-
Články
- Vzdělávání
- Časopisy
Top články
Nové číslo
- Témata
- Kongresy
- Videa
- Podcasty
Nové podcasty
Reklama- Kariéra
Doporučené pozice
Reklama- Praxe
Digging the diversity of Iberian bait worms Marphysa (Annelida, Eunicidae)
Authors: Daniel Martin aff001; João Gil aff002; Joana Zanol aff003; Miguel A. Meca aff001; Rocío Pérez Portela aff005
Authors place of work: Center for Advanced Studies of Blanes (CEAB–CSIC), Blanes, Catalunya, Spain aff001; Centre of Marine Sciences, CCMAR, University of Algarve, Campus de Gambelas, Faro, Portugal aff002; Universidade Federal do Rio de Janeiro, Museu Nacional, Departamento de Invertebrados, Rio de Janeiro, Brazil aff003; Department of Natural History, University Museum of Bergen, University of Bergen, Bergen, Norway aff004; Rosenstiel School of Marine & Atmospheric Science, University of Miami, Miami, Florida, United States of America aff005
Published in the journal: PLoS ONE 15(1)
Category: Research Article
doi: https://doi.org/10.1371/journal.pone.0226749Summary
During a visit to polychaete–rearing facilities in the vicinity of Bay of Cádiz (SW Iberian Peninsula, Atlantic Ocean), we sampled two populations of Marphysa (Annelida, Eunicidae) originally occurring at nearby intertidal soft bottoms, one being more than twice as long as the other at the same age. We analysed them using partial sequences of two mitochondrial genes, 16S rDNA and Cytochrome Oxidase I, and classical morphological observations. Our molecular results confirmed that the two populations corresponded to two different species, with PTP species delimitation values ranging from 0.973 (long–bodied species) to 0.999 (short–bodied species). Morphologically, the short–bodied species resembles the recently redescribed M. sanguinea (Montagu, 1813), but differs mainly in having some parapodia with two subacicular hooks (one bidentate and one unidentate) and three types of pectinate chaetae, Two isodont present all along the body, and one particularly large anodont asymmetric appearing only from mid–posterior parapodia. The long–bodied species resembles Marphysa aegypti Elgetany, El-Ghobashy, Ghoneim and Struck, 2018 both in size and in having very robust, unidentate subacicular hooks (single in most parapodia, two–both similar in size and form–in some posterior parapodia), but differs, among other features, in the maxillary formula, the number of acicula per parapodia and the number and shape of pectinate chaetae. Accordingly, we are here fully illustrating and formally describing the two Iberian populations as Marphysa gaditana sp. nov. (short–bodied) and Marphysa chirigota sp. nov. (long–bodied) and we are emending the description of M. aegypti based on our revision of the type material. Also, we discuss on the distribution of the species of the sanguinea–group and on the relevancy of taxonomically robust studies when dealing with species of commercial interest having the potential of being globally spread through human activities, as well as on the misunderstandings caused by the incorrect use of the “cosmopolitan species” concept.
Keywords:
Phylogenetic analysis – Teeth – Dentition – mandible – Animal antennae – Invasive species – Species delimitation – New species reports
Introduction
In addition to the intrinsic interest of the annelid polychaetes as ubiquitous and highly abundant members of virtually all marine benthic ecosystems, some of them are increasingly exploited commercially. There is a growing demand of these organisms as fishing baits and, thus, they are being harvested all around the world as an integral part of global coastal life [1, 2], including Europe [3–5]. They have also been introduced in integrated polycultures to contribute managing organic matter and wastes produced by bivalves and fish [6], and are a natural source of proteins and omega–3 fatty acids so that they can be used as a nutritional resource and maturation diet in crustacean and fish aquaculture [1, 7, 8]. Therefore, in addition to the impacts of traditional bait harvesting [9], new mechanized methods of collection are being developed to increase efficiency, productivity and revenue [10, 11]. Thus, we may only expect further impacts and native habitat deterioration, as well as a greater pressure on their wild stocks. Importing allochthonous species is a well–established alternative to exploiting local populations. However, this transfers the harvesting impact to the often remote areas where baits are collected. Also, this may lead to accidental introductions (even to invasions) whether some viable specimens manage to escape from fishing hooks or are directly released into the wild by anglers at the end of their fishing journey [12, 13]. A more environmentally friendly alternative is rearing autochthonous species, although the number of feasible initiatives is still very low (e.g., [4, 14]). Nevertheless, these activities may also entail the destruction of local habitats either when implementing the facilities or during the routine functioning activities. On the other hand, culturing allochthonous species must be disregarded and discouraged due to the implicit risks of accidental releasing of living specimens that would directly impact the wild surroundings.
So far, no commercial polychaete aquaculture initiatives have been successfully implemented in the Iberian Peninsula. There were some attempts by researchers from the “Grupo de Ecología” of the “Universidad de Cantabria”, in cooperation with the company TEICAN Mediambiental SL. Also, the Institute of Marine Sciences of Andalucía (ICMAN), in cooperation with the private companies “Comercial de Cebos para la Pesca S.L” and SEAPRTNERS, attempted to develop cultures of supposedly Marphysa sanguinea (Montagu, 1813) [15] based on their relatively abundant, autochthonous populations in the Bay of Cádiz (SW Atlantic coasts of the Iberian Peninsula) [16–18]. The present work resulted from a visit of DM and JG to the facilities built during an initial phase of the project developed at the Bay of Cádiz.
The genus Marphysa Quatrefages, 1866 [19] is a typical Eunicidae (Annelida, Eunicida), a family that currently comprises 71 nominal species [20]. They are free–living, tubicolous or burrowing polychaetes inhabiting a wide range of habitats, from soft sediments to rocky grounds, typically in warm and temperate waters. Bathymetrically, they occur mainly from intertidal to shallow subtidal depths, while the few species described from shelf to bathyal depths are generally poorly known and thus need further revision. Many intertidal species are a valuable biological and economical resource, widely used and highly appreciated as fishing baits for many decades in the Iberian Peninsula [13], but also elsewhere [3, 21–34], being commonly known with the vernacular names of “rosca” or “gusana de sangre” in Spanish, or “blood worm”, “rock worm” or “clam worm” in English. This includes the type species, M. sanguinea, originally described from Devon, UK and recently redescribed based on a neotype from a nearby locality [29, 35, 36].
During our visit to the polychaete–rearing facilities at Bay of Cádiz, we realised that the native populations of Marphysa originally collected from nearby intertidal soft-bottoms and designated by local fishermen as “sand” and “mud” Marphysa (according to their original habitats), clearly represented two different morphotypes. In spite of having being reared under the same environmental conditions, the adults of the former were more than twice longer and much more active than the latter at the same age.
We hypothesized initially that the short–bodied population corresponded to M. sanguinea, which has been widely reported in the Iberian Peninsula [37], while the other could represent an undescribed species. To resolve this question, we analysed specimens from both populations by using partial sequences of the mitochondrial genes 16S rDNA (hereafter 16S) and Cytochrome Oxidase I (COI), as well as classical morphological observations. As a result, both south Iberian morphotypes are here described as species new to science. Both species are compared with the most similar ones, including Marphysa aegypti Elgetany, El-Ghobashy, Ghoneim and Struck, 2018 [31], whose description is emended based on our revision of the type material. We finally discuss on the distribution of the species of the sanguinea–group and on the relevancy of taxonomically robust studies when dealing with species of commercial interest having the potential of being spread globally.
Material and methods
Collection
Samples were originally collected by professional fishermen in intertidal shores of the Natural Park of the Bay of Cádiz (SW Iberian Peninsula) and transported to isolated polychaete–rearing facilities located at the San Ramón saltworks (Chiclana de la Frontera, Spain). Within the frame of an agreement between “Comercial de Cebos para la Pesca” and the Institute of Marine Sciences of Andalucía (ICMAN-CSIC), the specimens studied herein were collected by hand digging at the rearing facilities on the 10th of May 2011. For morphological observations, the specimens were gently relaxed prior to being fixed in a buffered 10% seawater/formaldehyde solution and then transferred to 70% ethanol. For molecular purposes, fragments of the specimens obtained by natural autotomy of posterior ends were directly preserved in absolute ethanol and kept in the dark at -20°C.
DNA extraction, amplification and sequencing
Total DNA was extracted from small body wall pieces using REDExtract–N–Amp kit (Sigma Aldrich, www.sigma.com) and DNAeasy Tissue Kit (Qiagen) for 16S and COI genes, respectively, following the manufacturer’s protocol. REDExtract–N–Amp kit DNA extractions were diluted (1/6) in ultrapure Millipore water before using them for PCR amplification of fragments of the mitochondrial gene 16S. We amplified 826 bp of 16S and 660–700 bp of COI. We used primers designed in this study with the software Primer3 v 0.4.0 [38] for the 16S: Mar_16SF 5’ GTGAGCTGATCTTTACTTGC 3’ and Mar_16SR 5’ GCTCTGGAGGAAGATTAGTC 3’. For COI, we used the primers polyLCO 5’ GAYTATWTTCAACAAATCATAAAGATATTGG 3’ and polyHCO 5’ TAMACTTCWGGGTGACCAAARAATCA 3’ [39]. For 16S, PCR amplification reactions were performed in a 20 μL total reaction volume with 10 μL of REDEXtract–N–ampl PCR reaction mix (Sigma Aldrich), 0.8 μL of each primer (10 μM), 7.4 μL of ultrapure water, and 1 μL of DNA diluted template in the case of 16S. For COI PCR reactions were performed in a 25 μL total reaction volume with 2.5 μL of NH4 No MgCl2 Bioline Reaction Buffer (10X), 0.5 μL of MgCl2 (50 mM), 1 μL of nucleotide mix (10 mM each dNTP), 0.8 μL of each primer (10 μM), 0.15 μL of BIOTAQ DNA polymerase (5 U/μL, Bioline), 1 μL of template DNA and 17.25 μL of nuclease–free water. The PCR temperature profile for 16S was as follows: a first step at 95°C for 5 min, followed by 35 cycles at 94°C for 1 min + 42°C for 1 min + 72°C for 1 min, and a final step of 72°C for 5 min. For COI: a first step at 94°C for 10 min, followed by 5 cycles at 94°C for 40 sec + 44°C for 40 sec + 72°C for 1 min, 35 cycles at 94°C for 40 sec + 51°C for 40 sec + 72°C for 1 min, and a final step of 72°C for 5 min. Agarose gel electrophoresis were used to visualise PCR products and to confirm fragment amplifications. Successful amplifications were purified and sequenced in both directions (forward and reverse) by Macrogen, Inc. (Seoul, Korea) with the same primers used in amplifications.
Additional sequences belonging to other Marphysa species, together with other genera of Eunicidae and one Onuphidae, were obtained from GenBank (Table 1). Sequences of 16S rDNA were edited using Geneious vs. R8 and aligned along with GenBank sequences using the Q–INS–I option of MAFFT v.7 [40] and manually adjusted. COI sequences were edited using BioEdit v. 7.0.5.3 software [41], translated into aminoacids and aligned by hand together with GenBank additional sequences in Mesquite v.3.6 [42].
