal.pone.0118956 25785851.
51. Moore DB, Gillentine MA, Botezatu NM, Wilson KA, Benson AE, Langeland JA. Asynchronous evolutionary origins of Abeta and BACE1. Mol Biol Evol. 2014;31(3):696–702. doi: 10.1093/molbev/mst262 24361992.
52. Hardy JA, Higgins GA. Alzheimer’s disease: the amyloid cascade hypothesis. Science. 1992;256(5054):184–5. doi: 10.1126/science.1566067 1566067.
53. Blalock EM, Geddes JW, Chen KC, Porter NM, Markesbery WR, Landfield PW. Incipient Alzheimer’s disease: microarray correlation analyses reveal major transcriptional and tumor suppressor responses. Proc Natl Acad Sci U S A. 2004;101(7):2173–8. doi: 10.1073/pnas.0308512100 14769913.
54. Sperling RA, Dickerson BC, Pihlajamaki M, Vannini P, LaViolette PS, Vitolo OV, et al. Functional alterations in memory networks in early Alzheimer’s disease. Neuromolecular Med. 2010;12(1):27–43. doi: 10.1007/s12017-009-8109-7 20069392.
55. Head E, Lott IT, Patterson D, Doran E, Haier RJ. Possible compensatory events in adult Down syndrome brain prior to the development of Alzheimer disease neuropathology: targets for nonpharmacological intervention. J Alzheimers Dis. 2007;11(1):61–76. doi: 10.3233/jad-2007-11110 17361036.
56. Du X, Pang TY. Is Dysregulation of the HPA-Axis a Core Pathophysiology Mediating Co-Morbid Depression in Neurodegenerative Diseases? Front Psychiatry. 2015;6 : 32. doi: 10.3389/fpsyt.2015.00032 25806005.
57. Silverman MN, Sternberg EM. Glucocorticoid regulation of inflammation and its functional correlates: from HPA axis to glucocorticoid receptor dysfunction. Ann N Y Acad Sci. 2012;1261 : 55–63. doi: 10.1111/j.1749-6632.2012.06633.x 22823394.
58. Arlt S, Demiralay C, Tharun B, Geisel O, Storm N, Eichenlaub M, et al. Genetic risk factors for depression in Alzheimer`s disease patients. Curr Alzheimer Res. 2013;10(1):72–81. 23157339.
59. Lin JX, Leonard WJ. The role of Stat5a and Stat5b in signaling by IL-2 family cytokines. Oncogene. 2000;19(21):2566–76. doi: 10.1038/sj.onc.1203523 10851055.
60. Moon RT, Bowerman B, Boutros M, Perrimon N. The promise and perils of Wnt signaling through beta-catenin. Science. 2002;296(5573):1644–6. doi: 10.1126/science.1071549 12040179
61. Rapoport SI, Hatanpaa K, Brady DR, Chandrasekaran K. Brain energy metabolism, cognitive function and down-regulated oxidative phosphorylation in Alzheimer disease. Neurodegeneration. 1996;5(4):473–6. doi: 10.1006/neur.1996.0065 9117565.
62. Barron AM, Fuller SJ, Verdile G, Martins RN. Reproductive hormones modulate oxidative stress in Alzheimer’s disease. Antioxid Redox Signal. 2006;8(11–12):2047–59. doi: 10.1089/ars.2006.8.2047 17034349.
63. Schapira AH. Oxidative stress and mitochondrial dysfunction in neurodegeneration. Curr Opin Neurol. 1996;9(4):260–4. doi: 10.1097/00019052-199608000-00003 8858182.
64. Perry G, Nunomura A, Hirai K, Takeda A, Aliev G, Smith MA. Oxidative damage in Alzheimer’s disease: the metabolic dimension. Int J Dev Neurosci. 2000;18(4–5):417–21. Epub 2000/05/19. doi: 10.1016/s0736-5748(00)00006-x 10817925
65. Nunomura A, Perry G, Aliev G, Hirai K, Takeda A, Balraj EK, et al. Oxidative damage is the earliest event in Alzheimer disease. J Neuropathol Exp Neurol. 2001;60(8):759–67. Epub 2001/08/07. doi: 10.1093/jnen/60.8.759 11487050.
66. Perry G, Nunomura A, Hirai K, Zhu X, Perez M, Avila J, et al. Is oxidative damage the fundamental pathogenic mechanism of Alzheimer’s and other neurodegenerative diseases? Free Radic Biol Med. 2002;33(11):1475–9. Epub 2002/11/26. doi: 10.1016/s0891-5849(02)01113-9 12446204
67. Scherz-Shouval R, Elazar Z. ROS, mitochondria and the regulation of autophagy. Trends Cell Biol. 2007;17(9):422–7. Epub 2007/09/07. doi: 10.1016/j.tcb.2007.07.009 17804237.
68. Daulatzai MA. Death by a thousand cuts in Alzheimer’s disease: hypoxia-the prodrome. Neurotox Res. 2013;24(2):216–43. doi: 10.1007/s12640-013-9379-2 23400634.
69. Daulatzai MA. Cerebral hypoperfusion and glucose hypometabolism: Key pathophysiological modulators promote neurodegeneration, cognitive impairment, and Alzheimer’s disease. J Neurosci Res. 2017;95(4):943–72. doi: 10.1002/jnr.23777 27350397.
70. Zhao WQ, Ravindranath L, Mohamed AS, Zohar O, Chen GH, Lyketsos CG, et al. MAP kinase signaling cascade dysfunction specific to Alzheimer’s disease in fibroblasts. Neurobiol Dis. 2002;11(1):166–83. doi: 10.1006/nbdi.2002.0520 12460556.
71. Drewes G, Lichtenberg-Kraag B, Döring F, Mandelkow EM, Biernat J, Goris J, et al. Mitogen activated protein (MAP) kinase transforms tau protein into an Alzheimer-like state. EMBO J. 1992;11(6):2131–8. 1376245.
72. Maroulakou IG, Bowe DB. Expression and function of Ets transcription factors in mammalian development: a regulatory network. Oncogene. 2000;19(55):6432–42. doi: 10.1038/sj.onc.1204039 11175359.
73. Kar A, Gutierrez-Hartmann A. Molecular mechanisms of ETS transcription factor-mediated tumorigenesis. Crit Rev Biochem Mol Biol. 2013;48(6):522–43. doi: 10.3109/10409238.2013.838202 24066765.
74. Gjoneska E, Pfenning AR, Mathys H, Quon G, Kundaje A, Tsai LH, et al. Conserved epigenomic signals in mice and humans reveal immune basis of Alzheimer’s disease. Nature. 2015;518(7539):365–9. doi: 10.1038/nature14252 25693568.
75. Morgan SC, Taylor DL, Pocock JM. Microglia release activators of neuronal proliferation mediated by activation of mitogen-activated protein kinase, phosphatidylinositol-3-kinase/Akt and delta-Notch signalling cascades. J Neurochem. 2004;90(1):89–101. doi: 10.1111/j.1471-4159.2004.02461.x 15198670.
76. Herculano-Houzel S. Scaling of brain metabolism with a fixed energy budget per neuron: implications for neuronal activity, plasticity and evolution. PLoS One. 2011;6(3):e17514. doi: 10.1371/journal.pone.0017514 21390261.
77. Yamada T, Sasaki H, Furuya H, Miyata T, Goto I, Sakaki Y. Complementary DNA for the mouse homolog of the human amyloid beta protein precursor. Biochem Biophys Res Commun. 1987;149(2):665–71. doi: 10.1016/0006-291x(87)90419-0 3322280.
78. Musa A, Lehrach H, Russo VA. Distinct expression patterns of two zebrafish homologues of the human APP gene during embryonic development. Dev Genes Evol. 2001;211(11):563–7. Epub 2002/02/28. doi: 10.1007/s00427-001-0189-9 11862463.
79. Monsell SE, Kukull WA, Roher AE, Maarouf CL, Serrano G, Beach TG, et al. Characterizing Apolipoprotein E epsilon4 Carriers and Noncarriers With the Clinical Diagnosis of Mild to Moderate Alzheimer Dementia and Minimal beta-Amyloid Peptide Plaques. JAMA Neurol. 2015;72(10):1124–31. doi: 10.1001/jamaneurol.2015.1721 26302353.
80. Jack CR Jr., Albert MS, Knopman DS, McKhann GM, Sperling RA, Carrillo MC, et al. Introduction to the recommendations from the National Institute on Aging-Alzheimer’s Association workgroups on diagnostic guidelines for Alzheimer’s disease. Alzheimers Dement. 2011;7(3):257–62. 21514247.
81. Whitehouse PJ, George DR. A tale of two reports: what recent publications from the Alzheimer’s Association and Institute of Medicine say about the state of the field. J Alzheimers Dis. 2016;49(1):21–5. doi: 10.3233/JAD-150663 26444797.
82. Morris GP, Clark IA, Vissel B. Questions concerning the role of amyloid-β in the definition, aetiology and diagnosis of Alzheimer’s disease. Acta Neuropathol. 2018;136(5):663–89. Epub 2018/10/22. doi: 10.1007/s00401-018-1918-8 30349969.
83. Jansen WJ, Ossenkoppele R, Knol DL, Tijms BM, Scheltens P, Verhey FR, et al. Prevalence of cerebral amyloid pathology in persons without dementia: a meta-analysis. JAMA. 2015;313(19):1924–38. doi: 10.1001/jama.2015.4668 25988462.
84. Braggin JE, Bucks SA, Course MM, Smith CL, Sopher B, Osnis L, et al. Alternative splicing in a presenilin 2 variant associated with Alzheimer disease. Ann Clin Transl Neurol. 2019;6(4):762–77. Epub 2019/03/10. doi: 10.1002/acn3.755 31020001.
85. Nornes S, Newman M, Verdile G, Wells S, Stoick-Cooper CL, Tucker B, et al. Interference with splicing of Presenilin transcripts has potent dominant negative effects on Presenilin activity. Hum Mol Genet. 2008;17(3):402–12. Epub 2007/11/06. doi: 10.1093/hmg/ddm317 17981814.
86. Newman M, Hin N, Pederson S, Lardelli M. Brain transcriptome analysis of a familial Alzheimer’s disease-like mutation in the zebrafish presenilin 1 gene implies effects on energy production. Mol Brain. 2019;12(1):43. Epub 2019/05/03. doi: 10.1186/s13041-019-0467-y 31053140.
87. Huggett JF, Whale A. Digital PCR as a novel technology and its potential implications for molecular diagnostics. Clin Chem. 2013;59(12):1691–3. Epub 2013/10/07. doi: 10.1373/clinchem.2013.214742 24100808.
88. de St Groth Fazekas. The evaluation of limiting dilution assays. J Immunol Methods. 1982;49(2):R11–23. doi: 10.1016/0022-1759(82)90269-1 7040548.
89. Wisniewski JR, Zougman A, Nagaraj N, Mann M. Universal sample preparation method for proteome analysis. Nat Methods. 2009;6(5):359–62. doi: 10.1038/nmeth.1322 19377485.
90. Cox J, Hein MY, Luber CA, Paron I, Nagaraj N, Mann M. Accurate proteome-wide label-free quantification by delayed normalization and maximal peptide ratio extraction, termed MaxLFQ. Mol Cell Proteomics. 2014;13(9):2513–26. doi: 10.1074/mcp.M113.031591 24942700.
91. Andrews S. FastQC. 0.11.5 ed2010.
92. Lindgreen S. AdapterRemoval: easy cleaning of next-generation sequencing reads. BMC Res Notes. 2012;5 : 337. doi: 10.1186/1756-0500-5-337 22748135.
93. Kim D, Langmead B, Salzberg SL. HISAT: a fast spliced aligner with low memory requirements. Nat Methods. 2015;12(4):357–60. doi: 10.1038/nmeth.3317 25751142.
94. Broad Institute. Picard. 2.14.0 ed2017. p. A set of command line tools (in Java) for manipulating high-throughput sequencing (HTS) data and formats such as SAM/BAM/CRAM and VCF.
95. Liao Y, Smyth GK, Shi W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics. 2014;30(7):923–30. doi: 10.1093/bioinformatics/btt656 24227677.
96. R Core Team. R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing; 2017.
97. Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26(1):139–40. doi: 10.1093/bioinformatics/btp616 19910308.
98. Liu R, Holik AZ, Su S, Jansz N, Chen K, Leong HS, et al. Why weight? Modelling sample and observational level variability improves power in RNA-seq analyses. Nucleic Acids Res. 2015;43(15):e97. doi: 10.1093/nar/gkv412 25925576.
99. Phipson B, Lee S, Majewski IJ, Alexander WS, Smyth GK. Robust Hyperparameter Estimation Protects against Hypervariable Genes and Improves Power to Detect Differential Expression. Ann Appl Stat. 2016;10(2):946–63. doi: 10.1214/16-AOAS920 28367255.
100. Ritchie ME, Phipson B, Wu D, Hu Y, Law CW, Shi W, et al. limma powers differential expression analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015;43(7):e47. doi: 10.1093/nar/gkv007 25605792.
101. Risso D, Ngai J, Speed TP, Dudoit S. Normalization of RNA-seq data using factor analysis of control genes or samples. Nat Biotechnol. 2014;32(9):896–902. doi: 10.1038/nbt.2931 25150836.
102. Kolde R. pheatmap: Pretty Heatmaps. 1.0.8 ed2015.
103. Durinck S, Moreau Y, Kasprzyk A, Davis S, De Moor B, Brazma A, et al. BioMart and Bioconductor: a powerful link between biological databases and microarray data analysis. Bioinformatics. 2005;21(16):3439–40. doi: 10.1093/bioinformatics/bti525 16082012.
104. Durinck S, Spellman PT, Birney E, Huber W. Mapping identifiers for the integration of genomic datasets with the R/Bioconductor package biomaRt. Nat Protoc. 2009;4(8):1184–91. doi: 10.1038/nprot.2009.97 19617889.
105. Giner G, Smyth GK. FRY: a fast approximation to ROAST gene set test with mean aggregated set statistics [version 1; not peer reviewed]. F1000Research. 2016;5(2605). doi: 10.7490/f1000research.1113351.1
106. Wu D, Lim E, Vaillant F, Asselin-Labat ML, Visvader JE, Smyth GK. ROAST: rotation gene set tests for complex microarray experiments. Bioinformatics. 2010;26(17):2176–82. doi: 10.1093/bioinformatics/btq401 20610611.
107. Heinz S, Benner C, Spann N, Bertolino E, Lin YC, Laslo P, et al. Simple combinations of lineage-determining transcription factors prime cis-regulatory elements required for macrophage and B cell identities. Mol Cell. 2010;38(4):576–89. doi: 10.1016/j.molcel.2010.05.004 20513432.
108. Benner C. HOMER (Hypergeometric Optimization of Motif EnRichment). v4.9 ed2017. p. Software for motif discovery and next generation sequencing analysis.
109. Choi M, Chang CY, Clough T, Broudy D, Killeen T, MacLean B, et al. MSstats: an R package for statistical analysis of quantitative mass spectrometry-based proteomic experiments. Bioinformatics. 2014;30(17):2524–6. doi: 10.1093/bioinformatics/btu305 24794931.
110. Kammers K, Cole RN, Tiengwe C, Ruczinski I. Detecting Significant Changes in Protein Abundance. EuPA Open Proteom. 2015;7 : 11–9. doi: 10.1016/j.euprot.2015.02.002 25821719.
111. Magis AT, Funk CC, Price ND. SNAPR: a bioinformatics pipeline for efficient and accurate RNA-seq alignment and analysis. IEEE Life Sci Lett. 2015;1(2):22–5. Epub 2015/08/28. doi: 10.1109/LLS.2015.2465870 29270443.
112. Langfelder P, Zhang B, Horvath S. Defining clusters from a hierarchical cluster tree: the Dynamic Tree Cut package for R. Bioinformatics. 2008;24(5):719–20. doi: 10.1093/bioinformatics/btm563 18024473.
113. Langfelder P, Horvath S. Fast R Functions for Robust Correlations and Hierarchical Clustering. J Stat Softw. 2012;46(11). 23050260.