Tab. 1. Species and sequences included in the molecular analyses. Species delimitation
To explore the potential clustering of our samples to other Marphysa species, we reconstructed phylogenetic trees for both markers separately, including sequences of Marphysa available in GenBank (NCBI), of published studies or thesis that authors had access to, and of six outgroup taxa (five of other genera of Eunicidae and one Onuphidae) (Table 1). We used jModelTest 2 [71] as implemented in CIPRES Science Gateway V. 3.3 [72]. The most appropriate evolutionary models for our data determined by the Akaike Information Criterion (AIC) were GTR+I+G for 16S and HKY+I+G for COI. Bayesian Inference (BI) reconstructions were ran in MrBayes 3.2.6 [73] as implemented in CIPRES Science Gateway V. 3.3 [72], with two independent runs (each performed for four Markov–Chain Monte Carlo simulations) for 9 million generations for 16S and for COI analyses, sampled every 1,000 generations and initial 25% trees discarded as burning. We considered convergence of runs (average standard deviation ≤ 0.01) and effective sample size of parameters (ESS ≥ 200) calculated using Tracer v. 1.7.1 [74] to evaluate runs and accept results of the analyses. For both datasets, we calculated pairwise genetic distance using K2P model and partial gap deletion (cut-off 95%) in MEGAX [75].
The Poisson Tree Processes model (PTP, [76]) using BI rooted trees, 100,000 generations and removing all outgroups with exception of Paucibranchia was applied to infer putative species boundaries among our target samples and GenBank sequences using the webserver The Elexis Lab (https://sco.h-its.org/exelixis/web/software/PTP/index.html). We visually checked the convergence of MCMC runs in the maximum likelihood plot generated by the software.
Morphological study
To describe the diagnostic morphological features, we followed the terminology proposed by [52, 67, 77]. When necessary for descriptions or photography, relevant morphological structures (e.g., jaw apparatus, parapodia) were dissected and mounted on slides. Particularly, we dissected representative parapodia of the new species from anterior (5), median (40) and posterior (120–130) chaetigers to illustrate parapodial morphology and along-body variability.
Whole body pictures were taken with a PowerShot–SX710–HS digital camera. Light microscopy photos were taken with a CMEX 5 digital camera connected to a ZEISS Stemi CS–2000–C stereomicroscope and with a SP100 KAF1400 digital camera connected to a Zeiss Axioplan compound microscope. When necessary, dissected structures were stained with Methyl blue to highlight relevant characters. The same equipment was used to measure relevant morphological structures (with the help of the ISListen software, version 5.4(1) copyright by Tucsen Photonics Co. Ltd.), as well as to make the drawings (with the help of the Adobe Illustrator CC, version 2015.3.1, and Photoshop CC, version 2015.5.1, copyright by Adobe systems Inc.).
For Scanning Electron Microscope (SEM) observations, specimens were prepared using standard SEM procedures [78]. SEM images were taken with a Hitachi TM3000 TABLETOP microscope at the SEM service of the CEAB–CSIC.
The type series of the Iberian populations are deposited at the Museo Nacional de Ciencias Naturales of Madrid (MNCN) and in the Natural History Museum Oslo (NHMO). The type material of M. aegypti was revised thanks to a kind loan of the NHMO.
Nomenclatural acts
The electronic edition of this article conforms to the requirements of the amended International Code of Zoological Nomenclature, and hence the new names contained herein are available under that Code from the electronic edition of this article. This published work and the nomenclatural acts it contains have been registered in ZooBank, the online registration system for the ICZN. The ZooBank LSIDs (Life Science Identifiers) can be resolved and the associated information viewed through any standard web browser by appending the LSID to the prefix http://zoobank.org/. The LSID for this publication is: urn:lsid:zoobank.org:pub:5053C03E-0822-4581-8F7A-3FE78C6BC4EA. The electronic edition of this work was published in a journal with an ISSN, and has been archived and is available from the following digital repositories: PubMed Central, LOCKSS, ResearchGate and DigitalCSIC.
Results
Molecular analyses
In resulting trees, specimens from Cádiz formed two different well supported monophyletic groups (Figs 1 and 2). The lowest 16S K2P pairwise distances between both focus species and other sequences available in the GenBank were, respectively, 9.2% between M. gaditana sp. nov. and M. sanguinea (AY838836) and 16.1% between M. chirigota sp. nov. and M. californica Moore, 1909 [47] (GQ478162). For COI sequences, the lowest K2P pairwise distances for M. gaditana sp. nov. were 0–1.9% with specimens from France, Portugal and East Coast of USA misidentified as M. sanguinea (Fig 2, green clade), while for Marphysa chirigota sp. nov., the lowest COI K2P pairwise distances were with M. aegypti (2.9–3.74%).
Fig. 1. Bayesian Inference tree based on the 16S rDNA sequences. Posterior probability above 0.70 shown on branches. Orange and green clades correspond to the new species found in this study. Codes in parentheses are GenBank accession numbers. Fig. 2. Bayesian Inference tree based on the COI sequences. Posterior probability above 0.70 shown on branches. Orange and green clades correspond to the new species found in this study. Codes in parentheses are GenBank accession numbers. Results of PTP analyses supported that the two Iberian populations correspond to two different species, with 16S and COI species delimitation support values ranging, respectively, from 0.97 and 0.85 (M. chirigota sp. nov.) to 1 and 0.95 (M. gaditana sp. nov.) (full results as S1 File). Marphysa chirigota sp. nov. resulted in a species distinct from all others of the genus that have 16S and COI sequences available in GenBank, while M. gaditana sp. nov. formed the a single clade together with numerous specimens previously identified as Marphysa sanguinea and Marphysa sp. (Fig 2).
Taxonomic account
Order Eunicida Dales, 1962 [79]
Family Eunicidae Berthold, 1827 [80]
Genus Marphysa Quatrefages, 1866 [19]
Type species: Marphysa sanguinea (Montagu, 1813) [15], by subsequent designation.
Marphysa gaditana Martin, Gil and Zanol sp. nov.
LSID: urn:lsid:zoobank.org:act:4F4A6736-A267-4B40-AF6D-205091235ACF Figs 3A, 3B, 4, 5A, 5B, 6, 7A, 7B, 8, 9A, 9B, 10A and 10D.
Fig. 3. Marphysa gaditana sp. nov. A. Whole body. B. Detail of the anterior end showing the position of the eyespot. Marphysa chirigota sp. nov. C. Whole body. D. Detail of the anterior end showing the position of the eyespot. Fig. 4. Marphysa gaditana sp. nov. Anterior end. A. Dorsal view. B. Ventral view. C. Lateral view. Mid-body. D. Dorsal view. E. Ventral view. Posterior end. F. Lateral view. G. Ventral view. H. Detail of pygidium showing the two pairs of anal cirri. A–G same scale. Fig. 5. Marphysa gaditana sp. nov. A. Dissected mandible. B. Dissected maxillae. Marphysa chirigota sp. nov. C. Dissected mandible. D. Dissected maxillae. Arrows pointing on sclerotized matrix. Roman numerals: number of the maxilla; al: attachment lamella. Fig. 6. Marphysa gaditana sp. nov. Parapodium from chaetiger 5 in antero–posterior (A) and postero–anterior (B) views. Parapodium from chaetiger 40 in antero–posterior (C) and postero–anterior (D) views. Parapodium from a posterior branchial chaetiger (120) in antero–posterior (E) and postero–anterior (F) views. Fig. 7. Position of lateral sense organs under SEM (A, B) and neurochaetae in parapodia stained with Methyl blue (C, D). A, C. Marphysa gaditana sp. nov. B, D. Marphysa chirigota sp. nov. White arrows: lateral sense organs; dc: dorsal cirri; p: pectinate chaetae; a: aciculae; sh: subacicular hooks. Fig. 8. Marphysa gaditana sp. nov. A. Supracicular limbate chaetae. B. Subacicular spiniger compound chaetae. C. Detail of a spiniger compound chaeta. D. Bidentate subacicular hook. E. Unidentate subacicular hook. F. Detail of the tip of a bidentate acicular hook. G. Type 1 pectinate chaetae. H. Type 2 pectinate chaetae. I. Type 3 pectinate chaetae. Fig. 9. SEM micrographs. Marphysa gaditana sp. nov. A. Types of pectinate chaetae from chaetiger 40. B.Bidentate subacicular hook with guards (white arrow). B1. Detail of guards of the bidentate subacicular hook. Marphysa chirigota sp. nov. C. Types of pectinate chaetae from a posterior–most chaetiger and the acicula with the tips protruding out from acicular lobe. D. Unidentate, subacicular hook lacking guards (white arrow). D1. Detail of a parapodium with two subacicular hooks lacking guards. Fig. 10. Comparison between pectinate chaetae. Examined material. Holotype, MNCN 16.01/18522, 4 paratypes, MNCN 16.01/18523 and 1 paratype NHMO C7029; fixed in a 10% buffered seawater formalin solution, preserved in 70% ethanol. The molecular type series contains 2 DNAtypes (MNCN/ADN 118921 and MNCN/ADN 118922), fixed and preserved in 96% ethanol. Same location for all type series: 36° 26’ 32.5”N, 6° 10’ 45.82”W, Salina de San Ramón, Chiclana de la Frontera, Cádiz, SW Iberian Peninsula, 10 cm depth in soft sediment, collected by D. Martin and J. Gil, 10th May 2011. Specimens or their progenitors originally native from intertidal muddy shores at the nearby Natural Park of the Bay of Cádiz (approximate location 36.349°N, 6.181°W).
Description. Holotype long, complete, with ca. 205 chaetigers (ca. 121.7 mm long and 6.5 mm wide at mid–body, without parapodia), slightly widest at median region, abruptly tapering at posterior end (Figs 3A and 4A–4G); round in cross–section until around chaetiger 15, then dorsoventrally flattened. Chaetigers ca. 15 times wider than longer, at widest body region (Figs 3A, 4D and 4E).
Prostomium similar in length to peristomium, narrower than peristomium to as wide as peristomium, about half as deep as peristomium; prostomium dorsoventrally flattened, with anterior end higher and anteriorly bilobate, with a conspicuous median sulcus reaching almost half its length (Figs 3B and 4A–4C). Eyes subdermal, as dots inserted laterally to ceratophores of lateral antennae (Fig 3B), hidden below the anterior peristomial border in preserved specimens (Fig 4A).
Prostomial appendages arranged in semicircle (median and lateral antennae in about the same line, palps a little more anterior), extending beyond prostomium by ca. 2/5 their length (Figs 3A, 3B and 4A–4C). Median antenna, about as long as lateral antennae, all of them directed anteriorly, reaching from middle of chaetiger 2 to posterior border of chaetiger 3 when folded back. Palps about 1/5 shorter than antennae, directed anteriorly reaching from anterior border of chaetiger 2 to middle of chaetiger 3 when folded back. Ceratostyles and palpostyles tapering, lacking peduncle, style basally thicker, non–articulated (Figs 3B and 4A–4C). Ceratophores and palpophores all ring shaped, slightly wider than bases of ceratostyles and palpostyles, almost 12 times shorter than styles length (Fig 3B).
Peristomial rings distinctly separated on all sides; second one about 1/3 and 1/4 of total peristomium length dorsally and ventrally, respectively (Figs 4A–4C). Peristomial ventrolateral lips laterally distinct as elevated surfaces (Figs 4B and 4C). Ventral anterior margin of peristomium forming a shallow arc; lateral margins longer than dorsal side (Fig 4B).
Posterior end of muscularized pharynx reaching chaetigers 8–10. Mandible calcareous cutting plates not seen; sclerotized matrix ca. 10 times shorter than mandible carriers, D–shaped, distally straight, with serrated upper margin and evident growth ring–like marks (Fig 5A). MxI ca. 2.8 times as long as carrier; MxII ca. 3/4 of MxI; MxIII arched, with anterior–most teeth more lateral than posterior–most ones, at least in part ventral to MxII; attachment lamella of MxIII very small, almost not sclerotized; left MxIV wider than longer, triangular; right MxIV longer than wider, arched (Fig 5B). Attachment lamellae of MxIV boomerang–shaped, anterior to plate, left one with arms similar in size and rounded ends, right one with left arm (pointed) more than twice longer than right arm (rounded) (Fig 5B). Maxillary formula: I = 1+1, II = 5+6, III = 5+0, IV = 3+5, V = 1+1. Mx VI absent.
Pre–chaetal lobe shorter than chaetal lobe along whole body. Post–chaetal lobe longer than chaetal lobe in about 40–50 anterior–most chaetigers, conical until chaetiger 5, about 1.5 times longer than wider (Fig 6A and 6B), widely round and about as long as chaetal lobe in most chaetigers, with tapering distal end in posterior–most chaetigers (Fig 4H). Remaining parapodia with post–chaetal lobe shorter than chaetal lobe (Fig 6C–6F).
Notopodial cirri triangular, tapering (almost three times as long as wide at basis), decreasing in length towards posterior end (0.97 mm at chaetiger 5, 0.48 mm at chaetiger 40, 0.25 mm at chaetiger 120), longer than post–chaetal lobes in anterior and median chaetigers shorter than chaetal lobes in posterior chaetigers (Fig 6A–6F) and longer than chaetal lobes in posterior–most chaetigers (Fig 4H). Lateral sense organs as three conspicuously ciliated bumps, located below the notopodial cirri (Fig 7A). Ventral cirri thumb–shaped with round wide tips; with inflated bases all along body from chaetiger 6 except about last 20, being round to triangular, with distinct round tips (Fig 6A–6F). Ventral cirri about 2/3 as long as notopodial cirri in anterior–most chaetigers, decreasing in length towards posterior end (0.58 mm at chaetiger 5, 0.55 mm at chaetiger 40, 0.35 mm at chaetiger 120).
Branchiae palmate (Fig 6C–6F), starting around chaetiger 20–25, with one filament in the first 1(2) branchial chaetigers, 2–3 in the initial 17% of body, then a maximum of 4–5 from chaetiger 39–160, three from chaetiger 161–170, and 1–2 from chaetiger 171–195; last branchiae on posterior 15% of body, ca. 35 chaetigers before pygidium. Best–developed branchiae with longest branchial filament around 7.5 times longer than notopodial cirri and 2.7 and 6 times longer than branchial stem length and branchiae basal width, respectively.
Notopodial aciculae in all notopodial cirri from second body quarter, pale brown, almost inconspicuous. Neurochaetal lobe round all along body, with a more or less marked middle incision giving a bilobed appearance. Chaetae distributed in two distinct bundles: supracicular, with limbate and pectinate chaetae at anterior edge, and subacicular, with compound spiniger chaetae and subacicular hooks (Fig 7C). Neuroaciculae blunt to tapering, golden brown, placed dorsal to midline in anterior-most parapodia and on midline thereafter; distributed in an oblique row, with anterior–most neuroacicula being also dorsal–most in parapodia. 1–2 neuroaciculae per parapodium in parapodia 1, 3(2) from parapodia 2 to 5, 4(3) to parapodia 15, 3 to parapodia 40, 1–2 in median and posterior regions. Number of limbate and compound spinigers decreasing towards posterior end. Limbate chaetae with proximal end and flat margin of distal end finely serrated (Fig 8A); anterior–most limbate chaetae in bundle shortest. Compound spiniger chaetae with finely serrated shafts and blades; blades flat, varying in length within bundle (Fig 8B and 8C). Compound spinigers inserted at anterior–most row of bundle, dorsal–most one slightly more dorsal than ventral–most neuroacicula. Pectinate chaetae in all chaetigers (Figs 7C, 8G–8I, 9A and 10A–10D), inserted between dorsal bundle of limbates and neuroaciculae, with a similar position all along the body; pectinate chaetae of three types: 1) 8–10 thin, flat to little curved, lightly serrated, isodont with external teeth slightly differing in length, slightly asymmetrical (almost symmetrical in anterior–most chaetigers), with ca. 17–22 teeth, varying in length on different chaetae, evenly tapering (Type 1, Figs 8G, 9A, 10A and 10B); 2) 4–6 thick, flat to little curved, isodont, slightly asymmetrical, with 10–14 teeth, coarse and long, with short filiform tips and variable lengths on different chaetae (Type 2, Figs 8H, 9A and 10C); 3) 3–6 thick, very large, non–curved chaetae, anodont, asymmetrical, resembling a hair pick, with 5–10 teeth, very long, coarse, tapering to very long filiform ends, ca. ten times longer than wider (Type 3, Figs 8I, 9A and 10D), absent from anterior most chaetigers. Pseudo–compound chaetae absent. Subacicular hooks first present from chaetigers 40–55, absent from some parapodia, usually one per parapodium, dark yellow, bidentate, with round tips and two guards covering tip, ca. twice thicker than shaft of spinigers (Figs 7C, 8D, 8F, 9B and 9B1); when present, second hook unidentate, guards absent (Fig 8E).
Pygidium longer on ventral side, with two pairs of tapering pygidial cirri on ventral side; dorsal pygidial cirri ca. 5–10 times longer than ventral ones (Fig 4F–4H).
Remarks. In addition to the marked molecular differences found in our analyses (Figs 1 and 2) and the distinct biogeographical origin [8], M. gaditana sp. nov. is characterised by having bidentate subacicular hooks. Thus it can be clearly distinguished from the species of the sanguinea–group having them i) unidentate (see a full list in the remarks on M. chirigota sp. nov.), ii) unidentate to faintly bidentate (M. kristiani Zanol, da Silva & Hutchings, 2016 [52]), iii) bidentate but present only in the last parapodia (M. hongkongensa Wang, Zhang & Qiu, 2018 [51]), or iv) absent, at least in large adults (M. californica Moore, 1909 [47], M. brevitentaculata Treadwell, 1921 [45, 81], M. victori Lavesque, Daffe, Bonifácio & Hutchings, 2017 [3]). It can also be distinguished from M. multipectinata Liu, Hutchings & Sun, 2017 [34], which has subacicular hooks starting at chaetiger 20 (vs. 40–55 in our new species). Marphysa tribranchiata Liu, Hutchings & Sun, 2017 [34] and M. schmardai Gravier, 1907 [82] have a maximum of three branchial filaments (vs. 4–5 in our new species). Marphysa brasiliensis (Hansen, 1882) [83] and M. mullawa Hutchings & Karageorgopolous 2003 [29] have branchiae starting from chaetiger 28–33 and M. acicularum Webster, 1884 [84] from chaetigers 27–35 (vs. 40–55 in M. gaditana sp. nov.). Marphysa viridis Treadwell, 1917 [56] has one type of isodont pectinate chaetae (vs. two in M. gaditana sp. nov.), being less numerous (4–5 vs. 8–10) and showing a lower number of teeth (14 vs. 22) in middle and posterior regions. Our new species can also be distinguished from M. elityeni Lewis & Karageorgopoulos, 2008 [30], whose subacicular hooks start after chaetiger 60 (instead of before).
The five following species, normally included or associated with the sanguinea–group and mainly described from European waters, have been discarded due to incomplete original descriptions and lack of redescriptions, which prevents a comparison: Leodice opalina Savigny in Lamarck, 1818 [85] (probably from Atlantic coast of France), Leodice erithrocephala Risso, 1826 [86] (Nice region, Mediterranean coast of France), Leodice grunwaldi Risso, 1826 [86] (Nice, Mediterranean coast of France), Lysidice multicirrata Claparède, 1863 [87] (St. Vaast la Hougue, Atlantic coast of France), and Marphysa haemasona Quatrefages, 1866 [19] (South Africa).
Morphologically, M. gaditana sp. nov. most closely resembles the recently redescribed M. sanguinea [29, 35, 36], but differs, among other characters, in having some parapodia with two subacicular hooks, the second one being unidentate (instead of only one, bidentate in M. sanguinea), in having three types of pectinate chaetae in posterior parapodia (instead of only two, with Type 1 lacking, in M. sanguinea) and in the shape of the anodont pectinate chaetae from posterior chaetigers, which are very large and have 5–10 teeth with filiform tips (instead of normal size, 6–14 teeth, lacking filiform tips in M. sanguinea) (Fig 10A–10H).
Despite the absence of reliable evidences, it has been suggested that the presence of a secondary subacicular hook in some parapodia in the species of Marphysa could represent a replacement for the main one [81]. However, the fact that, when present, the secondary hook in M. gaditana sp. nov. is unidentate and lacks guards, while the main one is bidentate and has a pair of guards, casts some doubts on this replacement hypothesis. The presence of subacicular hooks seems to be a variable character within a given specimen, as they may also be absent from some parapodia (after first appearing). Therefore, we strongly recommend to consider this variability as a relevant character in species description.
Marphysa gaditana sp. nov. differs from M. chirigota sp. nov. and M. aegypti in having bidentate subacicular hooks with guards (unidentate in the other two species). All molecular species delimitation methods used herein grouped the COI sequences of M. gaditana sp. nov. with those in GenBank from Cap de la Hague (France), Sado Estuary (Portugal), and Florida and Virginia (USA), all them in Atlantic waters. It is feasible that the first two localities fall within the natural species distribution area (particularly the second one), but the records from the USA are certainly surprising. This wide disjoint distribution is uncommon for the family and deserves further investigation.
Etymology. The specific epithet refers to Gadir, the Fenician name of the oldest settlement of the city of Càdiz; “gaditana” means “from Gadir” and it is the Spanish epithet (feminine) for Cádiz inhabitants.
Distribution. Type materials collected at the Salina de San Ramón; however, according to ICZN Article 76.1.1 [88], the type locality must be the nearby intertidal muddy shores of the Natural Park of the Bay of Cádiz (approx. 36.349°N, 6.181°W), Chiclana de la Frontera, Cádiz (SW Iberian Peninsula), from where the specimens or their progenitors were originally native. Localities of samples identified as the same species based on molecular evidence, all them in the Atlantic Ocean: Cap de la Hague (France), Sado Estuary (Portugal), Florida and Virginia (USA).