114. Allaire JJ, Gandrud C, Russell K, Yetman CJ. networkD3: D3 JavaScript Network Graphs from R. 2017.
115. Martin S, Brown WM, Klavans R, Boyack KW, editors. OpenOrd: an open-source toolbox for large graph layout. IS&T/SPIE Electronic Imaging; 2011: SPIE.
116. Kroehne V, Freudenreich D, Hans S, Kaslin J, Brand M. Regeneration of the adult zebrafish brain from neurogenic radial glia-type progenitors. Development. 2011:dev.072587. doi: 10.1242/dev.072587 22007133
117. Kaslin J, Kroehne V, Ganz J, Hans S, Brand M. Distinct roles of neuroepithelial-like and radial glia-like progenitor cells in cerebellar regeneration. Development. 2017;144(8):1462–71. Epub 2017/03/16. doi: 10.1242/dev.144907 28289134.
Článek Disparate effects of antibiotic-induced microbiome change and enhanced fitness in Daphnia magnaČlánek Phanerochaete chrysosporium strain B-22, a nematophagous fungus parasitizing Meloidogyne incognitaČlánek Do atmospheric events explain the arrival of an invasive ladybird (Harmonia axyridis) in the UK?Článek Growth behavior and glyphosate resistance level in 10 populations of Echinochloa colona in AustraliaČlánek Effects of Transcranial Direct Current Stimulation on GABA and Glx in Children: A pilot studyČlánek Early conservation benefits of a de facto marine protected area at San Clemente Island, CaliforniaČlánek Evaluating risk prediction models for adults with heart failure: A systematic literature reviewČlánek Patient perceived value of teleophthalmology in an urban, low income US population with diabetesČlánek Computational analysis of functional single nucleotide polymorphisms associated with SLC26A4 geneČlánek A study to better understand under-utilization of laboratory tests for antenatal care in SenegalČlánek Monitoring the ‘diabetes epidemic’: A framing analysis of United Kingdom print news 1993-2013Článek Trophic ecology of Mexican Pacific harbor seal colonies using carbon and nitrogen stable isotopesČlánek Models of protein production along the cell cycle: An investigation of possible sources of noiseČlánek Fecal transplant prevents gut dysbiosis and anxiety-like behaviour after spinal cord injury in ratsČlánek Phylogeographic analyses point to long-term survival on the spot in micro-endemic Lycian salamandersČlánek Genlisea hawkingii (Lentibulariaceae), a new species from Serra da Canastra, Minas Gerais, BrazilČlánek Modelling the impact of migrants on the success of the HIV care and treatment program in BotswanaČlánek Does squatting need attention?—A dual-task study on cognitive resources in resistance exerciseČlánek Design and evaluation of a laboratory-based wheelchair castor testing protocol using community dataČlánek Role of ecology in shaping external nasal morphology in bats and implications for olfactory trackingČlánek Allergic inflammation is initiated by IL-33–dependent crosstalk between mast cells and basophilsČlánek Combined fiscal policies to promote healthier diets: Effects on purchases and consumer welfareČlánek Influence of light on the infection of Aureococcus anophagefferens CCMP 1984 by a “giant virus”Článek Manual dexterity of mice during food-handling involves the thumb and a set of fast basic movementsČlánek Quantum isomer searchČlánek Optimization of tissue sampling for Borrelia burgdorferi in white-footed mice (Peromyscus leucopus)Článek Effects of Allium hookeri on gut microbiome related to growth performance in young broiler chickensČlánek Age and altitude of residence determine anemia prevalence in Peruvian 6 to 35 months old childrenČlánek Mothers’ oral health literacy and children’s oral health status in Pikine, Senegal: A pilot studyČlánek A network analysis revealed the essential and common downstream proteins related to inguinal herniaČlánek Low risk pregnancies after a cesarean section: Determinants of trial of labor and its failureČlánek Identification and characterization of miRNAs involved in cold acclimation of zebrafish ZF4 cellsČlánek Research on motion planning for an indoor spray arm based on an improved potential field methodČlánek Eye-gaze information input based on pupillary response to visual stimulus with luminance modulationČlánek Disruption in daily eating-fasting and activity-rest cycles in Indian adolescents attending schoolČlánek The earliest farming communities north of the Carpathians: The settlement at Gwoździec site 2Článek Eligibility for hepatitis B antiviral therapy among adults in the general population in ZambiaČlánek Characterization of the visceral and neuronal phenotype of 4L/PS-NA mice modeling Gaucher diseaseČlánek Increased inflammation and endothelial markers in patients with late severe post-thrombotic syndromeČlánek Management of veterinary anaesthesia in small animals: A survey of current practice in QuebecČlánek Umbilical cord separation time, predictors and healing complications in newborns with dry careČlánek Analysis of attitudinal components towards statistics among students from different academic degreesČlánek Forecasting stock prices with long-short term memory neural network based on attention mechanismČlánek Enzyme response of activated sludge to a mixture of emerging contaminants in continuous exposureČlánek Quantitative PCR provides a simple and accessible method for quantitative microbiota profilingČlánek Comparison of Monocyte Distribution Width (MDW) and Procalcitonin for early recognition of sepsisČlánek Transcriptome analysis of Actinidia chinensis in response to Botryosphaeria dothidea infectionČlánek Niche modeling reveals life history shifts in birds at La Brea over the last twenty millenniaČlánek Distributed flux balance analysis simulations of serial biomass fermentation by two organismsČlánek Head impulse compensatory saccades: Visual dependence is most evident in bilateral vestibular lossČlánek Sofosbuvir-based regimen for genotype 2 HCV infected patients in Taiwan: A real world experienceČlánek The virulence domain of Shigella IcsA contains a subregion with specific host cell adhesion functionČlánek Short treatment with antalarmin alters adrenal gland receptors in the rat model of endometriosisČlánek Self-esteem and other risk factors for depressive symptoms among adolescents in United Arab EmiratesČlánek Influence of flow on phosphorus-dynamics and particle size in agricultural drainage ditch sedimentsČlánek An information-based approach to handle various types of uncertainty in fuzzy bodies of evidenceČlánek Novel method to measure temporal windows based on eye movements during viewing of the Necker cubeČlánek The impact of rehabilitation frequency on the risk of stroke in patients with rheumatoid arthritisČlánek Vascularization and biocompatibility of poly(ε-caprolactone) fiber mats for rotator cuff tear repairČlánek Disease-specific out-of-pocket healthcare expenditure in urban Bangladesh: A Bayesian analysisČlánek Reassortment and adaptive mutations of an emerging avian influenza virus H7N4 subtype in ChinaČlánek Occupational gender segregation and economic growth in U.S. local labor markets, 1980 through 2010Článek Accuracy of intraocular lens power calculation formulas using a swept-source optical biometerČlánek Characterization of black patina from the Tiber River embankments using Next-Generation SequencingČlánek Impact of long-term storage and freeze-thawing on eight circulating microRNAs in plasma samplesČlánek Obesity, smoking habits, and serum phosphate levels predicts mortality after life-style interventionČlánek Allele specific expression of Dof genes responding to hormones and abiotic stresses in sugarcaneČlánek Structure-function analyses of candidate small molecule RPN13 inhibitors with antitumor propertiesČlánek Multiple fragmented habitat-patch use in an urban breeding passerine, the Short-toed TreecreeperČlánek And the nominees are: Using design-awards datasets to build computational aesthetic evaluation modelČlánek Predictive factors of first dosage intravenous immunoglobulin-related adverse effects in childrenČlánek Effects of rejection intensity and rejection sensitivity on social approach behavior in womenČlánek The implementation of community-based diabetes and hypertension management care program in IndonesiaČlánek Optimization of cytotoxic activity of Nocardia sp culture broths using a design of experimentsČlánek Investigating Italian disinformation spreading on Twitter in the context of 2019 European electionsČlánek Modelling zero-truncated overdispersed antenatal health care count data of women in BangladeshČlánek Prevalence of antiphospholipid antibodies in Behçet's disease: A systematic review and meta-analysisČlánek Common mental illness among epilepsy patients in Bahir Dar city, Ethiopia: A cross-sectional studyČlánek Genetic characterization of Bacillus anthracis strains circulating in Italy from 1972 to 2018Článek Adverse reproductive effects of S100A9 on bovine sperm and early embryonic development in vitroČlánek CNP mediated selective toxicity on melanoma cells is accompanied by mitochondrial dysfunctionČlánek Factors for starting biosimilar TNF inhibitors in patients with rheumatic diseases in the real worldČlánek Use of magnetic resonance imaging to determine laterality of meniscal size in healthy volunteersČlánek Correction: Mutation spectrums of TSC1 and TSC2 in Chinese women with lymphangioleiomyomatosis (LAM)Článek Young women’s reproductive health conversations: Roles of maternal figures and clinical practicesČlánek Dominant negative effects by inactive Spa47 mutants inhibit T3SS function and Shigella virulenceČlánek Retraction: MiR-30a-5p Antisense Oligonucleotide Suppresses Glioma Cell Growth by Targeting SEPT7Článek Regional versus local wind speed and direction at a narrow beach with a high and steep foreduneČlánek MLST-based genetic relatedness of Campylobacter jejuni isolated from chickens and humans in PolandČlánek pyKNEEr: An image analysis workflow for open and reproducible research on femoral knee cartilageČlánek Redefining transcriptional regulation of the APOE gene and its association with Alzheimer’s diseaseČlánek Influence of inflammasome NLRP3, and IL1B and IL2 gene polymorphisms in periodontitis susceptibilityČlánek Revisits, readmissions, and outcomes for pediatric traumatic brain injury in California, 2005-2014
Článek vyšel v časopisePLOS One
Nejčtenější tento týden
2020 Číslo 1- Zachyťte pacienty s akutními porfyriemi, aby nebloudili zdravotnictvím
- Auris One: Když se dokumentace v ordinaci praktika začne psát „sama“
- „Jednohubky“ z klinického výzkumu – 2026/11
- Prof. Jan Škrha: Metformin je bezpečný, ale je třeba jej bezpečně užívat a léčbu kontrolovat
- Fotoprotekce za hranicí SPF: Jak se efektivně bránit skryté hrozbě ultradlouhovlnného UVA záření?
-
Všechny články tohoto čísla
- ETAPOD: A forecast model for prediction of black pod disease outbreak in Nigeria
- Disparate effects of antibiotic-induced microbiome change and enhanced fitness in Daphnia magna
- Deliver on Your Own: Disrespectful Maternity Care in rural Kenya
- Quantification of microaerobic growth of Geobacter sulfurreducens
- Number of days required to estimate physical activity constructs objectively measured in different age groups: Findings from three Brazilian (Pelotas) population-based birth cohorts
- Identifying site- and stimulation-specific TMS-evoked EEG potentials using a quantitative cosine similarity metric
- Design and assessment of TRAP-CSP fusion antigens as effective malaria vaccines
- Best compromise nutritional menus for childhood obesity
- Phanerochaete chrysosporium strain B-22, a nematophagous fungus parasitizing Meloidogyne incognita
- Non-disclosure of tuberculosis diagnosis by patients to their household members in south western Uganda
- Patch testing in Lao medical students
- A competence-regulated toxin-antitoxin system in Haemophilus influenzae
- Bund removal to re-establish tidal flow, remove aquatic weeds and restore coastal wetland services—North Queensland, Australia
- Exploring the mechanism of olfactory recognition in the initial stage by modeling the emission spectrum of electron transfer
- Risk of complications among diabetics self-reporting oral health status in Canada: A population-based cohort study
- Family Health Days program contributions in vaccination of unreached and under-immunized children during routine vaccinations in Uganda
- Calcium dobesilate reduces VEGF signaling by interfering with heparan sulfate binding site and protects from vascular complications in diabetic mice
- Predicting factors for long-term survival in patients with out-of-hospital cardiac arrest – A propensity score-matched analysis
- HIV infection does not alter interferon α/β receptor 2 expression on mucosal immune cells
- The impact of body posture on intrinsic brain activity: The role of beta power at rest
- Retraction: DJ-1 Modulates α-Synuclein Aggregation State in a Cellular Model of Oxidative Stress: Relevance for Parkinson's Disease and Involvement of HSP70
- Practical considerations in the use of a porcine model (Sus scrofa domesticus) to assess prevention of postoperative peritubal adhesions
- Do atmospheric events explain the arrival of an invasive ladybird (Harmonia axyridis) in the UK?
- Transcriptional Differences in Peanut (Arachis hypogaea L.) Seeds at the Freshly Harvested, After-ripening and Newly Germinated Seed Stages: Insights into the Regulatory Networks of Seed Dormancy Release and Germination
- First adaptation of quinoa in the Bhutanese mountain agriculture systems
- Identifying maintenance hosts for infection with Dichelobacter nodosus in free-ranging wild ruminants in Switzerland: A prevalence study
- Model order reduction for left ventricular mechanics via congruency training
- The use of mixed collagen-Matrigel matrices of increasing complexity recapitulates the biphasic role of cell adhesion in cancer cell migration: ECM sensing, remodeling and forces at the leading edge of cancer invasion
- Hyponatraemia reversibly affects human myometrial contractility. An in vitro pilot study
- Production, purification and evaluation of biodegradation potential of PHB depolymerase of Stenotrophomonas sp. RZS7
- The impact of a wireless audio system on communication in robotic-assisted laparoscopic surgery: A prospective controlled trial
- Towards a bottom-up understanding of antimicrobial use and resistance on the farm: A knowledge, attitudes, and practices survey across livestock systems in five African countries
- Geographical origin determines responses to salinity of Mediterranean caddisflies
- Non-redundant roles in sister chromatid cohesion of the DNA helicase DDX11 and the SMC3 acetyl transferases ESCO1 and ESCO2
- Seroprevalence of viral and vector-borne bacterial pathogens in domestic dogs (Canis familiaris) in northern Botswana
- Global reach of ageism on older persons’ health: A systematic review
- Musical expertise generalizes to superior temporal scaling in a Morse code tapping task
- Cross-cultural adaptation and psychometric evaluation of the Yoruba version of Oswestry disability index
- Growth behavior and glyphosate resistance level in 10 populations of Echinochloa colona in Australia
- Analysis of the lineage of Phytophthora infestans isolates using mating type assay, traditional markers, and next generation sequencing technologies
- Post-transcriptional regulation of Rad51c by miR-222 contributes cellular transformation
- Targeting chondroitinase ABC to axons enhances the ability of chondroitinase to promote neurite outgrowth and sprouting
- First eight residues of apolipoprotein A-I mediate the C-terminus control of helical bundle unfolding and its lipidation
- Repeated noninvasive stimulation of the ventromedial prefrontal cortex reveals cumulative amplification of pleasant compared to unpleasant scene processing: A single subject pilot study
- Can scientists fill the science journalism void? Online public engagement with science stories authored by scientists
- Retention and predictors of attrition among patients who started antiretroviral therapy in Zimbabwe’s national antiretroviral therapy programme between 2012 and 2015
- Prognostics for pain in osteoarthritis: Do clinical measures predict pain after total joint replacement?
- Infants without health insurance: Racial/ethnic and rural/urban disparities in infant households’ insurance coverage
- HY5 is not integral to light mediated stomatal development in Arabidopsis
- Effects of Transcranial Direct Current Stimulation on GABA and Glx in Children: A pilot study
- Hypertension testing and treatment in Uganda and Kenya through the SEARCH study: An implementation fidelity and outcome evaluation
- Whole genome sequence analysis reveals the broad distribution of the RtxA type 1 secretion system and four novel putative type 1 secretion systems throughout the Legionella genus
- Evaluation of rice wild relatives as a source of traits for adaptation to iron toxicity and enhanced grain quality
- The Malaysian Workplace Bullying Index (MWBI): A new measure of workplace bullying in Eastern countries
- Brief communication: Long-term absence of Langerhans cells alters the gene expression profile of keratinocytes and dendritic epidermal T cells
- APOBEC3B reporter myeloma cell lines identify DNA damage response pathways leading to APOBEC3B expression
- Morphological diversity within a core collection of subterranean clover (Trifolium subterraneum L.): Lessons in pasture adaptation from the wild
- Feasibility of real-time in vivo 89Zr-DFO-labeled CAR T-cell trafficking using PET imaging
- Repository-based plasmid design
- A LAMP at the end of the tunnel: A rapid, field deployable assay for the kauri dieback pathogen, Phytophthora agathidicida
- A new method of recording from the giant fiber of Drosophila melanogaster shows that the strength of its auditory inputs remains constant with age
- Early conservation benefits of a de facto marine protected area at San Clemente Island, California
- Evaluating risk prediction models for adults with heart failure: A systematic literature review
- Age, period and cohort analysis of age-specific maternal mortality trend in Ethiopia: A secondary analysis
- Aberrant cervical innate immunity predicts onset of dysbiosis and sexually transmitted infections in women of reproductive age
- Performance of Qure.ai automatic classifiers against a large annotated database of patients with diverse forms of tuberculosis
- Closed circuit xenon delivery for 72h in neonatal piglets following hypoxic insult using an ambient pressure automated control system: Development, technical evaluation and pulmonary effects
- Safe mobility, socioeconomic inequalities, and aging: A 12-year multilevel interrupted time-series analysis of road traffic death rates in a Latin American country
- THAP11F80L cobalamin disorder-associated mutation reveals normal and pathogenic THAP11 functions in gene expression and cell proliferation
- Lesion of striatal patches disrupts habitual behaviors and increases behavioral variability
- A clinical method for estimating the modulus of elasticity of the human cornea in vivo
- Gamma gap thresholds and HIV, hepatitis C, and monoclonal gammopathy
- Infective endocarditis post-transcatheter aortic valve implantation (TAVI), microbiological profile and clinical outcomes: A systematic review
- Potentiation of curing by a broad-host-range self-transmissible vector for displacing resistance plasmids to tackle AMR
- An acceleration in hypertension-related mortality for middle-aged and older Americans, 1999-2016: An observational study
- Two common disease-associated TYK2 variants impact exon splicing and TYK2 dosage
- Patient perceived value of teleophthalmology in an urban, low income US population with diabetes
- Real-world cost-effectiveness of rivaroxaban compared with vitamin K antagonists in the context of stroke prevention in atrial fibrillation in France
- Spatial risk assessment of global change impacts on Swedish seagrass ecosystems
- The effects of low-carbohydrate diets on cardiovascular risk factors: A meta-analysis
- Computational analysis of functional single nucleotide polymorphisms associated with SLC26A4 gene
- Evidence in support of chromosomal sex influencing plasma based metabolome vs APOE genotype influencing brain metabolome profile in humanized APOE male and female mice
- Accelerated sparsity based reconstruction of compressively sensed multichannel EEG signals
- A multicenter case control study of association of vitamin D with breast cancer among women in Karachi, Pakistan
- Microvesicles from Lactobacillus reuteri (DSM-17938) completely reproduce modulation of gut motility by bacteria in mice
- Chemical profiling of Curatella americana Linn leaves by UPLC-HRMS and its wound healing activity in mice
- “Yellow” laccase from Sclerotinia sclerotiorum is a blue laccase that enhances its substrate affinity by forming a reversible tyrosyl-product adduct
- Dense carbon-nanotube coating scaffolds stimulate osteogenic differentiation of mesenchymal stem cells
- Gamma Knife radiosurgery for vestibular schwannomas: Evaluation of planning using the sphericity degree of the target volume
- Variants in ADIPOQ gene are linked to adiponectin levels and lung function in young males independent of obesity
- Purification and molecular characterization of phospholipase, antigen 5 and hyaluronidases from the venom of the Asian hornet (Vespa velutina)
- Clinical state tracking in serious mental illness through computational analysis of speech
- Why are animal source foods rarely consumed by 6-23 months old children in rural communities of Northern Ethiopia? A qualitative study
- A study to better understand under-utilization of laboratory tests for antenatal care in Senegal
- Monitoring the ‘diabetes epidemic’: A framing analysis of United Kingdom print news 1993-2013
- Heart rate variability helps to distinguish the intensity of menopausal symptoms: A prospective, observational and transversal study
- Physicians’ perspectives regarding non-medical switching of prescription medications: Results of an internet e-survey
- Trophic ecology of Mexican Pacific harbor seal colonies using carbon and nitrogen stable isotopes
- Effectiveness of information technology–enabled ‘SMART Eating’ health promotion intervention: A cluster randomized controlled trial
- Cauda Equina Syndrome Core Outcome Set (CESCOS): An international patient and healthcare professional consensus for research studies
- Incidence and prediction of intraoperative and postoperative cardiac arrest requiring cardiopulmonary resuscitation and 30-day mortality in non-cardiac surgical patients
- Microscopic distance from tumor invasion front to serosa might be a useful predictive factor for peritoneal recurrence after curative resection of T3-gastric cancer
- A new species of Macrocypraea (Gastropoda, Cypraeidae) from Trindade Island, Brazil, including phenotypic differentiation from remaining congeneric species
- The evolving topology of the Lightning Network: Centralization, efficiency, robustness, synchronization, and anonymity
- Avoid jumping to conclusions under uncertainty in Obsessive Compulsive Disorder
- Tanopicobia gen. nov., a new genus of quill mites, its phylogenetic placement in the subfamily Picobiinae (Acariformes: Syringophilidae) and picobiine relationships with avian hosts
- Large-scale spatial variation of chronic stress signals in moose
- Complex situations: Economic insecurity, mental health, and substance use among pregnant women who consider – but do not have – abortions
- Well-being and entrepreneurship: Using establishment size to identify treatment effects and transmission mechanisms
- Models of protein production along the cell cycle: An investigation of possible sources of noise
- Protein-protein interactions underlying the behavioral and psychological symptoms of dementia (BPSD) and Alzheimer’s disease
- Assessing the feasibility of a life history calendar to measure HIV risk and health in older South Africans
- Prevalence of anaemia and low intake of dietary nutrients in pregnant women living in rural and urban areas in the Ashanti region of Ghana
- Enhancing performance of subject-specific models via subject-independent information for SSVEP-based BCIs
- Perceptions of and interest in HIV pre-exposure prophylaxis use among adolescent girls and young women in Lilongwe, Malawi
- Long term conjugated linoleic acid supplementation modestly improved growth performance but induced testicular tissue apoptosis and reduced sperm quality in male rabbit
- A new approach to the temporal significance of house orientations in European Early Neolithic settlements
- Meta-analysis of the radiological and clinical features of Usual Interstitial Pneumonia (UIP) and Nonspecific Interstitial Pneumonia (NSIP)
- Extreme mortality and reproductive failure of common murres resulting from the northeast Pacific marine heatwave of 2014-2016
- Persistence of chikungunya ECSA genotype and local outbreak in an upper medium class neighborhood in Northeast Brazil
- Fecal transplant prevents gut dysbiosis and anxiety-like behaviour after spinal cord injury in rats
- In vivo elongation of thin filaments results in heart failure
- High resolution respirometry to assess function of mitochondria in native homogenates of human heart muscle
- Disparity in depressive symptoms between heterosexual and sexual minority men in China: The role of social support
- Effect of classroom intervention on student food selection and plate waste: Evidence from a randomized control trial
- Cytomegalovirus-specific CD8+ T-cell responses are associated with arterial blood pressure in people living with HIV
- In-depth hepatoprotective mechanistic study of Phyllanthus niruri: In vitro and in vivo studies and its chemical characterization
- Content shared on social media for national cancer survivors day 2018
- Cost-effectiveness of alectinib compared to crizotinib for the treatment of first-line ALK+ advanced non-small-cell lung cancer in France
- Mating strategy is determinant of adenovirus prevalence in European bats
- Preventing HIV and HSV-2 through knowledge and attitudes: A replication study of a multi-component community-based intervention in Zimbabwe
- MLST-based genetic relatedness of Campylobacter jejuni isolated from chickens and humans in Poland
- Unraveling the polychromy and antiquity of the Pachacamac Idol, Pacific coast, Peru
- Randomized clinical trial analyzing maintenance of peripheral venous catheters in an internal medicine unit: Heparin vs. saline
- Hypertension prevalence but not control varies across the spectrum of risk in patients with atrial fibrillation: A RE-LY atrial fibrillation registry sub-study
- Valuing natural habitats for enhancing coastal resilience: Wetlands reduce property damage from storm surge and sea level rise
- Universal coverage but unmet need: National and regional estimates of attrition across the diabetes care continuum in Thailand
- Patient-related factors may influence nursing perception of sleep in the Intensive Care Unit
- A systematic review and meta-analysis of acute kidney injury in the intensive care units of developed and developing countries
- Phylogeographic analyses point to long-term survival on the spot in micro-endemic Lycian salamanders
- A randomized trial of a behavioral intervention to decrease hospital length of stay by decreasing bedrest
- Genlisea hawkingii (Lentibulariaceae), a new species from Serra da Canastra, Minas Gerais, Brazil
- Structural variation and its potential impact on genome instability: Novel discoveries in the EGFR landscape by long-read sequencing
- Assessment of forest cover and carbon stock changes in sub-tropical pine forest of Azad Jammu & Kashmir (AJK), Pakistan using multi-temporal Landsat satellite data and field inventory
- Color image segmentation using adaptive hierarchical-histogram thresholding
- The association between nonalcoholic fatty liver disease and esophageal, stomach, or colorectal cancer: National population-based cohort study
- Effects in spite of tough constraints - A theory of change based investigation of contextual and implementation factors affecting the results of a performance based financing scheme extended to malnutrition in Burundi
- Comparison of motif-based and whole-unique-sequence-based analyses of phage display library datasets generated by biopanning of anti-Borrelia burgdorferi immune sera
- Identification of the cleavage sites leading to the shed forms of human and mouse anti-aging and cognition-enhancing protein Klotho
- Research performance and age explain less than half of the gender pay gap in New Zealand universities
- Do bumblebees have signatures? Demonstrating the existence of a speed-curvature power law in Bombus terrestris locomotion patterns
- A primary healthcare information intervention for communicating cardiovascular risk to patients with poorly controlled hypertension: The Education and Coronary Risk Evaluation (Educore) study—A pragmatic, cluster-randomized trial
- “I did not know it was a medical condition”: Predictors, severity and help seeking behaviors of women with female sexual dysfunction in the Volta region of Ghana
- The role of services content for manufacturing competitiveness: A network analysis
- Mortality and demographic recovery in early post-black death epidemics: Role of recent emigrants in medieval Dijon
- Modelling the impact of migrants on the success of the HIV care and treatment program in Botswana
- Does squatting need attention?—A dual-task study on cognitive resources in resistance exercise
- A human mission to Mars: Predicting the bone mineral density loss of astronauts
- The role of demographic history and selection in shaping genetic diversity of the Galápagos penguin (Spheniscus mendiculus)
- Attitudes towards animal study registries and their characteristics: An online survey of three cohorts of animal researchers
- Risk perception and behavioral change during epidemics: Comparing models of individual and collective learning
- Drug-target interaction prediction using Multi Graph Regularized Nuclear Norm Minimization
- A preliminary study of resting brain metabolism in treatment-resistant depression before and after treatment with olanzapine-fluoxetine combination
- Use of serum KL-6 level for detecting patients with restrictive allograft syndrome after lung transplantation
- Gait asymmetry in glucocerebrosidase mutation carriers with Parkinson’s disease
- Radioiodine therapy and Graves’ disease – Myths and reality
- pyKNEEr: An image analysis workflow for open and reproducible research on femoral knee cartilage
- Creatinine versus cystatin C for renal function-based mortality prediction in an elderly cohort: The Northern Manhattan Study
- Risk factors for third-generation cephalosporin resistant Enterobacteriaceae in gestational urine cultures: A retrospective cohort study based on centralized electronic health records
- Population-based estimates of humoral autoimmunity from the U.S. National Health and Nutrition Examination Surveys, 1960–2014
- Residential neighbourhood greenspace is associated with reduced risk of cardiovascular disease: A prospective cohort study
- Circulating CTRP9 correlates with the prevention of aortic calcification in renal allograft recipients
- Potential socioeconomic impacts from ocean acidification and climate change effects on Atlantic Canadian fisheries
- Prevention and control of cholera with household and community water, sanitation and hygiene (WASH) interventions: A scoping review of current international guidelines
- Kinematic analysis of motor learning in upper limb body-powered bypass prosthesis training
- The treeness of the tree of historical trees of life
- Female finches prefer courtship signals indicating male vigor and neuromuscular ability
- The effect of spatial position and age within an egg-clutch on embryonic development and key metabolic enzymes in two clownfish species, Amphiprion ocellaris and Amphiprion frenatus
- Egg donors’ motivations, experiences, and opinions: A survey of egg donors in South Africa
- Polymer-free sirolimus-eluting stent use in Europe and Asia: Ethnic differences in demographics and clinical outcomes
- How “simple” methodological decisions affect interpretation of population structure based on reduced representation library DNA sequencing: A case study using the lake whitefish
- The impact of translated reminder letters and phone calls on mammography screening booking rates: Two randomised controlled trials
- Application of a genetic algorithm to the keyboard layout problem
- Design and evaluation of a laboratory-based wheelchair castor testing protocol using community data
- Relationship between diabetic macular edema and choroidal layer thickness
- Evaluation of the predictive ability of ultrasound-based assessment of breast cancer using BI-RADS natural language reporting against commercial transcriptome-based tests
- A Comprehensive Data Gathering Network Architecture in Large-Scale Visual Sensor Networks
- Recovery of health-related quality of life after burn injuries: An individual participant data meta-analysis
- Modeling aggressive market order placements with Hawkes factor models
- Higher prevalence of splenic artery aneurysms in hereditary hemorrhagic telangiectasia: Vascular implications and risk factors
- Measuring the diffusion of innovations with paragraph vector topic models
- Role of ecology in shaping external nasal morphology in bats and implications for olfactory tracking
- Neandertals on the beach: Use of marine resources at Grotta dei Moscerini (Latium, Italy)
- Allergic inflammation is initiated by IL-33–dependent crosstalk between mast cells and basophils
- High expression of olfactomedin-4 is correlated with chemoresistance and poor prognosis in pancreatic cancer
- Wattpad as a resource for literary studies. Quantitative and qualitative examples of the importance of digital social reading and readers’ comments in the margins
- Constructing and influencing perceived authenticity in science communication: Experimenting with narrative
- Development and validation of a prognostic model predicting symptomatic hemorrhagic transformation in acute ischemic stroke at scale in the OHDSI network
- Immune recovery markers in a double blind clinical trial comparing dolutegravir and raltegravir based regimens as initial therapy (SPRING-2)
- A non-canonical role for p27Kip1 in restricting proliferation of corneal endothelial cells during development
- Combined fiscal policies to promote healthier diets: Effects on purchases and consumer welfare
- Estimating the impact of drug use on US mortality, 1999-2016
- Complex patterns of cell growth in the placenta in normal pregnancy and as adaptations to maternal diet restriction
- Tofu intake is inversely associated with risk of breast cancer: A meta-analysis of observational studies
- Digging the diversity of Iberian bait worms Marphysa (Annelida, Eunicidae)
- Influence of light on the infection of Aureococcus anophagefferens CCMP 1984 by a “giant virus”
- MESSAR: Automated recommendation of metabolite substructures from tandem mass spectra
- Temporal ordering of input modulates connectivity formation in a developmental neuronal network model of the cortex
- Healthy lifestyle index and its association with hypertension among community adults in Sri Lanka: A cross-sectional study
- Manual dexterity of mice during food-handling involves the thumb and a set of fast basic movements
- Research on an evolutionary game model and simulation of a cluster innovation network based on fairness preference
- Reconstructing Krassilovia mongolica supports recognition of a new and unusual group of Mesozoic conifers
- Selection of memory clinic patients for CSF biomarker assessment can be restricted to a quarter of cases by using computerized decision support, without compromising diagnostic accuracy
- From organ to cell: Multi-level telomere length assessment in patients with idiopathic pulmonary fibrosis
- Training interval in cardiopulmonary resuscitation
- Quantum isomer search
- Ultrastructure of light-activated axons following optogenetic stimulation to produce late-phase long-term potentiation
- Optimization of tissue sampling for Borrelia burgdorferi in white-footed mice (Peromyscus leucopus)
- How do critical care staff respond to organisational challenge? A qualitative exploration into personality types and cognitive processing in critical care
- Symmetric core-cohesive blockmodel in preschool children’s interaction networks
- Effects of supplemental creatine and guanidinoacetic acid on spatial memory and the brain of weaned Yucatan miniature pigs
- Predicting antibacterial activity from snake venom proteomes
- Community-Based Health Planning and Services Plus programme in Ghana: A qualitative study with stakeholders in two Systems Learning Districts on improving the implementation of primary health care
- An investigation of transportation practices in an Ontario swine system using descriptive network analysis
- Comparison of gridded precipitation datasets for rainfall-runoff and inundation modeling in the Mekong River Basin
- Functional interactions in patients with hemianopia: A graph theory-based connectivity study of resting fMRI signal
- PCR for the detection of pathogens in neonatal early onset sepsis
- Mercury and selenium concentrations in fishes of the Upper Colorado River Basin, southwestern United States: A retrospective assessment
- The effects of dual-task cognitive interference on gait and turning in Huntington’s disease
- Effects of Allium hookeri on gut microbiome related to growth performance in young broiler chickens
- Novel imaging biomarkers for mapping the impact of mild mitochondrial uncoupling in the outer retina in vivo
- Hyperkalemia treatment modalities: A descriptive observational study focused on medication and healthcare resource utilization
- Age and altitude of residence determine anemia prevalence in Peruvian 6 to 35 months old children
- Web service QoS prediction using improved software source code metrics
- Long term impact of PositiveLinks: Clinic-deployed mobile technology to improve engagement with HIV care
- Comparison of post-transplantation diabetes mellitus incidence and risk factors between kidney and liver transplantation patients
- Mothers’ oral health literacy and children’s oral health status in Pikine, Senegal: A pilot study
- A definition-by-example approach and visual language for activity patterns in engineering disciplines
- A network analysis revealed the essential and common downstream proteins related to inguinal hernia
- Use of conventional cardiac troponin assay for diagnosis of non-ST-elevation myocardial infarction: ‘The Ottawa Troponin Pathway’
- Low risk pregnancies after a cesarean section: Determinants of trial of labor and its failure
- Exploratory analysis of the potential for advanced diagnostic testing to reduce healthcare expenditures of patients hospitalized with meningitis or encephalitis
- Airway epithelial specific deletion of Jun-N-terminal kinase 1 attenuates pulmonary fibrosis in two independent mouse models
- Identification and characterization of miRNAs involved in cold acclimation of zebrafish ZF4 cells
- Research on motion planning for an indoor spray arm based on an improved potential field method
- Camera-traps are a cost-effective method for surveying terrestrial squamates: A comparison with artificial refuges and pitfall traps
- Detailed analysis of the transverse arch of hallux valgus feet with and without pain using weightbearing ultrasound imaging and precise force sensors
- The role of survivin in the progression of pancreatic ductal adenocarcinoma (PDAC) and a novel survivin-targeted therapeutic for PDAC
- Filling the human resource gap through public-private partnership: Can private, community-based skilled birth attendants improve maternal health service utilization and health outcomes in a remote region of Bangladesh?