Marphysa chirigota Martin, Gil and Zanol sp. nov.
LSID: urn:lsid:zoobank.org:act:90486B6A-CB92-4284-A97C-7B2381DAF4D0 Figs 3C, 3D, 5C, 5D, 7B–7D, 9C, 9D, 11–13 and 14A–14D.
Fig. 11. Marphysa chirigota sp. nov. Anterior end. A. Dorsal view. B. Ventral view. C. Lateral view. Mid–body. D. Dorsal view. E. Ventral view. Posterior end. F. Lateral view. G. Ventral view. H. Detail of pygidium showing the two pairs of anal cirri. A–G same scale. Fig. 12. Marphysa chirigota sp. nov. Parapodium from chaetiger 5 in antero–posterior (A) and postero–anterior (B) views. Parapodium from chaetiger 40 in antero–posterior (C) and postero–anterior (D) views. Parapodium from a posterior chaetiger (130) in antero–posterior (E) and postero–anterior (F) views. Fig. 13. Marphysa chirigota sp. nov. A. Supracicular limbate chaetae. B. Subacicular spiniger compound chaetae. C. Close view of spiniger compound chaetae. D. Detail of blade serration of spiniger compound chaeta. E. Detail of shaft tip serration of spiniger compound chaeta. F. Unidentate subacicular hook. G. Detail of the tip of the unidentate subacicular hook; white arrow pointing on guards. H. Type 1 pectinate chaeta. I. Type 2 pectinate chaetae. J. Type 3 pectinate chaetae; K. Type 4 pectinate chaetae. Fig. 14. Comparison between pectinate chaetae. Examined material. Holotype, MNCN 16.01/18524, 4 Paratypes, MNCN 16.01/18525, and 1 paratype, NHMO C7030; fixed in a 10% buffered seawater formalin solution, preserved in 70% ethanol. The molecular type series contains 3 DNAtypes (MNCN/ADN 118918 to MNCN/ADN 118920), fixed and preserved in 96% ethanol. Same location for all type series:36° 26’ 32.5”N, 6° 10’ 45.82”W, Salina de San Ramón, Chiclana de la Frontera, Cádiz, SW Iberian Peninsula, 10 cm depth in soft sediment, collected by D. Martin and J. Gil. Specimens or their progenitors originally native from intertidal sandy shores of the nearby Natural Park of the Bay of Cádiz (approx. 36.349°N, 6.181°W).
Description. Holotype complete, very long, with ca. 370 chaetigers (26.5 cm long, 7.9 mm wide at mid–body, without parapodia), slightly widest all along median region, progressively tapering at regenerating posterior end (Figs 3C and 11A–11G); round in cross–section until around chaetiger 20–25, then dorsoventrally flattened (Fig 3C). Chaetigers more than 13 times wider than longer at widest body region (Figs 11D and 11E).
Prostomium ca. 1/3 shorter than, and as wide as, peristomium, about half as deep as peristomium. Prostomium dorsoventrally flattened, with anterior end higher and anteriorly bilobate, with a conspicuous median sulcus reaching almost 1/3 its length (Figs 3D and 11A). Eyes subdermal, as dots inserted laterally to lateral antennae ceratophores (Fig 3D), hidden below the anterior peristomial border in preserved specimens (Figs 3D and 11A).
Prostomial appendages arranged in semicircle (median and lateral antennae in the same line, palps a little more anterior), extending beyond prostomium between half and 2/3 their length (Figs 3D and 11A). Median antenna, about as long as lateral antennae, all of them directed anteriorly, reaching from middle of chaetiger 1 to posterior border of chaetiger 3 when folded back. Palps about 1/5 shorter than antennae, directed anteriorly, reaching from middle of chaetiger 1 to middle of chaetiger 3 when folded back. Ceratostyles and palpostyles tapering, lacking peduncle, style basally thicker, non–articulated (Figs 3D and 11A). Ceratophores and palpophores all ring shaped, slightly wider than bases of ceratostyles and palpostyles, almost 13 times shorter than styles length (Fig 3D).
Peristomial rings distinctly separated on all sides; second one about 1/3 of total peristomium length (Figs 3D and 11A–11C). Peristomial ventrolateral lips laterally distinct as elevated surfaces (Figs 11B and 11C). Ventral anterior margin of peristomium forming a shallow arc; lateral margins longer than dorsal side (Figs 3D and 11A–11C).
Posterior end of muscularized pharynx reaching chaetigers 5–6. Mandible calcareous cutting plates not seen; sclerotized matrix ca. 13 times shorter than mandible carriers, D–shaped, distally straight, with serrated upper margin and evident growth ring–like marks (Fig 5C). MxI ca. 2.5 times as long as carrier; MxII ca. 3/4 of MxI; MxIII arched, with anterior–most teeth more lateral than posterior–most ones, ventral to MxII; attachment lamella of MxIII short, as an elongated D, strongly sclerotized, placed at middle of plate ventral edge; MxIV longer than wider, left one short, straight; right one, arched; attachment lamellae of MxIV roughly C–shaped, ventral to plate, left one with left arm (pointed) more than twice shorter than right arm (rounded), right one with left arm (pointed) ca. four times longer than right (rounded) (Fig 5D). Maxillary formula: I = 1+1, II = 4/5+5, III = 6+0, IV = 4/5+7, V = 1+1. Mx VI absent.
Pre–chaetal lobe shorter than chaetal one along whole body. Post–chaetal lobe longer than chaetal one in about 40–50 anterior–most chaetigers, finger–like until chaetiger 4, blunt triangular on chaetiger 5, about 1.5 wider than longer (Fig 12A and 12B), wide rounded and about as long as chaetal lobe in most chaetigers (Fig 12C–12F), with tapering distal end in posterior–most chaetigers.
Notopodial cirri triangular, tapering (almost three times longer than wide at basis), decreasing in length towards posterior end (0.97 mm at chaetiger 5, 0.48 mm at chaetiger 40, 0.25 mm at chaetiger 120), longer than post–chaetal lobes in anterior chaetigers, as long as in median chaetigers and shorter in posterior ones (Fig 12A–12F), but longer than post–chaetal lobes in posterior–most chaetigers (Figs 11F and 11G). Lateral sense organs as single ciliated bump, located below the notopodial cirri (Fig 7B). Ventral cirri thumb–shaped with round wide tips; from chaetiger 5 with inflated bases along most of the body, except about last 20, being round to triangular, with distinct round tips (Fig 12A–12F). Ventral cirri about half as long as notopodial cirri in anterior–most chaetigers (0.59 mm at chaetiger 5), similar in length in maximum branchial development region (0.54 at chaetiger 40) and decreasing in length at end of branchial region (0.43 mm at chaetiger 120).
Branchiae palmate (Fig 12C–12F), starting around chaetiger 25–30, with one filament in the first 1(2) branchial chaetigers, 3–4 up to the initial 17% of body, five from chaetiger ca. 55 to 75, a maximum of six until ca. 220, then 3–4 until ca. 280 and 1–2 until ca. 330; last branchiae on posterior 10% of body, ca. 40 chaetigers before pygidium. Best–developed branchiae with longest branchial filament around 8 times longer than notopodial cirri and 2.7 and 10 times longer than branchial stem length and branchiae basal width, respectively.
Notopodial aciculae in all notopodial cirri along second body quarter, pale yellow, inconspicuous. Neurochaetal lobe round all along body. Chaetae distributed in two distinct bundles: supracicular with limbate and pectinate chaetae at anterior edge, and subacicular with compound spiniger chaetae and subacicular hooks (Fig 7D). Neuroaciculae blunt to tapering, dorsal to parapodia midline in anterior segments and along parapodia midline thereafter; distributed in an oblique row, with anterior–most neuroacicula being also dorsal–most in parapodia, with tips clearly protruding from acicular lobe (Fig 9C). Three neuroaciculae per parapodium on chaetiger 1, 3–4 until chaetiger 30, then 4–6 to parapodia 120, 3–4 to ca. chaetiger 320, then 3(2) to body end. Neuroaciculae golden brown (Fig 7D). Number of limbate chaetae and compound spinigers decreasing towards posterior end. Limbate chaetae with proximal end and flat margin of distal end serrated; anterior–most limbate chaetae in bundle shortest (Fig 13A). Compound spiniger chaetae with serrated shafts and blades; blades flat, varying in length within bundle (Fig 13B–13E). Anterior parapodia with dorsal–most compound spiniger chaetae inserted at anterior–most row of bundle, as dorsal as ventral–most neuroacicula. Pectinate chaetae in all chaetigers except in first four, inserted between dorsal bundle of limbate chaetae and neuroaciculae (Figs 7D and 9C); pectinate chaetae of four types; i) 2–10 thin, flat to little curved, lightly serrated chaetae, with evenly tapering fine teeth, isodont with external teeth markedly differing in length, with ca. 20–30 teeth, number of chaetae and teeth increasing towards midbody, (Type 1, Figs 13H and 14A); ii) 2–10 thin, flat to little curved, lightly serrated chaetae, isodont, with ca. 20–30 evenly tapering fine teeth, number of chaetae and teeth and degree of asymmetry increasing from anterior to posterior parapodia (Type 2, Figs 13I and 14B); iii) 5–6 thick, flat to little curved chaetae, markedly asymmetrical, isodont, with 13–16 coarse and long teeth, of variable length on different chaetae (Type 3, Figs 13J and 14C); iv) 2–5 thick, large, non–curved, asymmetrical chaetae resembling a hair pick, anodont, with 4–7 thick, almost triangular teeth, tapering to filiform ends, 3–5 times longer than wider (Type 4, Figs 13K and 14D). Type 1 present on anterior–most parapodia, being progressively replaced by Type 2, present alone on roughly half anterior body; Types 3 and 4 appearing around mid–body and on posterior–most parapodia, respectively; Type 4 with teeth length vs. tip width ratio of 0.5–8.0 and teeth length vs. width ratio of 2.5 (Figs 13K and 14D). Pseudocompound chaetae absent. Subacicular hooks ca. four times thicker than shaft of spinigers, first present from chaetiger 30–45, then in all posterior chaetigers, usually one per parapodium, two in some posterior–most chaetigers, dark yellow, unidentate, with round tip, one with guards absent, another with guards absent or very small (Figs 7D, 9D, 9D1, 13F and 13G).
Pygidium longer on ventral side, with two pairs of tapering pygidial cirri on ventral side; dorsal pygidial cirri ca.14 times longer than ventral ones (Fig 11H).