- HIV antiretroviral drugs, dolutegravir, maraviroc and ritonavir-boosted atazanavir use different pathways to affect inflammation, senescence and insulin sensitivity in human coronary endothelial cells
- Still standing: Recent patterns of post-fire conifer refugia in ponderosa pine-dominated forests of the Colorado Front Range
- Surrogate R-spondins for tissue-specific potentiation of Wnt Signaling
- Biogeographic study of human gut-associated crAssphage suggests impacts from industrialization and recent expansion
- Apolipoprotein-AI mimetic peptides D-4F and L-5F decrease hepatic inflammation and increase insulin sensitivity in C57BL/6 mice
- Treating patients with driving phobia by virtual reality exposure therapy – a pilot study
- The impact of race relations on NFL attendance: An econometric analysis
- The potential impact of the Affordable Care Act and Medicaid expansion on reducing colorectal cancer screening disparities in African American males
- Efficient processing of raster and vector data
- Rewilding with large herbivores: Positive direct and delayed effects of carrion on plant and arthropod communities
- Early life experience and alterations of group composition shape the social grooming networks of former pet and entertainment chimpanzees (Pan troglodytes)
- Muscarinic modulation of M and h currents in gerbil spherical bushy cells
- Therapeutic hypothermia after out of hospital cardiac arrest improve 1-year survival rate for selective patients
- Carotid plaques and neurological impairment in patients with acute cerebral infarction
- Deep learning based image reconstruction algorithm for limited-angle translational computed tomography
- Subterranean Deuteraphorura Absolon, 1901, (Hexapoda, Collembola) of the Western Carpathians — Troglomorphy at the northern distributional limit in Europe
- Fragmentation and inefficiencies in US equity markets: Evidence from the Dow 30
- Association between coffee drinking and telomere length in the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial
- Hyperbaric oxygen preconditioning and the role of NADPH oxidase inhibition in postischemic acute kidney injury induced in spontaneously hypertensive rats
- Rad51 paralogs and the risk of unselected breast cancer: A case-control study
- Aqueous ethanol extract of Libidibia ferrea (Mart. Ex Tul) L.P. Queiroz (juca) exhibits antioxidant and migration-inhibiting activity in human gastric adenocarcinoma (ACP02) cells
- Diagnostic differences in respiratory breathing patterns and work of breathing indices in children with Duchenne muscular dystrophy
- The role of narrative in collaborative reasoning and intelligence analysis: A case study
- Proportions of CD4 test results indicating advanced HIV disease remain consistently high at primary health care facilities across four high HIV burden countries
- Modelling of amino acid turnover in the horse during training and racing: A basis for developing a novel supplementation strategy
- Single-modal and multi-modal false arrhythmia alarm reduction using attention-based convolutional and recurrent neural networks
- Eye-gaze information input based on pupillary response to visual stimulus with luminance modulation
- Predictive value of comb-push ultrasound shear elastography for the differentiation of reactive and metastatic axillary lymph nodes: A preliminary investigation
- Type 1 diabetes is associated with an increased risk of venous thromboembolism: A retrospective population-based cohort study
- Trends of litter decomposition and soil organic matter stocks across forested swamp environments of the southeastern US
- Post mortem evaluation of inflammation, oxidative stress, and PPARγ activation in a nonhuman primate model of cardiac sympathetic neurodegeneration
- Were ancient foxes far more carnivorous than recent ones?—Carnassial morphological evidence
- Disruption in daily eating-fasting and activity-rest cycles in Indian adolescents attending school
- Plasma proteome profiling of freshwater and seawater life stages of rainbow trout (Oncorhynchus mykiss)
- Association between baseline abundance of Peptoniphilus, a Gram-positive anaerobic coccus, and wound healing outcomes of DFUs
- The earliest farming communities north of the Carpathians: The settlement at Gwoździec site 2
- Trends of the prevalence and incidence of hypertrophic cardiomyopathy in Korea: A nationwide population-based cohort study
- Percent amplitude of fluctuation: A simple measure for resting-state fMRI signal at single voxel level
- Antimicrobial activity of Asteraceae species against bacterial pathogens isolated from postmenopausal women
- Designing information provision to serve as a reminder of altruistic benefits: A case study of the risks of air pollution caused by industrialization
- Are changes in depressive symptoms, general health and residential area socio-economic status associated with trajectories of waist circumference and body mass index?
- Extracellular vesicles of U937 macrophage cell line infected with DENV-2 induce activation in endothelial cells EA.hy926
- FlexGraph: Flexible partitioning and storage for scalable graph mining
- Post-weaning infant-to-mother bonding in nutritionally independent female mice
- A little good is good enough: Ethical consumption, cheap excuses, and moral self-licensing
- Link-centric analysis of variation by demographics in mobile phone communication patterns
- Multimodal hand gesture recognition using single IMU and acoustic measurements at wrist
- Variance based weighting of multisensory head rotation signals for verticality perception
- Eligibility for hepatitis B antiviral therapy among adults in the general population in Zambia
- Tobacco smoking and health-related quality of life among university students: Mediating effect of depression
- Drivers of the opioid crisis: An appraisal of financial conflicts of interest in clinical practice guideline panels at the peak of opioid prescribing
- Nutritional inadequacies in commercial vegan foods for dogs and cats
- LTA1 and dmLT enterotoxin-based proteins activate antigen-presenting cells independent of PKA and despite distinct cell entry mechanisms
- The Shapley value for a fair division of group discounts for coordinating cooling loads
- Comparison and evaluation of the morphology of crowns generated by biogeneric design technique with CEREC chairside system
- Assessing risk factors and impact of cyberbullying victimization among university students in Myanmar: A cross-sectional study
- Incidence of hospital-acquired pressure ulcers in patients with "minimal risk" according to the "Norton-MI" scale
- Intra-host symbiont diversity in eastern Pacific cold seep tubeworms identified by the 16S-V6 region, but undetected by the 16S-V4 region
- Lipoprotein(a) plasma levels are not associated with survival after acute coronary syndromes: An observational cohort study
- Use of Nanotrap particles for the capture and enrichment of Zika, chikungunya and dengue viruses in urine
- Pancreatic secretory trypsin inhibitor reduces multi-organ injury caused by gut ischemia/reperfusion in mice
- The effect of diet on the gastrointestinal microbiome of juvenile rehabilitating green turtles (Chelonia mydas)
- Biochemical characterization of Ty1 retrotransposon protease
- Lateral pressure equalisation as a principle for designing support surfaces to prevent deep tissue pressure ulcers
- Immunomodulatory function of the cystic fibrosis modifier gene BPIFA1
- The validation of the Beijing version of the Montreal Cognitive Assessment in Chinese patients undergoing hemodialysis
- All of gene expression (AOE): An integrated index for public gene expression databases
- Characterization of the visceral and neuronal phenotype of 4L/PS-NA mice modeling Gaucher disease
- Inflammasome expression is higher in ovarian tumors than in normal ovary
- HCV genotype profile in Brazil of mono-infected and HIV co-infected individuals: A survey representative of an entire country
- Engaging with change: Information and communication technology professionals’ perspectives on change at the mid-point in the UK/EU Brexit process
- Adherence to iron-folic acid supplement and associated factors among antenatal care attending pregnant mothers in governmental health institutions of Adwa town, Tigray, Ethiopia: Cross-sectional study
- Flower, seed, and fruit development in three Tunisian species of Polygonum: Implications for their taxonomy and evolution of distyly in Polygonaceae
- Development of a risk score for prediction of poor treatment outcomes among patients with multidrug-resistant tuberculosis
- Preclinical evaluation of AT-527, a novel guanosine nucleotide prodrug with potent, pan-genotypic activity against hepatitis C virus
- Aqueous extract from Mangifera indica Linn. (Anacardiaceae) leaves exerts long-term hypoglycemic effect, increases insulin sensitivity and plasma insulin levels on diabetic Wistar rats
- Marine seafood production via intense exploitation and cultivation in China: Costs, benefits, and risks
- Signatures of medical student applicants and academic success
- Discovery of Jogalong virus, a novel hepacivirus identified in a Culex annulirostris (Skuse) mosquito from the Kimberley region of Western Australia
- The effects of extended photoperiod and warmth on hair growth in ponies and horses at different times of year
- Modeling the effect of prolonged ethanol exposure on global gene expression and chromatin accessibility in normal 3D colon organoids
- Clinical, cytogenetic and molecular genetic characterization of a tandem fusion translocation in a male Holstein cattle with congenital hypospadias and a ventricular septal defect
- Severity of misophonia symptoms is associated with worse cognitive control when exposed to misophonia trigger sounds
- Detection of Torque Teno Virus (TTV) and TTV-Like Minivirus in patients with presumed infectious endophthalmitis in India
- CD4 rate of increase is preferred to CD4 threshold for predicting outcomes among virologically suppressed HIV-infected adults on antiretroviral therapy
- The evolution of secondary flow phenomena and their effect on primary shock conditions in shock tubes: Experimentation and numerical model
- Estimating the basic reproduction number of a pathogen in a single host when only a single founder successfully infects
- What drugs modify the risk of iatrogenic impulse-control disorders in Parkinson’s disease? A preliminary pharmacoepidemiologic study
- Evaluating emotional distress and health-related quality of life in patients with heart failure and their family caregivers: Testing dyadic dynamics using the Actor-Partner Interdependence Model
- Community- and trophic-level responses of soil nematodes to removal of a non-native tree at different stages of invasion
- Association of ECG parameters with late gadolinium enhancement and outcome in patients with clinical suspicion of acute or subacute myocarditis referred for CMR imaging
- Sonographic measurement of normal common bile duct diameter and associated factors at the University of Gondar comprehensive specialized hospital and selected private imaging center in Gondar town, North West Ethiopia
- Catchment-scale export of antibiotic resistance genes and bacteria from an agricultural watershed in central Iowa
- Impact of multi-drug resistant bacteria on economic and clinical outcomes of healthcare-associated infections in adults: Systematic review and meta-analysis
- Characterization of a universal screening approach for congenital CMV infection based on a highly-sensitive, quantitative, multiplex real-time PCR assay
- Proof-of-concept for a non-invasive, portable, and wireless device for cardiovascular monitoring in pediatric patients
- On PTV definition for glioblastoma based on fiber tracking of diffusion tensor imaging data
- Multiregional origins of the domesticated tetraploid wheats
- Racism against Totonaco women in Veracruz: Intercultural competences for health professionals are necessary
- Increased inflammation and endothelial markers in patients with late severe post-thrombotic syndrome
- Genes associated with body weight gain and feed intake identified by meta-analysis of the mesenteric fat from crossbred beef steers
- Intraoperative computed tomography imaging for dose calculation in intraoperative electron radiation therapy: Initial clinical observations
- Multiple paedomorphic lineages of soft-substrate burrowing invertebrates: parallels in the origin of Xenocratena and Xenoturbella
- Human lung epithelial BEAS-2B cells exhibit characteristics of mesenchymal stem cells
- Simple non-mydriatic retinal photography is feasible and demonstrates retinal microvascular dilation in Chronic Obstructive Pulmonary Disease (COPD)
- Evaluating poverty alleviation strategies in a developing country
- RNAmountAlign: Efficient software for local, global, semiglobal pairwise and multiple RNA sequence/structure alignment
- Maternal depressive symptoms and children’s cognitive development: Does early childcare and child’s sex matter?