Remarks. In addition to the marked molecular differences found in our analyses (Figs 1 and 2) and the distinct biogeographical origin [8], M. chirigota sp. nov. differs from all species of the sanguinea–group either having bidentate subacicular hooks with guards, or laking them at all (see remarks on M. gaditana). It also differs from M. bulla Liu, Hutchings & Kupriyanova, 2018 [33], M. nobilis Treadwell, 1917 [56] and M. tripectinata Liu, Hutchings & Sun, 2017 [34] in having subacicular hooks starting at chaetiger 30–45 vs. 71, 255 and 170, respectively. Marphysa aransensis Treadwell, 1939 [89] has less isodont pectinate chaetae in anterior segments (1–2 vs. 2–10), isodont and anodont pectinate chaetae in middle parapodia (instead of two isodont types) and less numerous pectinate chaetae in posterior parapodia, where the anodont ones have 14 teeth (vs. 4–7 in M. chirigota sp. nov.). Marphysa furcellata Crossland, 1903 [22], M. iloiloensis Glasby, Mandario, Burghardt, Kupriyanova, Gunton & Hutchings, 2019 [8], and M. mangeri Augener, 1918 [90] have the first branchial segments before chaetiger 25 and M. macintoshi Crossland, 1903 [22] and M. tamurai Okuda, 1934 [27] after chaetiger 30 (25–30 in M. chirigota sp. nov.). Marphysa parishii Baird, 1869 [91] was described as having pectinate chaetae appearing only in the posterior body region (vs. from first chaetigers in M. chirigota sp. nov.) and Marphysa acicularum brevibranchiata Treadwell, 1921 [45] has 6+6 and 8+9 teeth in the maxilla II and IV (vs. 4/5+5 and 5/5+7 in M. chirigota sp. nov.).
In turn, Leodice opalina Savigny in Lamarck, 1818 [85], Leodice erithrocephala Risso, 1826 [86], Leodice grunwaldi Risso, 1826 [86], Lysidice multicirrata Claparède, 1863 [87] and Marphysa haemasona Quatrefages, 1866 [19] are discarded for the same reasons discussed in the remarks for M. gaditana sp. nov.
Marphysa chirigota sp. nov. most closely resembles the recently described M. aegypti in overall body size and in having very robust, unidentate subacicular hooks (single in most parapodia, two—both similar in size and form—in some posterior parapodia). However both species differ in numerous morphological characters: the ratio chaetiger width/length, the ratio prostomium/peristomium length, the presence of peduncle in cerato–and palpostyles, the posterior end of muscularised pharynx, the maxillary formula, the shape of notopodial cirri, the length and proportions of branchial filaments, the number and colour of neuropodial acicula, and the shape and number of pectinate chaetae (Table 2, Fig 14). Despite the numerous differences, distinguishing the two species requires a careful observation of key characters. These subtle differences are also reflected in the low genetic differentiation between both species (2.9–3.74%), which are borderline between intraspecific and interspecific for polychaete species [92, 93], suggesting a recent speciation event.
Tab. 2. Summary of the main differences between M. aegypti and M. chirigota sp. nov. based on descriptions and observation of type material. Etymology. The specific epithet “chirigota” is a tribute to the “Chirigotas”, a genre of choral folksong typical of Cádiz province (SW Iberian Peninsula), the type locality of the species. The chirigotas are satirical-humoristic songs performed predominantly in the streets by costumed performers during Carnival, and reflect much of the refined local sense of humour and hospitality that the first two authors had the chance to enjoy during the collection trip. By selecting this species name, all authors aim to contribute promoting the amazing heritage (natural, cultural and human) of the whole region of the Gulf of Cádiz.
Distribution. Type material collected at the Salina de San Ramón; according to ICZN Article 76.1.1 [88], the type locality must be considered as the nearby intertidal sandy shores of the Natural Park of the Bay of Cádiz (approx. 36.349°N, 6.181°W), Chiclana de la Frontera, Cádiz (Iberian Peninsula), from), where the specimens or their progenitors were originally native. The species is also likely to be present in south Portugal, namely in Parchal (Algarve). This area is characterised by intertidal sand banks in marine sheltered waters (similar to the type locality) and harbours a population of Marphysa with very long specimens, known by Portuguese anglers as “ganso do Parchal” (Nuno Lopes, pers. comm. 28 April 2019).
Marphysa aegypti Elgetany, El-Ghobashy, Ghoneim and Struck, 2018 [31]
LISID: urn:lsid:zoobank.org:act:EC8C5797-11DB-45FB-8ABF-B9F2C969F083 Figs 14E–14H, 15 and 16.
Fig. 15. Marphysa aegypti. Paratype NHMO C6963. A. Dissected mandible. B. Dissected maxillae. Paratype NHMO C6965: C. Anterior parapodium (chaetiger 5), anterior view. D. Same parapodium, posterior view. Paratype NHMO C6964: E. Mid–posterior parapodium (chaetiger 100), anterior view; F. Detail of same parapodium as E, showing the position of the neuroacicula (a) and the subacicular hook (s). Fig. 16. Marphysa aegypti. Paratype NHMO C6964. A. Neuroaciculum. B. Two unidentate subacicular hooks from same parapodium. C. Detail of tips of subacicular hooks in B. D. Type 1 pectinate chaeta. E. Type 2 pectinate chaeta. F. Type 3 pectinate chaetae; G. Type 4 pectinate chaetae. Examined material. Holotype: NHMO C6963. Al Ferdan, Suez Canal, 30° 40' 12.4'' N, 32° 20' 6.8' 'E. Paratypes (3 specimens): NHMO C6964, Eladabia, Gulf of Suez, 29° 56' 6.0'' N, 32° 28' 36.6'' E; NHMO C 6965, Eladabia, Gulf of Suez, 29° 56' 6.0'' N, 32° 28' 36.6'' E; NHMO C6966, off Alexandria (Mediterranean Sea), 31° 12' 43'' N, 29° 53' 2.4' 'E.
Re–description. Maxillary formula: I = 1+1, II = 4+4, III = 5+0, IV = 4+6, V = 2+1, VI absent (paratype NHMO C6964, Fig 15A and 15B); fully agrees with original description except in having: (1) anterior most parapodia with conical ventral cirri (instead of having inflated basis along whole body) (Fig 15C and 15D); (2) three black aciculae per parapodium (instead of four, three black and one yellow) (Figs 15E, 15F and 16A); (3) one (occasionally absent, occasionally two in posterior chaetigers) unidentate subacicular hook (instead of subacicular hooks absent, reported as “yellow acicula” in the original description) (Figs 15E, 15F, 16B and 16C), present from chaetiger 32 (paratype NHMO C6966), 40 (holotype, paratype NHMO C6964), 48 (paratype NHMO C6965); (4) two pairs of pygidial cirri, ventral ones absent but scars indicating presence (instead of lacking ventral pair of pygidial cirri); (5) pectinate chaetae of four types; Type 1 in anterior body region, progressively replaced at midbody by Type 2; Types 3 and 4 in posterior and posterior–most chaetigers, respectively (instead of three types, with Type 1 in anterior and midbody segments and Types 2 and 3 in posterior segments); (6) Type 1 thin, symmetrical, isodont with external teeth markedly differing in length, with ca. 10–15 teeth; Type 2 thin, asymmetrical, isodont, with > 25 teeth; Type 3 relatively thick, asymmetrical, isodont, with about 15 teeth, coarse, with pointed tips; Type 4 thick, asymmetrical, anodont, with about five long and coarse teeth (instead of Type 1 isodont, with about 19 teeth, Type 2 with ca. 9 teeth and Type 3 with six teeth); and (7) Type 4 with teeth length vs. tip width ratio of 1 and teeth length vs. width ratio of 4 (not mentioned in original description) (Figs 14E–14H and 16D–16G).
Discussion
Distribution range of Marphysa sanguinea
Robust taxonomic literature strongly supports not only that M. sanguinea fails to be a cosmopolitan species, but also that its distribution seems to be surprisingly restricted to areas surrounding its type locality [29, 30, 36]. Its current confirmed distribution ranges from Arcachon (Bay of Biscay, Atlantic coast of France) as southern limit, to the Southern Bight region (North Sea) as north-eastern limit [35, 36], including both shores of the English Channel (type locality). The species has also been recorded in nearby regions, such as the western Irish coast [94], the Irish and Welsh shores of the Celtic Sea [95–98], and the Bristol Channel and Severn Estuary (e.g., [95, 97–99] and references herein), in what could represent its north-western limit. Moreover, the Natural History Museum of UK (NHM) holds in its collections specimens identified as M. sanguinea from the Bristol Channel (NHMUK 1954.1.1.127, from Woody Bay; NHMUK 1970.7, from Porlock Weir). The species was also reported as “common” at Sully and Lavernock Point (Welsh coast of inner Bristol Channel) [99] and as “relatively rare” [98] or “occasional” [96] at Dale (Pembrokeshire, Welsh coasts of Celtic Sea), where it was not found in a 1988 survey [100]. Although we have not revised any of these records, many of them refer to intertidal specimens associated to hard substrates, so that at least some of them may feasibly represent the north-western limit of distribution for M. sanguinea.
The species has been recently reported as “introduced” in the southern North Sea, namely in southwestern Dutch shores [35, 101–103], where it is listed as an alien species. However, this statement seems to lack supporting evidence. Although there are not many published reports, M. sanguinea was previously known from the English coasts of the North Sea, at Whitstable, Kent [104] and Skipper’s Island, Essex [105] and, more recently, from a shipwreck off Oostende, Belgium [106]. Furhermore, the NHM holds in its collections specimens identified as M. sanguinea from Norfolk (NHMUK 1903.5.16.1), Burnham-on-Crouch, Essex (NHMUK 1966.10.4), and Margate Beach, Kent (NHMUK 1966.4.21). Although we have not revised the identity of these specimens, all them support the existence of populations of Marphysa in the Southern Bight region for more than one century. However, the scarce records in the Southern Bight and their absence in the northern regions of the North Sea (with one exception, see below) seem to indicate that the genus is, if not accidental, at least rare or occurring there at low densities. This supports the Southern Bight as being the north-eastern limit of distribution for the genus (including M. sanguinea). Consequently, we suggest that the relatively rare presence of M. sanguinea in the Netherlands is more likely connected with the natural limit of its distribution, rather than to a human mediated introduction [35], with the recent findings in the area more probably resulting from achieved newly routine and more exhaustive monitoring programs.
The single report of Marphysa in the northern regions of the North Sea corresponds to a specimen described (but not named) from the Swedish west coast (near Uddevalla, Skagerrak) [107], a region under climatic and oceanographic conditions very different from those prevailing in the English Channel and Southern Bight. This specimen differs clearly from the sanguinea–group by the presence of tridentate composite falcigers in the anterior 15 chaetigers (against the single presence of composite spinigers in the sanguinea–group), a very uncommon feature, if not unique, in the genus. Regardless whether it may represent a undescribed species, it clearly differs from all the species targeted in our work.
The low records of M. sanguinea in north European waters above the Southern Bight or the Celtic Sea seem to indicate temperature as a key limiting factor for the northern distribution of this intertidal species. This is in accordance with the distribution of other intertidal invertebrates along the English Channel coasts, which diminish their densities eastwards in the direction of the Strait of Dover), were not only the average water temperature is lower, but also the severe winter cold results in a reduced fitness for southern species, which are replaced by northern taxa [108]. Regarding the Celtic Sea and Bristol Channel side, local episodes of high mortality of M. sanguinea were registered at certain areas of south Wales after the 1962–63 severe winter [98]).