- Pan-cancer analysis of somatic mutations and epigenetic alterations in insulated neighbourhood boundaries
- Evaluation of a bioengineered ACL matrix’s osteointegration with BMP-2 supplementation
- Psychosocial profiles of physical activity fluctuation in office employees: A latent profile analysis
- Prevalence and characteristics of Livestock-Associated Methicillin-Resistant Staphylococcus aureus (LA-MRSA) isolated from chicken meat in the province of Quebec, Canada
- HIV treatment response among female sex workers participating in a treatment as prevention demonstration project in Cotonou, Benin
- Soluble AXL as a marker of disease progression and survival in melanoma
- Using machine learning methods to determine a typology of patients with HIV-HCV infection to be treated with antivirals
- Quantifying tourism booms and the increasing footprint in the Arctic with social media data
- Gender differences influence over insomnia in Korean population: A cross-sectional study
- Impact of scion/rootstock reciprocal effects on metabolomics of fruit juice and phloem sap in grafted Citrus reticulata
- Adapting cognitive diagnosis computerized adaptive testing item selection rules to traditional item response theory
- Usability assessment of seven HIV self-test devices conducted with lay-users in Johannesburg, South Africa
- Autumn shifts in cold tolerance metabolites in overwintering adult mountain pine beetles
- Management of veterinary anaesthesia in small animals: A survey of current practice in Quebec
- Genetic structure of the European hedgehog (Erinaceus europaeus) in Denmark
- Molecular karyotyping of Siberian wild rye (Elymus sibiricus L.) with oligonucleotide fluorescence in situ hybridization (FISH) probes
- Umbilical cord separation time, predictors and healing complications in newborns with dry care
- The strain distribution in the lumbar anterior longitudinal ligament is affected by the loading condition and bony features: An in vitro full-field analysis
- Marine resource congestion in China: Identifying, measuring, and assessing its impact on sustainable development of the marine economy
- Analysis of attitudinal components towards statistics among students from different academic degrees
- Effects of fatigue induced by repeated-sprint on kicking accuracy and velocity in female soccer players
- A pre-clinical validation plan to evaluate analytical sensitivities of molecular diagnostics such as BD MAX MDR-TB, Xpert MTB/Rif Ultra and FluoroType MTB
- Leadership for success in transforming medical abortion policy in Canada
- Clinical correlates associated with the long-term response of bipolar disorder patients to lithium, valproate or lamotrigine: A retrospective study
- Determinants of change in long-acting or permanent contraceptives use in Ethiopia; A multivariate decomposition analysis of data from the Ethiopian demographic and health survey
- Forecasting stock prices with long-short term memory neural network based on attention mechanism
- On the genus Crossaster (Echinodermata: Asteroidea) and its distribution
- Intracellular and in vivo evaluation of imidazo[2,1-b]thiazole-5-carboxamide anti-tuberculosis compounds
- Serum amyloid P component promotes formation of distinct aggregated lysozyme morphologies and reduces toxicity in Drosophila flies expressing F57I lysozyme
- Optogenetically induced cellular habituation in non-neuronal cells
- An integrated vitamin E-coated polymer hybrid nanoplatform: A lucrative option for an enhanced in vitro macrophage retention for an anti-hepatitis B therapeutic prospect
- The effect of strontium and silicon substituted hydroxyapatite electrochemical coatings on bone ingrowth and osseointegration of selective laser sintered porous metal implants
- Modeling the Theory of Planned Behaviour to predict adherence to preventive dental visits in preschool children
- Molecular prevalence of Bartonella, Babesia, and hemotropic Mycoplasma species in dogs with hemangiosarcoma from across the United States
- Color discrimination and gas chromatography-mass spectrometry fingerprint based on chemometrics analysis for the quality evaluation of Schizonepetae Spica
- Comparisons of recurrence-free survival and overall survival between microwave versus radiofrequency ablation treatment for hepatocellular carcinoma: A multiple centers retrospective cohort study with propensity score matching
- Transcriptome-wide identification of novel circular RNAs in soybean in response to low-phosphorus stress
- Oral misoprostol, low dose vaginal misoprostol, and vaginal dinoprostone for labor induction: Randomized controlled trial
- The association between dietary patterns before and in early pregnancy and the risk of gestational diabetes mellitus (GDM): Data from the Malaysian SECOST cohort
- Gene expression noise in a complex artificial toxin expression system
- Dynamic Extreme Aneuploidy (DEA) in the vegetable pathogen Phytophthora capsici and the potential for rapid asexual evolution
- Assertive, trainable and older dogs are perceived as more dominant in multi-dog households
- Prediction of Uropathogens by Flow Cytometry and Dip-stick Test Results of Urine Through Multivariable Logistic Regression Analysis
- Accelerated brain aging towards transcriptional inversion in a zebrafish model of the K115fs mutation of human PSEN2
- Copper to Tuscany – Coals to Newcastle? The dynamics of metalwork exchange in early Italy
- The Brazilian TP53 mutation (R337H) and sarcomas
- Interleukin 6 is increased in preclinical HNSCC models of acquired cetuximab resistance, but is not required for maintenance of resistance
- Detection of amitraz resistance and reduced treatment efficacy in the Varroa Mite, Varroa destructor, within commercial beekeeping operations
- Impact of viral disease hypophagia on pig jejunal function and integrity
- Enzyme response of activated sludge to a mixture of emerging contaminants in continuous exposure
- Molecular evidence for horizontal transmission of chelonid alphaherpesvirus 5 at green turtle (Chelonia mydas) foraging grounds in Queensland, Australia
- Technology anxiety and resistance to change behavioral study of a wearable cardiac warming system using an extended TAM for older adults
- Evaluation and validation of 2D biomechanical models of the knee for radiograph-based preoperative planning in total knee arthroplasty
- Soil-Transmitted Helminth infections reduction in Bhutan: A report of 29 years of deworming
- Age-related differences in the temporal dynamics of spectral power during memory encoding
- cagA gene EPIYA motif genetic characterization from Colombian Helicobacter pylori isolates: Standardization of a molecular test for rapid clinical laboratory detection
- Mugharat an-Nachcharini: A specialized sheep-hunting camp reveals high-altitude habitats in the earliest Neolithic of the Central Levant
- Spectral characteristics of urine from patients with end-stage kidney disease analyzed using Raman Chemometric Urinalysis (Rametrix)
- Clinicians’ communication with patients receiving a MCI diagnosis: The ABIDE project
- Quantitative PCR provides a simple and accessible method for quantitative microbiota profiling
- Fast quantitative time lapse displacement imaging of endothelial cell invasion
- Two novel mutations in MSX1 causing oligodontia
- 7,200 years old constructions and mudbrick technology: The evidence from Tel Tsaf, Jordan Valley, Israel
- Tuberculosis recurrences and predictive factors in a vulnerable population in Catalonia
- Dome-shaped macula in children and adolescents
- Barriers in the access, diagnosis and treatment completion for tuberculosis patients in central and western Nepal: A qualitative study among patients, community members and health care workers
- Evaluation of KRAS, NRAS and BRAF mutations detection in plasma using an automated system for patients with metastatic colorectal cancer
- Targeted transcriptomic study of the implication of central metabolic pathways in mannosylerythritol lipids biosynthesis in Pseudozyma antarctica T-34
- Preliminary evidences of the presence of extracellular DNA single stranded forms in soil
- A comparison of quality of life between patients treated with different dialysis modalities in Taiwan
- The effectiveness of substance use interventions for homeless and vulnerably housed persons: A systematic review of systematic reviews on supervised consumption facilities, managed alcohol programs, and pharmacological agents for opioid use disorder
- Spatiotemporal characteristics and driving forces of construction land expansion in Yangtze River economic belt, China
- Comparison of Monocyte Distribution Width (MDW) and Procalcitonin for early recognition of sepsis
- Morphological association between the muscles and bones in the craniofacial region
- Transcriptome analysis of Actinidia chinensis in response to Botryosphaeria dothidea infection
- Evaluating two decision aids for Australian men supporting informed decisions about prostate cancer screening: A randomised controlled trial
- Serum galectins as potential biomarkers of inflammatory bowel diseases
- Linguistic Z-number weighted averaging operators and their application to portfolio selection problem
- Comparative study on skin protection activity of polyphenol-rich extract and polysaccharide-rich extract from Sargassum vachellianum
- Real-world data about emotional stress, disability and need for social care in a German IBD patient cohort
- The regenerative compatibility: A synergy between healthy ecosystems, environmental attitudes, and restorative experiences
- Fusion of augmented reality imaging with the endoscopic view for endonasal skull base surgery; a novel application for surgical navigation based on intraoperative cone beam computed tomography and optical tracking
- Functional characterization of NK cells in Mexican pediatric patients with acute lymphoblastic leukemia: Report from the Mexican Interinstitutional Group for the Identification of the Causes of Childhood Leukemia
- Radiomics signature for prediction of lateral lymph node metastasis in conventional papillary thyroid carcinoma
- Antenatal depression and its association with adverse birth outcomes in low and middle-income countries: A systematic review and meta-analysis
- Perceptions of risk and influences of choice in pregnant women with obesity. An evidence synthesis of qualitative research
- The role of refugee and migrant migration status on medication adherence: Mediation through illness perceptions
- Job stress and emotional exhaustion at work in Spanish workers: Does unhealthy work affect the decision to drive?
- Correction: Amphibians on the hotspot: Molecular biology and conservation in the South American Atlantic Rainforest
- Sexual risk classes among youth experiencing homelessness: Relation to childhood adversities, current mental symptoms, substance use, and HIV testing
- Time for change is now: Experiences of participants in a community-based approach for iron and folic acid supplementation in a rural county in Kenya, a qualitative study
- Non-invasive genetic monitoring for the threatened valley elderberry longhorn beetle
- Statistical learning for turboshaft helicopter accidents using logistic regression
- Vegetation change over seven years in the largest protected Pacific Northwest Bunchgrass Prairie remnant
- The effect of various metal-salts on the sedimentation of soil in a water-based suspension
- Using electronic health record system triggers to target delivery of a patient-centered intervention to improve venous thromboembolism prevention for hospitalized patients: Is there a differential effect by race?
- Effects of CK2β subunit down-regulation on Akt signalling in HK-2 renal cells
- Novel broad-spectrum activity-based probes to profile malarial cysteine proteases
- Health-related quality of life in cancer patients treated with immune checkpoint inhibitors: A systematic review on reporting of methods in randomized controlled trials
- Environmental tobacco smoke (ETS) and hyperlipidemia modified by perceived work stress
- Association between opioid analgesic therapy and initiation of buprenorphine management: An analysis of prescription drug monitoring program data
- Effect of a community-based approach of iron and folic acid supplementation on compliance by pregnant women in Kiambu County, Kenya: A quasi-experimental study
- Radiocarbon dating of two old African baobabs from India
- Improvement project in higher education institutions: A BPEP-based model
- An updated evaluation of serum sHER2, CA15.3, and CEA levels as biomarkers for the response of patients with metastatic breast cancer to trastuzumab-based therapies
- Genome-wide association study of metabolic syndrome in Korean populations
- The diagnostic accuracy of liver fibrosis in non-viral liver diseases using acoustic radiation force impulse elastography: A systematic review and meta-analysis
- Drug therapy problems and treatment satisfaction among ambulatory patients with epilepsy in a specialized hospital in Ethiopia
- Short- & long-term effects of monetary and non-monetary incentives to cooperate in public good games: An experiment
- Niche modeling reveals life history shifts in birds at La Brea over the last twenty millennia
- Morphological consequences of artificial cranial deformation: Modularity and integration
- Distributed flux balance analysis simulations of serial biomass fermentation by two organisms
- Plasma kynurenines and prognosis in patients with heart failure
- Occurrence and distribution of anthropogenic persistent organic pollutants in coastal sediments and mud shrimps from the wetland of central Taiwan
- Intensified visual clutter induces increased sympathetic signalling, poorer postural control, and faster torsional eye movements during visual rotation
- Restoration of cortical symmetry and binaural function: Cortical auditory evoked responses in adult cochlear implant users with single sided deafness
- A smartphone-enabled wireless and batteryless implantable blood flow sensor for remote monitoring of prosthetic heart valve function
- Gut microbiota composition alterations are associated with the onset of diabetes in kidney transplant recipients
- Shock index and TIMI risk index as valuable prognostic tools in patients with acute coronary syndrome complicated by cardiogenic shock
- Merit overrules theory of mind when young children share resources with others
- Economic burden of maternal morbidity – A systematic review of cost-of-illness studies
- Comparison of balance changes after inspiratory muscle or Otago exercise training
- Correction: Escherichia coli and Salmonella spp. isolated from Australian meat chickens remain susceptible to critically important antimicrobial agents
- Metabolic analysis of amino acids and vitamin B6 pathways in lymphoma survivors with cancer related chronic fatigue
- Cell-free DNA donor fraction analysis in pediatric and adult heart transplant patients by multiplexed allele-specific quantitative PCR: Validation of a rapid and highly sensitive clinical test for stratification of rejection probability
- Immunopathogenesis of canine chronic ulcerative stomatitis
- Correction: Quantification of speech and synchrony in the conversation of adults with autism spectrum disorder
- Efficacy and safety of ultrasonic circular cyclocoagulation with second-generation probe in glaucoma: A retrospective study
- Generalizing findings from a randomized controlled trial to a real-world study of the iLookOut, an online education program to improve early childhood care and education providers’ knowledge and attitudes about reporting child maltreatment
- Self-selection of food ingredients and agricultural by-products by the house cricket, Acheta domesticus (Orthoptera: Gryllidae): A holistic approach to develop optimized diets
- Machine learning detection of Atrial Fibrillation using wearable technology
- Comparative proteomic analysis of different stages of breast cancer tissues using ultra high performance liquid chromatography tandem mass spectrometer
- A cross-sectional study of psychopathy and khat abuse among prisoners in the correctional institution in Jimma, Ethiopia
- Head impulse compensatory saccades: Visual dependence is most evident in bilateral vestibular loss
- Complementarity of empirical and process-based approaches to modelling mosquito population dynamics with Aedes albopictus as an example—Application to the development of an operational mapping tool of vector populations
- Pepsin promotes laryngopharyngeal neoplasia by modulating signaling pathways to induce cell proliferation
- When and what to test for: A cost-effectiveness analysis of febrile illness test-and-treat strategies in the era of responsible antibiotic use
- Comparison of effects and safety in providing controlled hypotension during surgery between dexmedetomidine and magnesium sulphate: A meta-analysis of randomized controlled trials
- The gene encoding the ketogenic enzyme HMGCS2 displays a unique expression during gonad development in mice
- Seroepidemiological study of rubella in Vojvodina, Serbia: 24 years after the introduction of the MMR vaccine in the national immunization programme
- Efficacy of a mitochondrion-targeting agent for reducing the level of urinary protein in rats with puromycin aminonucleoside-induced minimal-change nephrotic syndrome
- Association of endothelial nitric oxide synthase (NOS3) gene polymorphisms with primary open-angle glaucoma in a Saudi cohort
- Antitrust analysis with upward pricing pressure and cost efficiencies
- Machine learning models for identifying preterm infants at risk of cerebral hemorrhage
- Natural selection contributes to food web stability
- Pyramiding QTLs controlling tolerance against drought, salinity, and submergence in rice through marker assisted breeding
- Diversity and plant growth-promoting functions of diazotrophic/N-scavenging bacteria isolated from the soils and rhizospheres of two species of Solanum
- Sustainability effects of motor control stabilisation exercises on pain and function in chronic nonspecific low back pain patients: A systematic review with meta-analysis and meta-regression
- Sofosbuvir-based regimen for genotype 2 HCV infected patients in Taiwan: A real world experience
- The virulence domain of Shigella IcsA contains a subregion with specific host cell adhesion function
- Sequencing artifacts derived from a library preparation method using enzymatic fragmentation
- Analysis of the Rdr1 gene family in different Rosaceae genomes reveals an origin of an R-gene cluster after the split of Rubeae within the Rosoideae subfamily