As for the southern limit of distribution of M. sanguinea, it still needs further investigation along the Atlantic coasts of France, Spain and Portugal. The present descriptions of M. gaditana sp. nov. and M. chirigota sp. nov. from the Bay of Cádiz place that southern limit somewhere between Arcachon and Cádiz. Very likely, it may be north of the Sado Estuary (Portugal), as our analyses place the GenBank sequence of one specimen from that locality within M. gaditana sp. nov.
State of the art after type species resdescription
Since M. sanguinea redescription [29], two new species of the sanguinea–group were described from European and nearby locations, M. victori from the Bay of Biscay [3] and M. aegypti from the eastern Mediterranean, Suez Canal and Gulf of Suez [31], while we are here describing two more from the Bay of Cádiz. Similar situations occurred in other well studied coasts, such as Australia [29, 52], South Africa [30], the Grand Caribbean [77], China [33, 34] and Hong-Kong [51], where the presence of M. sanguinea proved to result from misidentifications or from a wrong use of the “cosmopolitan species” concept. Accordingly, several species (many new, some recovered from synonymies) have been reported, while others are still waiting to be reanalysed, likely to have their status removed from synonymy. Among them, Marphysa haemasona Quatrefages, 1866, (South Africa), M. leidii Quatrefages, 1866 (Atlantic USA), M. parishii Baird, 1869 (Brazil), M. iwamushi Izuka, 1907 (Japan), or M. sanguinea americana Monro, 1933 (Pacific Panama) [19, 23, 91, 109]. As a result, the so–called sanguinea–group [50] or Group–B [110] currently comprises 32 species or subspecies of Marphysa, including one recently described from Philippines [8] and the two new ones described herin. Certainly, many more wait to be discovered in the near future.
Another important aspect allowing recognising and delineating the species of Marphysa is the habitat. Marphysa sanguinea seems to be virtually always present in association with hard substrates [25, 111, 112], while most species of the sanguinea–group occur in different, likely species-specific substrates [36], usually soft. In the case of the two new species here described, this habitat specificity also applies, as M. gaditana sp. nov. was found in muddy substrates, while M. chirigota sp. nov. was associated to sediments with higher contents of the sand fraction.
In addition to highlighting habitat specificity, we would also like to stress two other main aspects that emerge as useful issues in providing solutions to this species group. First, the obvious growing molecular standards. In our case, we were able to state, with different degrees of certitude, that both M. gaditana sp. nov and M. chirigota sp. nov. differed from all previously sequenced species of the genus, but also that the former apparently occurs in a number of different locations at both sides of the Atlantic, namely France, Portugal and USA. Second, the increasingly careful and detailed observations leading to highlight the presence of clearly discriminatory characters, many of them previously overlooked. In the case of Marphysa, in addition to traditional morphological traits (e.g., the shape of dorsal cirri and pre–chaetal, chaetal and post–chaetal lobes, the starting chaetiger of brachiae or subacicuar hooks, or the type of compound chaetae [77, 81]), the shape of pectinate chaetae became a key argument, as first postulated for the type species [35] and later for some Chinese species of the sanguinea–group [34]. Classifying pectinate chaetae in a formulaic way may be tricky [8], but our results confirm the relevancy of carefully observing their morphology, number and presence, as well as the variations along the whole body. We also provide additional morphometric support based on the use of width/length ratios for the teeth of these chaetae in distinguishing among species, which turned to be particularly relevant when comparing M. aegypti and M. chirigota sp. nov.
Commercial interests and associated risks
Many polychaetes have a great commercial interest, and the species of Marphysa are not an exception. Most of them are being widely used as fishing bait by anglers all around the world, which is particularly favoured by two facts: 1) many of them occur intertidally or shallow subtidally, often in sheltered coasts, being thus easily collectable by hand or by digging the sediment, and 2) their relatively big size and robust muscular body is particularly adequate to be used as fishing bait. Their stiff bodies enable a tight fixation to fishing hooks, from which they cannot be easily detached. They most often remain intact if bitten by small fishes, being thus available for a bigger catch, which improves size selection and capture outcomes (Nuno Lopes, personal communication, 28 April 2019). Some anglers also sustain that the specimens of Marphysa may be bioluminescent, which would make them particularly attractive for night fishing (Nuno Lopes, personal communication, 28 April 2019). However, this statement still requires scientific confirmation.
Endurance once in the hook and catch selectivity have thus made the species of Marphysa sought and popular fishing baits everywhere in the world for such a long time. Scientific records of this particular use are known from Australia [29, 35], China [33, 34], Egypt [31], England and the English Channel [25, 113], the French Atlantic [3] and Mediterranean coasts [21], Japan [23, 24, 26, 27], Malaysia [32, 114], South Africa [30], Sri Lanka [28], or Zanzibar [22]. However, our results emphasize the importance of knowing how many species are being currently traded under the name “M. sanguinea”, not only in the Iberian Peninsula, but also in Europe and all around the world [1, 13]. The fact that the south Iberian “M. sanguinea” turned to be two different, new species, as well as their differences in size, behaviour and habitat, indicate that they may have different life cycles, which probably also differ from those of the genuine M. sanguinea and any other species within the sanguinea–group. This may have obvious consequences for any commercial initiative (e.g., aquaculture, fishing baits), as well as for management programs of exploited natural populations, which may be extrapolated to all species within the group.
Our results also contribute to highlight the relevance and necessity of accurate taxonomic studies dealing with species of commercial interest. Exploited saleable species used to be distributed locally, while at present, the growing global marked establishes the potential of being distributed worldwide [1, 2, 13]. The usage of incorrect identifications favours careless practices, and enables impunity in trading, transporting and (possibly) releasing living allochthonous species into the wild. As they are being officially traded under the same scientific name than autochthonous species, no legal actions can be taken if a, let us say, “M. sanguinea” from a remote region of the globe is released, accidentally or not, in a Mediterranean area were “M. sanguinea” also occurs. This way, different exotic species may be legally introduced to areas where they are non–native. This may be the case of M. gaditana sp. nov. in some of the locations here reported (particularly in the most remote ones). It must be highlighted that, at least at Cap de la Hague (France), this species lives in sympatry with M. sanguinea (although they occupy different habitats, i.e., soft and hard bottoms, respectively). Sympatry has been also reported for other species of the sanguinea group in Philippines, Zanzibar, the Florida Keys, Australia and Cádiz Bay ([8], present work). The fact is that exotic species may perfectly survive to establish viable populations outside their native habitats after being released to the wild by anglers. This not only represents a risk due to the own presence of the introduced polychaete, but also may favour introductions of potentially dangerous associated organisms. A recent example has been reported for the beachworm Perinereis linea (Treadwell, 1936) [115], a traded fishing bait native from the NW Pacific that has a well–established populations in the Mar Menor lagoon (Mediterranean coast of the Iberian Peninsula) [116]. The reproductive females of this exotic species carry gelatinous egg masses where the embryos are attacked by symbiotic ciliate protozoans, thus keeping the potential of acting as carriers of diseases for the native beachworms [116].
An interesting additional question rises on whether all known species of the sanguinea group are native or introduced in the areas from where they were first described. Solving this question, however, would require having samples from all around the world to undertake a complex molecular analyses, which is completely out of the scope of our paper. Despite this, knowing the real identity of commercially exploited species may certainly contribute to recognise the risks and, thus, to control them by promoting the implementation of good habits among traders, but also among the possible final users (e.g., sport anglers). As introduced exotic species may always have the potential of becoming invasive, the consequences of lacking these controls for local species and habitats would be unpredictable, but certainly point to overall changes in biodiversity that would further affect food webs, ecosystem functioning, and the provision of ecosystem services [117].
The collapsing “cosmopolitan species” concept
The use of polychaetes as model organisms in many different types of studies, from biogeochemistry, biology and physiology to ecology and genetics, as well as their commercial interest and increasing trade market, combines with old incomplete descriptions and inadequate diagnostic features to generate a considerable number of worldwide citations for certain species that obviously lack a rigorous taxonomic support. Marphysa sanguinea is a perfect example of this problem. This species has been reported in many studies from locations as diverse as Japan, China, Hong-Kong, South Korea, Australia, USA, Morocco, South Africa, India, New Caledonia, Gulf of Aden, Persian Gulf, Gulf of Thailand and many more (e.g.,[36, 118–121] and references therein), with examples of misidentifications all around the world existing mainly, but not exclusively, in faunistic or ecological papers. Misidentifications certainly include European waters, where specimens of supposedly M. sanguinea have been used to trace heavy metals and for diet tests based on survival and growth of juveniles in Portugal [122, 123], to monitor life cycles in the Venice Lagoon [124], or as target of potential interest for aquaculture in the Bay of Cádiz [16, 17]. As for other world citations, our results strongly support that many of these European reports do not refer to M. sanguinea, but to different species within the genus.
As a final remark, we would like to highlight that proving the incorrectness of the “cosmopolitan” character traditionally attributed to many polychaete species should no longer be considered a surprise or even an added value increasing the interest of a given research or publication. Virtually all “cosmopolitan” polychaete species that have been confronted with careful, detailed studies (morphological, molecular or, ideally, both combined) have shown geographically restricted distributions, habitat specificity and/or the existence of hidden species complexes [125]. As a result, most species having broad worldwide distributions would very probably be those that have been secondarily spread (i.e., introduced) by human activities.
Supporting information
S1 File [docx]
Species delimitation.
Zdroje
1. Watson GJ, Murray JM, Schaefer M, Bonner A. Bait worms: a valuable and important fishery with implications for fisheries and conservation management. Fish and Fisheries. 2017;18(2):374–88. https://doi.org/10.1111/faf.12178.
2. Cole VJ, Chick RC, Hutchings PA. A review of global fisheries for polychaete worms as a resource for recreational fishers: diversity, sustainability and research needs. Reviews in Fish Biology and Fisheries. 2018. http://doi.org/10.1007/s11160-018-9523-4.
3. Lavesque N, Daffe G, Bonifácio P, Hutchings P. A new species of the Marphysa sanguinea complex from French waters (Bay of Biscay, NE Atlantic) (Annelida, Eunicidae). ZooKeys. 2017;716 : 1–17. https://doi.org/10.3897/zookeys.716.14070.
4. Olive PJW. Polychaete aquaculture and polychaete science: a mutual synergism. Hydrobiologia. 1999;402 : 175–83. https://doi.org/10.1007/978-94-017-2887-4_9.
5. Gambi MC, Castelli A, Giangrande A, Prevedelli D, Zunarelli-Vandini R. Polychaetes of commercial and applied interest in Italy: an overview. Mémoires du Muséum National d'Histoire Naturelle, Paris. 1994;162 : 593–602.
6. Batista FM, Fidalgo e Costa P, Matias D, Joaquim S, Massapina C, Passos AM, et al. Preliminary results on the growth and survival of the polychaete Nereis diversicolor (OF Muller, 1776), when fed with faeces from the carpet shell clam Ruditapes decussatus (L., 1758). Boletín del Instituto Español de Oceanografía. 2003;19(1/4):443.
7. Noda N, Tanaka R, Tsujino K, Takasaki Y, Nakano M, Nishi M, et al. Phosphocholine-bonded galactosylceramides having a tri-unsaturated long-chain base from the clam worm, Marphysa sanguinea. The Journal of Biochemistry. 1994;116(2). https://doi.org/10.1093/oxfordjournals.jbchem.a124543.
8. Glasby CJ, Mandario MA, Burghardt I, Kupriyanova E, Gunton LM, Hutchings PA. A new species of the sanguinea-group Quatrefages, 1866 (Annelida: Eunicidae: Marphysa) from the Philippines. Zootaxa. 2019;4674(2):264–82.
9. Carvalho S, Constantino R, Cerqueira M, Pereira F, Subida MD, Drake P, et al. Short-term impact of bait digging on intertidal macrobenthic assemblages of two south Iberian Atlantic systems. Estuarine, Coastal and Shelf Science. 2013;132 : 65–76. https://doi.org/10.1016/j.ecss.2011.06.017.
10. Beukema JJ. Long-term effects of mechanical harvesting of lugworms Arenicola marina on the zoobenthic community of a tidal flat in the Wadden Sea. Netherlands Journal of Sea Research. 1995;33(2):219–27. https://doi.org/10.1016/0077-7579(95)90008-X.
11. Birchenough S. Impact of bait collecting in Poole Harbour and other estuaries within the Southern IFCA District. Fisheries Challenge Fund–Project FES 186. Great Britain: UK Marine Management Organisation (MMO), 2013.
12. Çinar ME. Alien polychaete species worldwide: current status and their impacts. Journal of the Marine Biological Association of the United Kingdom. 2013;93(5):1257–78. https://doi.org/10.1017/S0025315412001646.
13. Font T, Gil J, Lloret J. The commercialization and use of exotic baits in recreational fisheries in the north-western Mediterranean: Environmental and management implications. Aquatic Conservation: Marine and Freshwater Ecosystems. 2018. https://doi.org/10.1002/aqc.2873.
14. Bischoff AA, Fink P, Waller U. The fatty acid composition of Nereis diversicolor cultured in an integrated recirculated system: Possible implications for aquaculture. Aquaculture. 2009;296(3):271–6. https://doi.org/10.1016/j.aquaculture.2009.09.002.
15. Montagu G. An account of some new and rare marine British shells and animals. Transactions of the Linnean Society of London. 1813;11 : 179–204. https://doi.org/10.1111/j.1096-3642.1813.tb00047.x.
16. Moreno E, Ortiz-Delgado JB, García M, Agraso M, Fernández-Lora M, Yúfera M, et al. Avances en el cultivo integral de Marphysa sanguinea en el parque natural de la bahía de Cádiz. Actas del III Simposio Internacional de Ciencias del Mar; Cádiz, Spain.: Facultad de Ciencias del Mar y Ambientales, Universidad de Cádiz; 2012.
17. Muñoz Lechuga R, Cabrera R. Estudio preliminar del cultivo de Marphysa sanguinea (Montagu, 1815) a bajo coste. ¿Es posible? XV Congreso nacional y I Congreso ibérico de acuicultura; Huelva: Sociedad Española de Acuicultura; 2015. p. 412–3.
18. Villegas EM. Cultivo integral y biología de Marphysa sanguinea (Montagu, 1813): Universidad de Cádiz; 2016.
19. Quatrefages A, de. Histoire naturelle des Annelés marins et d'eau douce. Annélides et Géphyriens. Volume 1. Paris: Librarie Encyclopédique de Roret; 1866.
20. Read G, Fauchald K. World Polychaeta database. Marphysa Quatrefages, 1866. Accessed at: http://www.marinespecies.org/polychaeta/aphia.php?p=taxdetails&id=129281 on 10–22, 2019.
21. Marion AF, Bobretzky N. Étude des annélides du golfe de Marseille. Annales des Sciences Naturelles, Paris. 1875;6(12):1–106.
22. Crossland C. On the marine fauna of Zanzibar and British East Africa, from collections made by Cyril Crossland in the years 1901 and 1902. Polychaeta, Part I. Proceedings of the Zoological Society of London. 1903;1(1):169–76. https://doi.org/10.1111/j.1469-7998.1903.tb08273.x.
23. Izuka A. [On two new species of annelids belonging to the Euncidae]. Zoological Magazine (Dobutsugasku zasshi), Tokyo. 1907;19 : 139–43.
24. Izuka A. The errantiate Polychaeta of Japan. Journal of the College of Science, Imperial University of Tokyo. 1912;30(2):1–262.
25. McIntosh WC. A monograph of the British annelids. Polychaeta. Syllidae to Ariciidae. Ray Society of London. 1910;2(2):233–524. https://doi.org/10.5962/bhl.title.54725.
26. Okuda S. Some polychaete annelids used as bait in the Inland Sea. Japanese Zoological Bulletin. 1933;14 : 243–53,2plates.
27. Okuda S. A new species of errantiate polychaete, Marphysa tamurai, n. sp. Proceedings of the Imperial Academy Tokyo. 1934;10 : 521–423,9figs.
28. Pillai TG. Studies on a brackish-water polychaetous annelid, Marphysa borradailei, sp. n. from Ceylon. Ceylon Journal of Science (Biological Sciences). 1958;1(2):94–106.
29. Hutchings PA, Karageorgopoulos P. Designation of a neotype of Marphysa sanguinea (Montagu, 1813) and a description of a new species of Marphysa from eastern Australia. In: Advances in Polychaete Research Hydrobiologia. 2003;496(1–3):87–94. https://doi.org/10.1023/A:1026124310552.
30. Lewis C, Karageorgopoulos P. A new species of Marphysa (Eunicidae) from the western Cape of South Africa. Journal of the Marine Biological Association of the UK. 2008;88(02):277–87. https://doi.org/10.1017/S002531540800009X.
31. Elgetany AH, El-Ghobashy AE, Ghoneim AM, Struck TH. Description of a new species of the genus Marphysa (Eunicidae), Marphysa aegypti sp. n., based on molecular and morphological evidence. Invertebrate Zoology. 2018;15(1):71–84. https://doi.ord/10.15298/invertzool.15.1.05.
32. Idris I, Hutchings P, Arshad A. Description of a new species of Marphysa Quatrefages, 1865 (Polychaeta: Eunicidae) from the west coast of Peninsular Malaysia and comparisons with species from Marphysa Group A from the Indo-West Pacific and Indian Ocean. Memoirs of Museum Victoria. 2014;71 : 109–21. https://doi.org/10.24199/j.mmv.2014.71.11.
33. Liu Y, Hutchings P, Kupriyanova E. Two new species of Marphysa Quatrefages, 1865 (Polychaeta: Eunicida: Eunicidae) from northern coast of China and redescription for Marphysa orientalis Treadwell, 1936. Zootaxa. 2018;4377(2):191–215. http://dx.doi.org/10.11646/zootaxa.4377.2.3. 29690064
34. Liu Y, Hutchings P, Sun S. Three new species of Marphysa Quatrefages, 1865 (Polychaeta: Eunicida: Eunicidae) from the south coast of China and redescription of Marphysa sinensis Monro, 1934. Zootaxa. 2017;4263(2):228–50. https://doi.org/10.11646/zootaxa.4263.2.2. 28609867
35. Hutchings P, Glasby CJ, Wijnhoven S. Note on additional diagnostic characters for Marphysa sanguinea (Montagu, 1813) (Annelida: Eunicida: Eunicidae), a recently introduced species in the Netherlands. Aquatic Invasions. 2012;7(2):277–82. http://dx.doi.org/10.3391/ai.2012.7.2.014.
36. Lavesque N, Daffe G, Grall J, Zanol J, Gouillieux B, Hutchings PA. Guess who? On the importance of using appropriate name: case study of Marphysa sanguinea (Montagu, 1813). ZooKeys. 2019;859 : 1–15. https://doi.org/10.3897/zookeys.859.34117. 31327919
37. Gil J. The European fauna of Annelida Polychaeta. Lisboa: Universidade de Lisboa; 2011.
38. Koressaar T, Remm M. Enhancements and modifications of primer design program Primer3. Bioinformatics. 2007;23(10):1289–91. https://doi.org/10.1093/bioinformatics/btm091. 17379693
39. Carr CM, Hardy SM, Brown TM, Macdonald TA, Hebert PD. A tri-oceanic perspective: DNA barcoding reveals geographic structure and cryptic diversity in Canadian polychaetes. PLoS One. 2011;6(7):e22232. https://doi.org/10.1371/journal.pone.0022232. 21829451
40. Rozewicki J, Yamada KD, Katoh K. MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Briefings in Bioinformatics. 2017;bbx108. https://doi.org/10.1093/bib/bbx108.
41. Hall TA. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposyum Series. 1999;41 : 95–8.
42. Maddison WP, Maddison DR. Mesquite: a modular system for evolutionary analysis. Version 3.51. http://www.mesquiteproject.org, accessed on 20 November 2018 2018.
43. Kott P. Nereidae and Eunicidae of south Western Australia; also notes on the ecology of Western Australian limestone reefs. Journal of the Royal Society of Western Australia. 1951;35 : 85–130.
44. Zanol J, Da silva TDSC, Hutchings P. One new species and two redescriptions of Marphysa (Eunicidae, Annelida) species of the Aenea-group from Australia. Zootaxa. 2017;4268(3):411–26. doi: 10.11646/zootaxa.4268.3.6 28610365
45. Treadwell AL. Leodicidae of the West Indian region. Publications of the Carnegie Institution of Washington. 1921;15(293):1–13. https://www.jstor.org/stable/4063281.
46. Zanol J, Halanych KM, Struck TH, Fauchald K. Phylogeny of the bristle worm family Eunicidae (Eunicida, Annelida) and the phylogenetic utility of noncongruent 16S, COI and 18S in combined analyses. Molecular Phylogenetics and Evolution. 2010;55(2):660–76. https://doi.org/10.1016/j.ympev.2009.12.024. 20040377
47. Moore JP. Polychaetous annelids from Monterey Bay and San Diego, California. Proceedings of the Academy of Natural Sciences of Philadelphia. 1909;61(2):235–95.
48. Kinberg JGH. Annulata nova. Öfversigt af Kongliga Vetenskaps-Akademiens Förhandlingar, Stockholm. 1865;21(10):559–74.
49. Kara J. A Phylogeny of South African east coast intertidal rocky-shore Polychaete worms and the genetic structure and demographic history of an example, Marphysa corallina [Master thesis]: School of Biological & Conservation Sciences University of KwaZulu-Natal Durban. Supervisor Angus HH Macdonald.; 2015.