- Concomitant phytonutrient and transcriptome analysis of mature fruit and leaf tissues of tomato (Solanum lycopersicum L. cv. Oregon Spring) grown using organic and conventional fertilizer
- Quantitative analysis of adsorption and desorption of volatile organic compounds on reusable zeolite filters using gas chromatography
- Comparing bioinformatic pipelines for microbial 16S rRNA amplicon sequencing
- TMEM98 is a negative regulator of FRAT mediated Wnt/ß-catenin signalling
- Modeling migration patterns in the USA under sea level rise
- Quo vadis Pantanal? Expected precipitation extremes and drought dynamics from changing sea surface temperature
- Cloud-computing and machine learning in support of country-level land cover and ecosystem extent mapping in Liberia and Gabon
- An exploratory study on the quality of patient screening and counseling for hypertension management in Tanzania
- Relation of fibroblast growth factor receptor 2 expression to hepatocellular carcinoma recurrence after liver resection
- The Brief Measure of Emotional Preoperative Stress (B-MEPS) as a new predictive tool for postoperative pain: A prospective observational cohort study
- The impact of diabetes mellitus medication on the incidence of endogenous endophthalmitis
- Correction: Chl1 DNA helicase and Scc2 function in chromosome condensation through cohesin deposition
- Clinical and pathological features of thrombotic microangiopathy influencing long-term kidney transplant outcomes
- Multidisciplinary investigation of two Egyptian child mummies curated at the University of Tartu Art Museum, Estonia (Late/Graeco-Roman Periods)
- Occupational exposure to particulate matter from air pollution in the outdoor workplaces in Almaty during the cold season
- Morphological adjustment in free-living Steinernema feltiae infective juveniles to increasing concentration of Nemafric-BL phytonematicide
- Murine Surf4 is essential for early embryonic development
- Using mHealth to improve health care delivery in India: A qualitative examination of the perspectives of community health workers and beneficiaries
- Algorithmic handwriting analysis of the Samaria inscriptions illuminates bureaucratic apparatus in biblical Israel
- Key necroptotic proteins are required for Smac mimetic-mediated sensitization of cholangiocarcinoma cells to TNF-α and chemotherapeutic gemcitabine-induced necroptosis
- Concurrent lipidomics and proteomics on malignant plasma cells from multiple myeloma patients: Probing the lipid metabolome
- Short treatment with antalarmin alters adrenal gland receptors in the rat model of endometriosis
- Is it really always only the others who are to blame? GP’s view on medical overuse. A questionnaire study
- Serum visfatin and vaspin levels in hepatocellular carcinoma (HCC)
- Retraction: SDR9C7 Promotes Lymph Node Metastases in Patients with Esophageal Squamous Cell Carcinoma
- iTRAQ proteomics reveals the regulatory response to Magnaporthe oryzae in durable resistant vs. susceptible rice genotypes
- A smartphone-based test for the assessment of attention deficits in delirium: A case-control diagnostic test accuracy study in older hospitalised patients
- Association between tuberculosis and depression on negative outcomes of tuberculosis treatment: A systematic review and meta-analysis
- Incidence and predictors of loss to follow up among adult HIV patients on antiretroviral therapy in University of Gondar Comprehensive Specialized Hospital: A competing risk regression modeling
- Point-of-care diagnostic (POCD) method for detecting Bursaphelenchus xylophilus in pinewood using recombinase polymerase amplification (RPA) with the portable optical isothermal device (POID)
- Bioluminescent imaging of Arabidopsis thaliana using an enhanced Nano-lantern luminescence reporter system
- Biosynthetic pathway of indole-3-acetic acid in ectomycorrhizal fungi collected from northern Thailand
- Clinical implications of elevated serum interleukin-6 in IgG4-related disease
- Downscaling NLDAS-2 daily maximum air temperatures using MODIS land surface temperatures
- Sex-specific and opposite modulatory aspects revealed by PPI network and pathway analysis of ischemic stroke in humans
- Plasma Trimethylamine-N-oxide and impaired glucose regulation: Results from The Oral Infections, Glucose Intolerance and Insulin Resistance Study (ORIGINS)
- Self-esteem and other risk factors for depressive symptoms among adolescents in United Arab Emirates
- Control of the microsporidian parasite Nosema ceranae in honey bees (Apis mellifera) using nutraceutical and immuno-stimulatory compounds
- The effect of storage conditions on microbial communities in stool
- Role of donor genotype in RT-QuIC seeding activity of chronic wasting disease prions using human and bank vole substrates
- Influence of flow on phosphorus-dynamics and particle size in agricultural drainage ditch sediments
- A prospective, randomized, double-blind trial to compare body weight-adjusted and fixed doses of palonosetron for preventing postoperative nausea and vomiting in obese female patients
- Application of computerized 3D-CT texture analysis of pancreas for the assessment of patients with diabetes
- Predictive validation and forecasts of short-term changes in healthcare expenditure associated with changes in smoking behavior in the United States
- An information-based approach to handle various types of uncertainty in fuzzy bodies of evidence
- Oral magnesium supplementation for leg cramps in pregnancy—An observational controlled trial
- Health care professionals’ knowledge of commonly used sedative, analgesic and neuromuscular drugs: A single center (Rambam Health Care Campus), prospective, observational survey
- Campylobacter portucalensis sp. nov., a new species of Campylobacter isolated from the preputial mucosa of bulls
- OGG1 deficiency alters the intestinal microbiome and increases intestinal inflammation in a mouse model
- Transgenic interleukin 11 expression causes cross-tissue fibro-inflammation and an inflammatory bowel phenotype in mice
- Novel method to measure temporal windows based on eye movements during viewing of the Necker cube
- Whole blood transcriptomic analysis of beef cattle at arrival identifies potential predictive molecules and mechanisms that indicate animals that naturally resist bovine respiratory disease
- Effects of smoke flavoring using different wood chips and barbecuing on the formation of polycyclic aromatic hydrocarbons and heterocyclic aromatic amines in salmon fillets
- Sleep quality and sex modify the relationships between trait energy and fatigue on state energy and fatigue
- The role of peer, parental, and school norms in predicting adolescents’ attitudes and behaviours of majority and different minority ethnic groups in Croatia
- Filtered beauty in Oslo and Tokyo: A spatial frequency analysis of facial attractiveness
- The impact of rehabilitation frequency on the risk of stroke in patients with rheumatoid arthritis
- Availability, prices and affordability of selected antibiotics and medicines against non-communicable diseases in western Cameroon and northeast DR Congo
- The effect of mutations derived from mouse-adapted H3N2 seasonal influenza A virus to pathogenicity and host adaptation
- Detection of posttraumatic pneumothorax using electrical impedance tomography—An observer-blinded study in pigs with blunt chest trauma
- Educators’ perceptions of organisational readiness for implementation of a pre-adolescent transdisciplinary school health intervention for inter-generational outcomes
- Beyond the heterodimer model for mineralocorticoid and glucocorticoid receptor interactions in nuclei and at DNA
- The effects of sport expertise and shot results on basketball players’ action anticipation
- Framework and algorithms for identifying honest blocks in blockchain
- Efficacy and safety of anti-viral therapy for Hepatitis B virus-associated glomerulonephritis: A meta-analysis
- Selective transmission of some HIV-1 subtype C variants might depend on Envelope stimulating dendritic cells to secrete IL-10
- Noise reduction and quantification of fiber orientations in greyscale images
- Exploring the impact of terminology differences in blood and organ donor decision making
- Ontogenetic similarities between giraffe and sauropod neck osteological mobility
- Load transfer mechanism and critical length of anchorage zone for anchor bolt
- Income inequalities in stroke incidence and mortality: Trends in stroke-free and stroke-affected life years based on German health insurance data
- Community’s perception, experiences and health seeking behavior towards newborn illnesses in Debre Libanos District, North Shoa, Oromia, Ethiopia: Qualitative study
- Platelet indices significantly correlate with liver fibrosis in HCV-infected patients
- Reanalysis of the Bridge et al. study of suicide following release of 13 Reasons Why
- Validation of the easyscreen flavivirus dengue alphavirus detection kit based on 3base amplification technology and its application to the 2016/17 Vanuatu dengue outbreak
- The nitrate content of fresh and cooked vegetables and their health-related risks
- Bioreactor for mobilization of mesenchymal stem/stromal cells into scaffolds under mechanical stimulation: Preliminary results
- Serotonin transporter dependent modulation of food-seeking behavior
- Implicit task switching in Parkinson’s disease is preserved when on medication
- Root treatment with oxathiapiprolin, benthiavalicarb or their mixture provides prolonged systemic protection against oomycete foliar pathogens
- Real-world effectiveness and safety of ranibizumab for the treatment of myopic choroidal neovascularization: Results from the LUMINOUS study
- Non-gradient and genotype-dependent patterns of RSV gene expression
- Multiplex real-time PCR for the detection of Clavibacter michiganensis subsp. michiganensis, Pseudomonas syringae pv. tomato and pathogenic Xanthomonas species on tomato plants
- The 24-hour urinary cortisol in post-traumatic stress disorder: A meta-analysis
- Parasites modulate the gut-microbiome in insects: A proof-of-concept study
- The dynamics of shapes of vesicle membranes with time dependent spontaneous curvature
- Vascularization and biocompatibility of poly(ε-caprolactone) fiber mats for rotator cuff tear repair
- The shield of self-compassion: A buffer against disordered eating risk from physical appearance perfectionism
- Disease-specific out-of-pocket healthcare expenditure in urban Bangladesh: A Bayesian analysis
- Advanced biofilm analysis in streams receiving organic deicer runoff
- Upregulation of long non-coding RNA ROR1-AS1 promotes cell growth and migration in bladder cancer by regulation of miR-504
- Method development and validation for rapid identification of epigallocatechin gallate using ultra-high performance liquid chromatography
- Neonatal sepsis in Iran: A systematic review and meta-analysis on national prevalence and causative pathogens
- Drug-eluting versus bare-metal stents for first myocardial infarction in patients with atrial fibrillation: A nationwide population-based cohort study
- Same-day antiretroviral therapy initiation for HIV-infected adults in South Africa: Analysis of routine data
- Health-related quality of life among patients with type 2 diabetes mellitus in Eastern Province, Saudi Arabia: A cross-sectional study
- Photocatalytic biocidal effect of copper doped TiO2 nanotube coated surfaces under laminar flow, illuminated with UVA light on Legionella pneumophila
- The interoceptive hippocampus: Mouse brain endocrine receptor expression highlights a dentate gyrus (DG)–cornu ammonis (CA) challenge–sufficiency axis
- Educational attainment and HIV testing and counselling service utilisation during antenatal care in Ghana: Analysis of Demographic and Health Surveys
- Dissection of flag leaf metabolic shifts and their relationship with those occurring simultaneously in developing seed by application of non-targeted metabolomics
- Centromeres of Cucumis melo L. comprise Cmcent and two novel repeats, CmSat162 and CmSat189
- Acute high-intensity and moderate-intensity interval exercise do not change corticospinal excitability in low fit, young adults
- “I like the way I am, but I feel like I could get a little bit bigger”: Perceptions of body image among adolescents and youth living with HIV in Durban, South Africa
- Nanoparticle-based ‘turn-on’ scattering and post-sample fluorescence for ultrasensitive detection of water pollution in wider window
- The relationship of moral sensitivity and patient safety attitudes with nursing students’ perceptions of disclosure of patient safety incidents: A cross-sectional study
- Insights into the strategy of micro-environmental adaptation: Transcriptomic analysis of two alvinocaridid shrimps at a hydrothermal vent
- Thirty-day readmission after medical-surgical hospitalization for people who experience imprisonment in Ontario, Canada: A retrospective cohort study
- The effect of long-term brine discharge from desalination plants on benthic foraminifera
- Hyper-spectral response and estimation model of soil degradation in Kenli County, the Yellow River Delta
- Prescribing trends of glaucoma drugs in six major cities of China from 2013 to 2017
- Significant changes in synovial fluid microRNAs after high tibial osteotomy in medial compartmental knee osteoarthritis: Identification of potential prognostic biomarkers
- Reassortment and adaptive mutations of an emerging avian influenza virus H7N4 subtype in China
- Ischemia and reperfusion injury in superficial inferior epigastric artery-based vascularized lymph node flaps
- High failure rates of protease inhibitor-based antiretroviral treatment in rural Tanzania – A prospective cohort study
- Switchable resolution in soft x-ray tomography of single cells
- Mitochondrial DNA variations and mitochondrial dysfunction in Fanconi anemia
- Extended-spectrum beta-lactamase (ESBL)-producing and non-ESBL-producing Escherichia coli isolates causing bacteremia in the Netherlands (2014 – 2016) differ in clonal distribution, antimicrobial resistance gene and virulence gene content
- Molecular characterization of blaKHM-1 encoding plasmid in an Enterobacter hormaechei subsp. hoffmannii isolate from blood culture
- PR3 levels are impaired in plasma and PBMCs from Arabs with cardiovascular diseases
- Sex differences in self-regulation in early, middle and late adolescence: A large-scale cross-sectional study
- Interaction between elevated temperature and different types of Na-salicylate treatment in Brachypodium dystachion
- A highway crash risk assessment method based on traffic safety state division
- A brain connectivity characterization of children with different levels of mathematical achievement based on graph metrics
- Quantifying the level of difficulty to treat major depressive disorder with antidepressants: Treatment Resistance to Antidepressants Evaluation Scale
- Occupational gender segregation and economic growth in U.S. local labor markets, 1980 through 2010
- The association of telomere length and telomerase activity with adverse outcomes in older patients with non-ST-elevation acute coronary syndrome
- Construction of a high-density genetic map and fine mapping of a candidate gene locus for a novel branched-spike mutant in barley
- Alterations of aqueous humor Aβ levels in Aβ-infused and transgenic mouse models of Alzheimer disease
- Parameters impacting the live birth rate per transfer after frozen single euploid blastocyst transfer
- Deep2Full: Evaluating strategies for selecting the minimal mutational experiments for optimal computational predictions of deep mutational scan outcomes
- Economic compensation interventions to increase uptake of voluntary medical male circumcision for HIV prevention: A systematic review and meta-analysis
- Distinctive effect of anesthetics on the effect of limb remote ischemic postconditioning following ischemic stroke
- Natural hybridization between Phyllagathis and Sporoxeia species produces a hybrid without reproductive organs
- Preliminary evaluation of a novel nine-biomarker profile for the prediction of autism spectrum disorder
- The impact of peer attachment on prosocial behavior, emotional difficulties and conduct problems in adolescence: The mediating role of empathy
- Spatial and climatic variables independently drive elevational gradients in ant species richness in the Eastern Himalaya
- What is the qualitative evidence concerning the risks, diagnosis, management and consequences of gastrointestinal infections in the community in the United Kingdom? A systematic review and meta-ethnography
- Naringenin protects AlCl3/D-galactose induced neurotoxicity in rat model of AD via attenuation of acetylcholinesterase levels and inhibition of oxidative stress
- Key barriers and enablers associated with uptake and continuation of oral pre-exposure prophylaxis (PrEP) in the public sector in Zimbabwe: Qualitative perspectives of general population clients at high risk for HIV
- Characterizing the University of California’s tenure-track teaching position from the faculty and administrator perspectives
- Restoration of Mal overcomes the defects of apoptosis in lung cancer cells
- Patient preferences for maintenance therapy in Crohn’s disease: A discrete-choice experiment
- Diagnostic performance of serum interferon gamma, matrix metalloproteinases, and periostin measurements for pulmonary tuberculosis in Japanese patients with pneumonia
- Hesperidin improves insulin resistance via down-regulation of inflammatory responses: Biochemical analysis and in silico validation
- Accuracy of intraocular lens power calculation formulas using a swept-source optical biometer
- Characterization of black patina from the Tiber River embankments using Next-Generation Sequencing
- Comparison of blood lactate and perceived exertion responses in two matched time-under-tension protocols
- Fibrin hydrogels are safe, degradable scaffolds for sub-retinal implantation
- Post-translational modifications of Drosophila melanogaster HOX protein, Sex combs reduced
- Problem gambling, associations with comorbid health conditions, substance use, and behavioural addictions: Opportunities for pathways to treatment
- Liganded T3 receptor β2 inhibits the positive feedback autoregulation of the gene for GATA2, a transcription factor critical for thyrotropin production
- Characterization of METTL16 as a cytoplasmic RNA binding protein
- Impact of long-term storage and freeze-thawing on eight circulating microRNAs in plasma samples
- Nanosheet wrapping-assisted coverslip-free imaging for looking deeper into a tissue at high resolution
- Assessment of dynamic cerebral autoregulation in humans: Is reproducibility dependent on blood pressure variability?
- Early diagnosis of sepsis in emergency departments, time to treatment, and association with mortality: An observational study
- Validity of cerebrovascular ICD-9-CM codes in healthcare administrative databases. The Umbria Data-Value Project
- Tuberculoid leprosy: An in vivo microvascular evaluation of cutaneous lesions
- Neuromuscular blockers in the acute respiratory distress syndrome: A meta-analysis
- Identification of putative Type-I sex pheromone biosynthesis-related genes expressed in the female pheromone gland of Streltzoviella insularis
- Redefining transcriptional regulation of the APOE gene and its association with Alzheimer’s disease
- Disease-relevant mutations alter amino acid co-evolution networks in the second nucleotide binding domain of CFTR
- A bushel of viruses: Identification of seventeen novel putative viruses by RNA-seq in six apple trees
- Torque teno virus viral load is related to age, CMV infection and HLA type but not to Alzheimer's disease
- The variability of bacterial communities in both the endosphere and ectosphere of different niches in Chinese chives (Allium tuberosum)
- Tripartite factors leading to molecular divergence between human and murine smooth muscle
- Characterization of dermal skin innervation in fibromyalgia syndrome
- A neonatal nonhuman primate model of gestational Zika virus infection with evidence of microencephaly, seizures and cardiomyopathy
- A scoping review of importation and predictive models related to vector-borne diseases, pathogens, reservoirs, or vectors (1999–2016)
- Assessment of climate change impact on the malaria vector Anopheles hyrcanus, West Nile disease, and incidence of melanoma in the Vojvodina Province (Serbia) using data from a regional climate model
- Associations of cigarette smoking and burden of thoracic aortic calcification in asymptomatic individuals: A dose-response relationship
- Healthcare utilization of Mexican-American Medicare beneficiaries with and without Alzheimer’s disease and related dementias
- Evaluation of questionnaire as an instrument to measure the level of nutritional and weight gain knowledge in pregnant women in Poland. A pilot study
- TranCEP: Predicting the substrate class of transmembrane transport proteins using compositional, evolutionary, and positional information
- Non-Invasive Functional-Brain-Imaging with an OPM-based Magnetoencephalography System
- Expression of acyl-CoA-binding protein 5 from Rhodnius prolixus and its inhibition by RNA interference
- Transforming assessment of speech in children with cleft palate via online crowdsourcing
- High prevalence of off-label and unlicensed paediatric prescribing in a hospital in Indonesia during the period Aug.—Oct. 2014
- General practice management of rotator cuff related shoulder pain: A reliance on ultrasound and injection guided care
- Estimating the population size of female sex workers and transgender women in Sri Lanka
- Can helmet decrease mortality of craniocerebral trauma patients in a motorcycle accident?: A propensity score matching
- Obesity, smoking habits, and serum phosphate levels predicts mortality after life-style intervention
- Treatment of children under 4 years of age with medulloblastoma and ependymoma in the HIT2000/HIT-REZ 2005 trials: Neuropsychological outcome 5 years after treatment
- Can a semi-quantitative method replace the current quantitative method for the annual screening of microalbuminuria in patients with diabetes? Diagnostic accuracy and cost-saving analysis considering the potential health burden
- A two-arm parallel double-blind randomised controlled pilot trial of the efficacy of Omega-3 polyunsaturated fatty acids for the treatment of women with endometriosis-associated pain (PurFECT1)
- Association of benzodiazepines, opioids and tricyclic antidepressants use and falls in trauma patients: Conditional effect of age
- Burden and risk factors of cutaneous leishmaniasis in a peri-urban settlement in Kenya, 2016
- Predicting strike susceptibility and collision patterns of the common buzzard at wind turbine structures in the federal state of Brandenburg, Germany
- Embryonic thermal manipulation has short and long-term effects on the development and the physiology of the Japanese quail
- High-order radiomics features based on T2 FLAIR MRI predict multiple glioma immunohistochemical features: A more precise and personalized gliomas management
- Human-raptor conflict in rural settlements of Colombia
- Regional adaptations and parallel mutations in Feline panleukopenia virus strains from China revealed by nearly-full length genome analysis
- Long-term ecological research in southern Brazil grasslands: Effects of grazing exclusion and deferred grazing on plant and arthropod communities
- Assessment of peritoneal microbial features and tumor marker levels as potential diagnostic tools for ovarian cancer
- Survival analysis of 230 patients with unresectable hepatocellular carcinoma treated with bland transarterial embolization
- Adverse drug reaction reporting practice and associated factors among medical doctors in government hospitals in Addis Ababa, Ethiopia
- TaWAK6 encoding wall-associated kinase is involved in wheat resistance to leaf rust similar to adult plant resistance
- Deficiency syndromes in top predators associated with large-scale changes in the Baltic Sea ecosystem
- The inhibitor of apoptosis proteins antagonist Debio 1143 promotes the PD-1 blockade-mediated HIV load reduction in blood and tissues of humanized mice
- Allele specific expression of Dof genes responding to hormones and abiotic stresses in sugarcane
- Perceived relative social status and cognitive load influence acceptance of unfair offers in the Ultimatum Game
- Quantitative evaluation of choriocapillaris using optical coherence tomography and optical coherence tomography angiography in patients with central serous chorioretinopathy after half-dose photodynamic therapy
- Structure-function analyses of candidate small molecule RPN13 inhibitors with antitumor properties
- Extracting lung function measurements to enhance phenotyping of chronic obstructive pulmonary disease (COPD) in an electronic health record using automated tools
- Multiple fragmented habitat-patch use in an urban breeding passerine, the Short-toed Treecreeper
- Histological and immunohistochemical characterization of the porcine ocular surface
- Household environmental tobacco smoke exposure in healthy young children in Hong Kong: Prevalence and risk factors
- Wind energy development and wildlife conservation in Lithuania: A mapping tool for conflict assessment
- Characteristics and prognosis of primary treatment-naïve oral cavity squamous cell carcinoma in Norway, a descriptive retrospective study
- Effect of epoch length on intensity classification and on accuracy of measurement under controlled conditions on treadmill: Towards a better understanding of accelerometer measurement
- Peer distribution of HIV self-test kits to men who have sex with men to identify undiagnosed HIV infection in Uganda: A pilot study
- Error rates of human reviewers during abstract screening in systematic reviews
- Faecal analyses and alimentary tracers reveal the foraging ecology of two sympatric bats
- Urethral realignment with maximal urethral length and bladder neck preservation in robot-assisted radical prostatectomy: Urinary continence recovery
- Error metrics determination in functionally approximated circuits using SAT solvers
- Spatial movement pattern recognition in soccer based on relative player movements
- A novel visual ranking system based on arterial spin labeling perfusion imaging for evaluating perfusion disturbance in patients with ischemic stroke
- Prospective Validation of the Laboratory Risk Indicator for Necrotizing Fasciitis (LRINEC) Score for Necrotizing Fasciitis of the Extremities
- The importance of transporters and cell polarization for the evaluation of human stem cell-derived hepatic cells
- Incidence, trends, and outcomes of infection sites among hospitalizations of sepsis: A nationwide study
- Morphological and functional characteristics of mitral annular calcification and their relationship to stroke
- And the nominees are: Using design-awards datasets to build computational aesthetic evaluation model
- Service delivery interventions to increase uptake of voluntary medical male circumcision for HIV prevention: A systematic review
- Multidimensional Scales of Perceived Self-Efficacy (MSPSE): Measurement invariance across Italian and Colombian adolescents
- Diversity of Mycobacteriaceae from aquatic environment at the São Paulo Zoological Park Foundation in Brazil
- A graph-based algorithm for RNA-seq data normalization
- Parents’ underestimation of their child’s weight status. Moderating factors and change over time: A cross-sectional study
- Pharmacokinetics, absolute bioavailability and tolerability of ketamine after intranasal administration to dexmedetomidine sedated dogs
- Spatial variation in fertilizer prices in Sub-Saharan Africa
- Knowledge, beliefs, and concerns about bone health from a systematic review and metasynthesis of qualitative studies
- Successful isolation of Treponema pallidum strains from patients’ cryopreserved ulcer exudate using the rabbit model
- Effects of size and elasticity on the relation between flow velocity and wall shear stress in side-wall aneurysms: A lattice Boltzmann-based computer simulation study
- Pupil response to noxious corneal stimulation
- Incidence, risk factors and healthcare costs of central line-associated nosocomial bloodstream infections in hematologic and oncologic patients
- The impact of computed radiography and teleradiology on patients’ diagnosis and treatment in Mweso, the Democratic Republic of Congo
- Differential effects of synthetic psychoactive cathinones and amphetamine stimulants on the gut microbiome in mice
- Hepatitis B and C virus infection among HIV patients within the public and private healthcare systems in Chile: A cross-sectional serosurvey
- Increased episodes of aspiration on videofluoroscopic swallow study in children with nasogastric tube placement
- Obstructive sleep apnea and hypopnea syndrome in patients admitted in a tertiary hospital in Cameroon: Prevalence and associated factors
- Association of single nucleotide polymorphisms with dyslipidemia in antiretroviral exposed HIV patients in a Ghanaian population: A case-control study
- Sonic Hedgehog upregulation does not enhance the survival and engraftment of stem cell-derived cardiomyocytes in infarcted hearts
- The pharmacokinetic parameters and the effect of a single and repeated doses of memantine on gastric myoelectric activity in experimental pigs
- Blind method for discovering number of clusters in multidimensional datasets by regression on linkage hierarchies generated from random data
- Predictive factors of first dosage intravenous immunoglobulin-related adverse effects in children
- Description and characterization of the artisanal elasmobranch fishery on Guatemala’s Caribbean coast
- Individual and community level determinants of short birth interval in Ethiopia: A multilevel analysis
- Effects of rejection intensity and rejection sensitivity on social approach behavior in women
- The impact of IoT security labelling on consumer product choice and willingness to pay
- The development and validation of a measurement instrument to investigate determinants of health care utilisation for low back pain in Ethiopia
- Validity of the French version of the Autonomy Preference Index and its adaptation for patients with advanced cancer
- The epidemiological characteristics and spatio-temporal analysis of childhood hand, foot and mouth disease in Korea, 2011-2017
- Exponential random graph model parameter estimation for very large directed networks
- The implementation of community-based diabetes and hypertension management care program in Indonesia
- Effect of temperature variation on hospital admissions and outcomes in dogs with myxomatous mitral valve disease and new onset pulmonary edema
- The development of the Police Practices Scale: Understanding policing approaches towards street-based female sex workers in a U.S. City
- A capability approach to assess aquaculture sustainability standard compliance
- Pre-collecting lymphatic vessels form detours following obstruction of lymphatic flow and function as collecting lymphatic vessels
- Construct validity and reliability of the Talent Development Environment Questionnaire in Caribbean youth track and field athletes
- Optimization of cytotoxic activity of Nocardia sp culture broths using a design of experiments
- Tissue-resident macrophages can be generated de novo in adult human skin from resident progenitor cells during substance P-mediated neurogenic inflammation ex vivo
- Microbiota in foods from Inuit traditional hunting
- Investigating Italian disinformation spreading on Twitter in the context of 2019 European elections
- In vivo expression of peptidylarginine deiminase in Drosophila melanogaster
- Modelling zero-truncated overdispersed antenatal health care count data of women in Bangladesh
- Detection and density of breeding marsh birds in Iowa wetlands
- A lineage-specific rapid diagnostic test (Chagas Sero K-SeT) identifies Brazilian Trypanosoma cruzi II/V/VI reservoir hosts among diverse mammalian orders
- Aromatase deficiency in hematopoietic cells improves glucose tolerance in male mice through skeletal muscle-specific effects
- If host is refractory, insistent parasite goes berserk: Trypanosomatid Blastocrithidia raabei in the dock bug Coreus marginatus
- Antimicrobial resistance patterns and molecular resistance markers of Campylobacter jejuni isolates from human diarrheal cases
- Protective role of brain derived neurotrophic factor (BDNF) in obstructive sleep apnea syndrome (OSAS) patients
- An IL-18-centered inflammatory network as a biomarker for cerebral white matter injury
- Prevalence of antiphospholipid antibodies in Behçet's disease: A systematic review and meta-analysis
- Chemical analysis of snus products from the United States and northern Europe
- Effect of prednisolone on glyoxalase 1 in an inbred mouse model of aristolochic acid nephropathy using a proteomics method with fluorogenic derivatization-liquid chromatography-tandem mass spectrometry
- Impact of early-onset persistent stunting on cognitive development at 5 years of age: Results from a multi-country cohort study
- Aggregation of CAT tails blocks their degradation and causes proteotoxicity in S. cerevisiae
- Expression of concern: Compensatory increase of transglutaminase 2 is responsible for resistance to mTOR inhibitor treatment
- Common mental illness among epilepsy patients in Bahir Dar city, Ethiopia: A cross-sectional study
- Staging dementia based on caregiver reported patient symptoms: Implications from a latent class analysis
- Health-related quality of life and its determinants among ambulatory patients with epilepsy at Ambo General Hospital, Ethiopia: Using WHOQOL-BREF
- In silico analysis and high-risk pathogenic phenotype predictions of non-synonymous single nucleotide polymorphisms in human Crystallin beta A4 gene associated with congenital cataract
- Fungal diversity in canopy soil of silver beech, Nothofagus menziesii (Nothofagaceae)
- Referral decisions and its predictors related to orthopaedic care. A retrospective study in a novel primary care setting
- Readiness to prescribe: Using educational design to untie the Gordian Knot
- Influence of gelation on the retention of purple cactus pear extract in microencapsulated double emulsions
- Factors related to met needs for rehabilitation 6 years after stroke
- Association of cataract and sun exposure in geographically diverse populations of India: The CASE study. First Report of the ICMR-EYE SEE Study Group
- Investigation of injury severity in urban expressway crashes: A case study from Beijing
- Clinical outcomes of incident peritoneal dialysis patients coming from kidney transplantation program: A case-control study
- Evaluation of the factors influencing the housing safety awareness of residents in Shanghai
- Morphometric study of the diaphragmatic surface of the liver in the human fetus
- Food insecurity and dietary diversity among lactating mothers in the urban municipality in the mountains of Nepal
- Genetic characterization of Bacillus anthracis strains circulating in Italy from 1972 to 2018
- Promising antifungal activity of new oxadiazole against Candida krusei
- An atlas of personality, emotion and behaviour
- Long-term effects of intracranial islet grafting on cognitive functioning in a rat metabolic model of sporadic Alzheimer's disease-like dementia
- Compartmentalized profiling of amniotic fluid cytokines in women with preterm labor
- Comparison of the myometrial transcriptome from singleton and twin pregnancies by RNA-Seq
- Adverse reproductive effects of S100A9 on bovine sperm and early embryonic development in vitro
- Functional dynamics of bacterial species in the mouse gut microbiome revealed by metagenomic and metatranscriptomic analyses
- Astrocyte senescence promotes glutamate toxicity in cortical neurons
- Primary ciliary dyskinesia and psychological well-being in adolescence
- Dipeptidyl peptidase-4 is increased in the abdominal aortic aneurysm vessel wall and is associated with aneurysm disease processes
- Primary care physician knowledge, attitudes, and diagnostic testing practices for norovirus and acute gastroenteritis
- Microfluidic-prepared DOTAP nanoparticles induce strong T-cell responses in mice
- Intraocular scattering as a predictor of driving performance in older adults with cataracts
- Reduced bone mineral density among HIV infected patients on anti-retroviral therapy in Blantyre, Malawi: Prevalence and associated factors
- Correction: Extraversion personality, perceived health and activity participation among community-dwelling aging adults in Hong Kong
- A rainwater control optimization design approach for airports based on a self-organizing feature map neural network model
- Influence of inflammasome NLRP3, and IL1B and IL2 gene polymorphisms in periodontitis susceptibility
- 18F-FDG-PET/MRI in the diagnostic work-up of limbic encephalitis
- The socioeconomic impact of orthopaedic trauma: A systematic review and meta-analysis
- Treatment patterns among patients with moderate-to-severe ulcerative colitis in the United States and Europe
- City to city learning and knowledge exchange for climate resilience in southern Africa
- Nuclear translocation of Atox1 potentiates activin A-induced cell migration and colony formation in colon cancer
- Activity-dependent switches between dynamic regimes of extracellular matrix expression
- Molecular sequencing and morphological identification reveal similar patterns in native bee communities across public and private grasslands of eastern North Dakota
- A mathematical model for assessing the effectiveness of controlling relapse in Plasmodium vivax malaria endemic in the Republic of Korea
- Cryo-focused ion beam preparation of perovskite based solar cells for atom probe tomography
- Physiological and transcriptomic responses of Lanzhou Lily (Lilium davidii, var. unicolor) to cold stress
- Unusual genome expansion and transcription suppression in ectomycorrhizal Tricholoma matsutake by insertions of transposable elements
- Estimating associations between antidepressant use and incident mild cognitive impairment in older adults with depression
- The use of telephone communication between nurse navigators and their patients
- CNP mediated selective toxicity on melanoma cells is accompanied by mitochondrial dysfunction
- HIV RNA measurement in dried blood spots of HIV-infected patients in Thailand using Abbott m2000 system
- Retraction: Oncogenic Fibulin-5 Promotes Nasopharyngeal Carcinoma Cell Metastasis through the FLJ10540/AKT Pathway and Correlates with Poor Prognosis
- Ultra-rapid cooling of ibex sperm by spheres method does not induce a vitreous extracellular state and increases the membrane damages
- Some animals are more equal than others: Validation of a new scale to measure how attitudes to animals depend on species and human purpose of use
- Observation and quantification of the morphological effect of trypan blue rupturing dead or dying cells
- The visual perception of emotion from masks
- Hexavalent chromium removal and total chromium biosorption from aqueous solution by Quercus crassipes acorn shell in a continuous up-flow fixed-bed column: Influencing parameters, kinetics, and mechanism
- The predictive value of anthropometric indices for cardiometabolic risk factors in Chinese children and adolescents: A national multicenter school-based study
- Lean back and wait for the alarm? Testing an automated alarm system for nosocomial outbreaks to provide support for infection control professionals
- Regional disparities in health care resources in traditional Chinese medicine county hospitals in China
- Analysis on hydraulic characteristics of improved sandy soil with soft rock
- Development and use of a scale to assess gender differences in appraisal of mistreatment during childbirth among Ethiopian midwifery students
- Factors for starting biosimilar TNF inhibitors in patients with rheumatic diseases in the real world
- Correction: Force field generalization and the internal representation of motor learning
- Prevalence and foetomaternal effects of iron deficiency anaemia among pregnant women in Lagos, Nigeria
- Socioeconomic risk factors for fatal opioid overdoses in the United States: Findings from the Mortality Disparities in American Communities Study (MDAC)
- Microbiome signatures in neonatal central line associated bloodstream infections
- Interventions for incarcerated adults with opioid use disorder in the United States: A systematic review with a focus on social determinants of health
- Opening gap width influences distal tibial rotation below the osteotomy site following open wedge high tibial osteotomy
- The impact of lowbush blueberry (Vaccinium angustifolium Ait.) and cranberry (Vaccinium macrocarpon Ait.) pollination on honey bee (Apis mellifera L.) colony health status
- Surveys of knowledge and awareness of antibiotic use and antimicrobial resistance in general population: A systematic review
- Managerial capacity among district health managers and its association with district performance: A comparative descriptive study of six districts in the Eastern Region of Ghana
- Knee joint distraction in regular care for treatment of knee osteoarthritis: A comparison with clinical trial data
- Reconstruction of a regulated two-cell metabolic model to study biohydrogen production in a diazotrophic cyanobacterium Anabaena variabilis ATCC 29413
- Cochlear dysfunction is associated with styrene exposure in humans
- Intra-individual variation of particles in exhaled air and of the contents of Surfactant protein A and albumin
- Revisits, readmissions, and outcomes for pediatric traumatic brain injury in California, 2005-2014
- Enhanced handover mechanism using mobility prediction in wireless networks
- Association between regular exercise and asthma control among adults: The population-based Northern Finnish Asthma Study
- Pharyngeal microbiome alterations during Neisseria gonorrhoeae infection
- Assessment of the clinical utility of four NGS panels in myeloid malignancies. Suggestions for NGS panel choice or design
- Assessment of time management practice and associated factors among primary hospitals employees in north Gondar, northwest Ethiopia
- Genetic diversity and population structure of feral rapeseed (Brassica napus L.) in Japan
- Are the current gRNA ranking prediction algorithms useful for genome editing in plants?
- Difference between physical therapist estimation and psychological patient-reported outcome measures in patients with low back pain
- Heterogeneity in the distribution of 159 drug-response related SNPs in world populations and their genetic relatedness
- Metabolic and lipidomic profiling of steatotic human livers during ex situ normothermic machine perfusion guides resuscitation strategies
- Investigating cumulative effects of pre-performance routine interventions in beach volleyball serving
- Dispensing of antibiotics without prescription and associated factors in drug retail outlets of Eritrea: A simulated client method
- MicroRNA expression and DNA methylation profiles do not distinguish between primary and recurrent well-differentiated liposarcoma
- Assessment of acyl-CoA cholesterol acyltransferase (ACAT-1) role in ovarian cancer progression—An in vitro study
- Cytoplasmic factories, virus assembly, and DNA replication kinetics collectively constrain the formation of poxvirus recombinants
- The wavelet power spectrum of perfusion weighted MRI correlates with tumor vascularity in biopsy-proven glioblastoma samples
- Agreement between cardiovascular disease risk assessment tools: An application to the United Arab Emirates population
- Constructing HLM to examine multi-level poverty-contributing factors of farmer households: Why and how?
- Patterns of symptoms possibly indicative of cancer and associated help-seeking behaviour in a large sample of United Kingdom residents—The USEFUL study
- An automated alarm system for food safety by using electronic invoices
- Neural effects of acute stress on appetite: A magnetoencephalography study
- Use of magnetic resonance imaging to determine laterality of meniscal size in healthy volunteers
- Co-prevalence of extracranial carotid aneurysms differs between European intracranial aneurysm cohorts
- Thermal biology of two tropical lizards from the Ecuadorian Andes and their vulnerability to climate change
- When weight is an encumbrance; avoidance of stairs by different demographic groups
- Non-mycosis fungoides cutaneous lymphomas in a referral center in Taiwan: A retrospective case series and literature review
- From the host's point of view: Effects of variation in burying beetle brood care and brood size on the interaction with parasitic mites
- Kernel-based Gaussian process for anomaly detection in sparse gamma-ray data
- Unmet care needs of children with ADHD
- Accelerometer-assessed outdoor physical activity is associated with meteorological conditions among older adults: Cross-sectional results from the OUTDOOR ACTIVE study
- Identification of Korean cancer survivors’ unmet needs and desired psychosocial assistance: A focus group study
- Evaluation of inactivated Bordetella pertussis as a delivery system for the immunization of mice with Pneumococcal Surface Antigen A
- The role of moral reasoning & personality in explaining lyrical preferences
- Would you like to participate in this trial? The practice of informed consent in intrapartum research in the last 30 years
- Correction: Mutation spectrums of TSC1 and TSC2 in Chinese women with lymphangioleiomyomatosis (LAM)
- Forward lunge before and after anterior cruciate ligament reconstruction: Faster movement but unchanged knee joint biomechanics
- Challenges associated with homologous directed repair using CRISPR-Cas9 and TALEN to edit the DMD genetic mutation in canine Duchenne muscular dystrophy
- Integrated targeted serum metabolomic profile and its association with gender, age, disease severity, and pattern identification in acne
- A prospective case-control study on miRNA circulating levels in subjects born small for gestational age (SGA) evaluated from childhood into young adulthood
- Polymer-fiber-coupled field-effect sensors for label-free deep brain recordings
- Global depth perception alters local timing sensitivity
- How to detect a polytrauma patient at risk of complications: A validation and database analysis of four published scales
- Module for SWC neuron morphology file validation and correction enabled for high throughput batch processing
- Reduced gray matter volume and cortical thickness associated with traffic-related air pollution in a longitudinally studied pediatric cohort
- Recombinant human soluble thrombomodulin is associated with attenuation of sepsis-induced renal impairment by inhibition of extracellular histone release
- Human and climatic drivers affect spatial fishing patterns in a multiple-use marine protected area: The Galapagos Marine Reserve
- Correction: Leisure-time physical activity and sports in the Brazilian population: A social disparity analysis
- Application of the mixture item response theory model to the Self-Administered Food Security Survey Module for Children
- Numerical simulation of atmospheric CO2 concentration and flux over the Korean Peninsula using WRF-VPRM model during Korus-AQ 2016 campaign
- Feline irradiated diet-induced demyelination; a model of the neuropathology of sub-acute combined degeneration?
- Improved multi-parametric prediction of tissue outcome in acute ischemic stroke patients using spatial features
- Genome-wide association and epistatic interactions of flowering time in soybean cultivar
- Correction: Association between workplace bullying and burnout, professional quality of life, and turnover intention among clinical nurses
- Correction: Estimation of membrane bending modulus of stiffness tuned human red blood cells from micropore filtration studies
- Correction: Limited indirect effects of an infant pneumococcal vaccination program in an aging population
- Correction: Targeting of the Plzf Gene in the Rat by Transcription Activator-Like Effector Nuclease Results in Caudal Regression Syndrome in Spontaneously Hypertensive Rats
- Fieldwork-based determination of design priorities for point-of-use drinking water quality sensors for use in resource-limited environments
- Young women’s reproductive health conversations: Roles of maternal figures and clinical practices
- Correction: Differential recordings of local field potential: A genuine tool to quantify functional connectivity
- Survival of medial versus lateral unicompartmental knee arthroplasty: A meta-analysis
- Novel MscL agonists that allow multiple antibiotics cytoplasmic access activate the channel through a common binding site
- Is it time to stop sweeping data cleaning under the carpet? A novel algorithm for outlier management in growth data
- Changes in oak (Quercus robur) photosynthesis after winter moth (Operophtera brumata) herbivory are not explained by changes in chemical or structural leaf traits
- Mutual interaction between motor cortex activation and pain in fibromyalgia: EEG-fNIRS study
- Evaluation of liposomal ciprofloxacin formulations in a murine model of anthrax
- Analysis of cholesterol in mouse brain by HPLC with UV detection
- Sugar, amino acid and inorganic ion profiling of the honeydew from different hemipteran species feeding on Abies alba and Picea abies
- Exploring prior diseases associated with incident late-onset Alzheimer’s disease dementia
- Hypertension prevalence in patients attending tertiary pain management services, a registry-based Australian cohort study
- SRL pathogenicity island contributes to the metabolism of D-aspartate via an aspartate racemase in Shigella flexneri YSH6000
- Correction: Comprehensive genome-wide analysis of the pear (Pyrus bretschneideri) laccase gene (PbLAC) family and functional identification of PbLAC1 involved in lignin biosynthesis
- Epilepsy in a melanocyte-lineage mTOR hyperactivation mouse model: A novel epilepsy model
- Water consumption and prevalence of irritable bowel syndrome among adults
- Mixed evidence for the relationship between periodontitis and Alzheimer’s disease: A bidirectional Mendelian randomization study
- Correction: Health conditions associated with overweight in climacteric women
- Correction: Determining Glomerular Filtration Rate in Homozygous Sickle Cell Disease: Utility of Serum Creatinine Based Estimating Equations
- Modelling the number of antenatal care visits in Bangladesh to determine the risk factors for reduced antenatal care attendance
- Correction: Cumulative viral load as a predictor of CD4+ T-cell response to antiretroviral therapy using Bayesian statistical models
- Dominant negative effects by inactive Spa47 mutants inhibit T3SS function and Shigella virulence
- ICOS-deficient and ICOS YF mutant mice fail to control Toxoplasma gondii infection of the brain
- Diel patterns in swimming behavior of a vertically migrating deepwater shark, the bluntnose sixgill (Hexanchus griseus)
- Life history of northern Gulf of Mexico Warsaw grouper Hyporthodus nigritus inferred from otolith radiocarbon analysis
- Physiology education for intensive care medicine residents: A 15-minute interactive peer-led flipped classroom session
- Strengthening capacity for natural sciences research: A qualitative assessment to identify good practices, capacity gaps and investment priorities in African research institutions
- Systematic scoping review of the concept of ‘genetic identity’ and its relevance for germline modification
- Height of overburden fracture based on key strata theory in longwall face
- Laboratory strains of Bacillus anthracis lose their ability to rapidly grow and sporulate compared to wildlife outbreak strains
- Improvement of classification performance of Parkinson’s disease using shape features for machine learning on dopamine transporter single photon emission computed tomography
- Comparative pharmacokinetics and pharmacodynamics of the advanced Retinol-Binding Protein 4 antagonist in dog and cynomolgus monkey
- Correction: A handy method to remove bacterial contamination from fungal cultures
- Correction: Effect of statin on life prognosis in Japanese patients undergoing hemodialysis
- Retraction: Outer Membrane Protein A (OmpA) of Shigella flexneri 2a Induces TLR2-Mediated Activation of B Cells: Involvement of Protein Tyrosine Kinase, ERK and NF-κB
- Retraction: Biofabrication of streptomycin-conjugated calcium phosphate nanoparticles using red ginseng extract and investigation of their antibacterial potential
- Receiver operating characteristic curve analysis of clinical signs for screening of convergence insufficiency in young adults
- Correction: Drivers of deforestation in the basin of the Usumacinta River: Inference on process from pattern analysis using generalised additive models
- Efficacy of fertilizing method for different potash sources in cotton (Gossypium hirsutum L.) nutrition under arid climatic conditions
- Podocyte autophagy is associated with foot process effacement and proteinuria in patients with minimal change nephrotic syndrome
- Effect of Lactobacillus acidophilus D2/CSL (CECT 4529) supplementation in drinking water on chicken crop and caeca microbiome
- Retraction: MiR-30a-5p Antisense Oligonucleotide Suppresses Glioma Cell Growth by Targeting SEPT7
- Correction: Dynamics of plasma micronutrient concentrations and their correlation with serum proteins and thyroid hormones in patients with paracoccidioidomycosis
- Impact of lower limb osteoarthritis on health-related quality of life: A cross-sectional study to estimate the expressed loss of utility in the Spanish population
- Correction: Prevalence of damaged and missing teeth among women in the southern plains of Nepal: Findings of a simplified assessment tool
- Correction: Tissue-Specific Expressed Antibody Variable Gene Repertoires
- Retraction: Immunoglobulin G Expression in Lung Cancer and Its Effects on Metastasis
- Correction: Causal knowledge promotes behavioral self-regulation: An example using climate change dynamics
- Retraction: Use of Granulocyte Colony-Stimulating Factor for the Treatment of Thin Endometrium in Experimental Rats
- Correction: Dynamic mechanical and nanofibrous topological combinatory cues designed for periodontal ligament engineering
- Correction: Evaluating the foundations that help avert antimicrobial resistance: Performance of essential water sanitation and hygiene functions in hospitals and requirements for action in Kenya
- From seed to flour: Sowing sustainability in the use of cantaloupe melon residue (Cucumis melo L. var. reticulatus)
- Core Scientific Dataset Model: A lightweight and portable model and file format for multi-dimensional scientific data
- Accounting for measurement error to assess the effect of air pollution on omic signals
- Leucine zipper transcription factor-like 1 binds adaptor protein complex-1 and 2 and participates in trafficking of transferrin receptor 1
- Barriers for tuberculosis case finding in Southwest Ethiopia: A qualitative study
- Genetic predisposition to celiac disease in Kazakhstan: Potential impact on the clinical practice in Central Asia
- A lower psoas muscle volume was associated with a higher rate of recurrence in male clear cell renal cell carcinoma
- Two angles of overqualification-the deviant behavior and creative performance: The role of career and survival job
- Cost-utility analysis of de-escalating biological disease-modifying anti-rheumatic drugs in patients with rheumatoid arthritis
- Efficient estimation of stereo thresholds: What slope should be assumed for the psychometric function?
- Learning efficient haptic shape exploration with a rigid tactile sensor array
- Effects of dietary supplementation with a microalga (Schizochytrium sp.) on the hemato-immunological, and intestinal histological parameters and gut microbiota of Nile tilapia in net cages
- Regional versus local wind speed and direction at a narrow beach with a high and steep foredune
- Fragmented QRS complex in patients with systemic lupus erythematosus at the time of diagnosis and its relationship with disease activity
- Severe thiamine deficiency in eastern Baltic cod (Gadus morhua)
- Transfer entropy as a variable selection methodology of cryptocurrencies in the framework of a high dimensional predictive model
- Psychometric validation of Czech version of the Sport Motivation Scale
- Correction: Multiple innate antibacterial immune defense elements are correlated in diverse ungulate species
- Recognition of personality disorder and anxiety disorder comorbidity in patients treated for depression in secondary psychiatric care
- Correction: Strategies for achieving high sequencing accuracy for low diversity samples and avoiding sample bleeding using illumina platform
- PLOS One
- Archiv čísel
- Aktuální číslo
- Informace o časopisu
Nejčtenější v tomto čísle- Severity of misophonia symptoms is associated with worse cognitive control when exposed to misophonia trigger sounds
- Chemical analysis of snus products from the United States and northern Europe
- Calcium dobesilate reduces VEGF signaling by interfering with heparan sulfate binding site and protects from vascular complications in diabetic mice
- Effect of Lactobacillus acidophilus D2/CSL (CECT 4529) supplementation in drinking water on chicken crop and caeca microbiome
Kurzy
Zvyšte si kvalifikaci online z pohodlí domova
Revma Focus: Spondyloartritidy
nový kurz
Autoři: doc. MUDr. Norbert Pauk, Ph.D.
Autoři: prof. MUDr. Vladimír Palička, CSc., Dr.h.c., doc. MUDr. Václav Vyskočil, Ph.D., MUDr. Petr Kasalický, CSc., MUDr. Jan Rosa, Ing. Pavel Havlík, Ing. Jan Adam, Hana Hejnová, DiS., Jana Křenková
Autoři: MUDr. Irena Krčmová, CSc.
Všechny kurzyPřihlášení#ADS_BOTTOM_SCRIPTS#Zapomenuté hesloZadejte e-mailovou adresu, se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.
- Vzdělávání