50. Glasby CJ, Hutchings P. A new species of Marphysa Quatrefages, 1865 (Polychaeta: Eunicida: Eunicidae) from northern Australia and a review of similar taxa from the Indo-west Pacific, including the genus Nauphanta Kinberg, 1865. Zootaxa. 2010;2352 : 29–45. http://dx.doi.org/10.11646/zootaxa.2352.1.2.
51. Wang Z, Zhang Y, Qiu JW. A new species in the Marphysa sanguinea complex (Annelida, Eunicidae) from Hong Kong. Zoological Studies. 2018;57(48):1–13. https://doi.org/10.6620/ZS.2018.57-48.
52. Zanol J, da Silva TdSC, Hutchings P. Marphysa (Eunicidae, polychaete, Annelida) species of the Sanguinea group from Australia, with comments on pseudo-cryptic species. Invertebrate Biology. 2016;135(4):328–44. https://doi.org/10.1111/ivb.12146.
53. Struck TH, Purschke G, Halanych KM. Phylogeny of Eunicida (Annelida) and exploring data congruence using a partition addition bootstrap alteration (PABA) approach. Systematic Biology. 2006;55(1):1–20. https://doi.org/10.1080/10635150500354910. 16507520
54. Peters WCH. Über die Gattung Bdella, Savigny, (Limnatis, Moquin-Tandon) und die in Mossambique beobachteten Anneliden, wovon hier eine Mittheilung folgt [informal title in meeting report]. Bericht über die zur Bekanntmachung geeigneten Verhandlungen der Königlichen Preussischen Akademie der Wissenschaften zu Berlin 1854;21(1):607–14.
55. Verrill AE. Additions to the Turbellaria, Nemertina, and Annelida of the Bermudas, with revisions of some New England genera and species. Transactions of the Connecticut Academy of Arts and Sciences. 1900;10(2):595–671.
56. Treadwell AL. Polychaetous annelids from Florida, Porto Rico, Bermuda and the Bahamas. Publications of the Carnegie Institution of Washington. 1917;251 : 255–72.
57. Lobo J, Teixeira MAL, Borges LMS, Ferreira MSG, Hollatz C, Gomes PT, et al. Starting a DNA barcode reference library for shallow water polychaetes from the southern European Atlantic coast. Molecular Ecological Resources. 2016;16(1):298–313. http://doi.org/10.1111/1755-0998.12441.
58. Siddall ME, Apakupakul K, Burreson EM, Coates KA, Erséus C, Gelder SR, et al. Validating Livanow: molecular data agree that leeches, branchiobdellidans, and Acanthobdella peledina form a monophyletic group of oligochaetes. Molecular Phylogenetics and Evolution. 2001;21(3):346–51. doi: 10.1006/mpev.2001.1021 11741378
59. Leray M, Knowlton N. DNA barcoding and metabarcoding of standardized samples reveal patterns of marine benthic diversity. Proceedings of the National Academy of Sciences. 2015;112(7):2076–81.
60. Li S, Chen Y, Zhang M, Bao X, Li Y, Teng W, et al. Complete mitochondrial genome of the marine polychaete, Marphysa sanguinea (Polychaeta, Eunicida). Mitochondrial DNA Part A. 2016;27(1):42–3.
61. Audouin JV, Milne Edwards H. Classification des Annélides, et description de celles qui habitent les côtes de la France. Annales des sciences naturelles, Paris. 1833;30 : 411–25.
62. Aylagas E, Borja Á, Irigoien X, Rodríguez-Ezpeleta N. Benchmarking DNA metabarcoding for biodiversity-based monitoring and assessment. Frontiers in Marine Science. 2016;3 : 96.
63. Rousset V, Pleijel F, Rouse GW, Erseus C, Siddall ME. A molecular phylogeny of annelids. Cladistics. 2007;23(1):41–63. 6865.
64. Hartman O. Polychaetous annelids from California. Allan Hancock Pacific Expeditions. 1961;25 : 1–226.
65. Molina-Acevedo IC. Morphological revision of the Subgroup 1 Fauchald, 1970 of Marphysa de Quatrefages, 1865 (Eunicidae: Polychaeta). Zootaxa. 2018;4480(1):1–125. http://dx.doi.org/10.11646/zootaxa.4480.1.1. 30313332
66. Zanol J, Halanych KM, Fauchald K. Reconciling taxonomy and phylogeny in the bristleworm family Eunicidae (polychaete, Annelida). Zoologica Scripta. 2014;43(1):79–100.
67. Carrera-Parra LF, Salazar-Vallejo SI. A new genus and 12 new species of Eunicidae (Polychaeta) from the Caribbean Sea. Journal of the Marine Biological Association of the United Kingdom. 1998;78(01):145–82. doi: 10.1017/S0025315400040005
68. Stair JB. An account of Palolo, a sea-worm eaten in the Navigator Islands, with a description by J.E. Gray. Proceedings of the Zoological Society of London. 1847;15 : 17–8.
69. Ehlers E. Report on the annelids of the dredging expedition of the U.S. coast survey steamer Blake. Memoirs of the Museum of Comparative Zoology at Harvard College. 1887;15 : 1–335, 60 plates.
70. Grube AE. Annulata Örstediana. Enumeratio Annulatorum, quac in itinere per Indiam occidentalem et Americam centralem annis 1845–1848 suscepto legit cl. A. S. Örsted, adjectis speciebus nonnullis a cl. H. Kröyero in itinere ad Americam meridionalem collectis. Videnskabelige Meddelelser fra Dansk naturhistorisk Forening. 1856 [published 1857];1857 : 158–66 [also issued as a separate with pagination 1–29].
71. Darriba D, Taboada GL, Doallo R, Posada D. jModelTest 2: more models, new heuristics and parallel computing. Nature methods. 2012;9(8):772. https://doi.org/10.1038/nmeth.2109.
72. Miller MA, Pfeiffer W, Schwartz T. The CIPRES science gateway: enabling high-impact science for phylogenetics researchers with limited resources. Proceedings of the 1st Conference of the Extreme Science and Engineering Discovery Environment: Bridging from the eXtreme to the campus and beyond: ACM; 2012. p. 39.
73. Ronquist F, Huelsenbeck JP. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics. 2003;19(12):1572–4. https://doi.org/10.1093/bioinformatics/btg180. 12912839
74. Rambaut A, Drummond A, Xie D, Baele G, Suchard M. Posterior summarization in Bayesian phylogenetics using Tracer 1.7. Systematic Biology. 2018;67 : 901–4. https://doi.org/10.1093/sysbio/syy032. 29718447
75. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Molecular Biology and Evolution. 2018;35 : 1547–9. doi: 10.1093/molbev/msy096 29722887
76. Zhang J, Kapli P, Pavlidis P, Stamatakis A. A general species delimitation method with applications to phylogenetic placements. Bioinformatics. 2013;29 : 2869–76. https://doi.org/10.1093/bioinformatics/btt499. 23990417
77. Molina-Acevedo IC, Carrera-Parra LF. Reinstatement of three species of the Marphysa sanguinea complex (Polychaeta: Eunicidae) from the Grand Caribbean Region. Zootaxa. 2015;3925(1):37–55. http://dx.doi.org/10.11646/zootaxa.3925.1.3. 25781729
78. Martin D, Britayev TA, San Martín G, Gil J. Inter-population variability and character description in the sponge associated Haplosyllis spongicola complex (Polychaeta: Syllidae). Hydrobiologia. 2003;496(Advances in Polychaete Research):145–62. https://doi.org/10.1023/A:1026184529208.
79. Dales RP. The polychaete stomodeum and the inter-relationships of the families of Polychaeta. Proceedings of the Zoological Society of London. 1962;139(3):389–428. https://doi.org/10.1111/j.1469-7998.1962.tb01837.x.
80. Berthold AA. Latreille's Natürliche Familien des Thierreichs. Aus dem Franzosischen, mit Anmerkungen und Zusätzen. Weimar: Verlage Landes-Industrie-Comptoirs; 1827. 606 p.
81. Molina-Acevedo IC, Carrera-Parra LF. Revision of Marphysa de Quatrefages, 1865 and some species of Nicidion Kinberg, 1865 with the erection of a new genus (Polychaeta: Eunicidae) from the Grand Caribbean. Zootaxa. 2017;4241(1):1–62. doi: 10.11646/zootaxa.4241.1.1 28603244
82. Gravier C. Sur les Annélides Polychètes rapportés par M. le Dr. Rivet, de Payta (Pérou). Bull Mus Hist nat, Paris. 1907;13 : 525–30.
83. Hansen A. Recherches sur les annèlides recueilles par M. le professeur Édouard Van Beneden pendant son voyage au Brésil et à la Plata. Mémoires Couronnés et Mémoires des Savants Étrangers. Académie Royale des Sciences, des Lettres, et des Beaux-Arts de Belgique 1882;44 : 1–29, plates I-VII. 7042.
84. Webster HE. Annelida from Bermuda collected by G. Brown Goode. Bulletin of the United States National Museum. 1884;25 : 307–27.
85. Lamarck JB. Histoire naturelle des Animaux sans Vertèbres, présentant les caractères généraux et particuliers de ces animaux, leur distribution, leurs classes, leurs familles, leurs genres, et la citation des principales espèces qui s'y rapportent; précédée d'une introduction offrant la détermination des caractères essentiels de l`animal, sa distinction du végétal et des autres corps naturels, enfin, l'exposition des principes fondamentaux de la zoologie. Vol. 5. Paris: Déterville & Verdière; 1818. 612 p.
86. Risso A. Histoire naturelle des principales productions de l'Europe méridionale et particulièrement de celles des environs de Nice et des Alpes Maritimes. Paris: Levrault; 1826.
87. Claparède ARE. Beobachtungen über Anatomie und Entwicklungsgeschichte wirbelloser Thiere an der Küste von Normandie angestellt. Leipzig: Verlag von Wilhelm Engelmann; 1863.
88. International Commission of Zoological Nomenclature I. The International Code of Zoological Nomenclature. 4th Edition. London: International Trust for Zoological Nomenclature; 1999.
89. Treadwell AL. New polychaetous annelids from New England, Texas and Puerto Rico. American Museum Novitates. 1939;1023 : 1–7.
90. Augener H. Polychaeta. In Beiträge zur Kenntnis der Meeresfauna Westafrikas. 2. Hamburg: Herausgegeben von W. Michaelsen; 1918. p. 67–625.
91. Baird W. Remarks on several genera of annelides, belonging to the group Eunicea, with a notice of such species as are contained in the collection of the British Museum, and a description ofsome others hitherto undescribed. J Linn Soc. 1869;10 : 341–61.
92. Nygren A, Parapar J, Pons J, Meißner K, Bakken T, Kongsrud JA, et al. A mega-cryptic species complex hidden among one of the most common annelids in the North East Atlantic. PLOS ONE. 2018;13(6):e0198356. https://doi.org/10.1371/journal.pone.0198356. 29924805
93. Nygren A. Cryptic polychaete diversity: a review. Zoologica Scripta. 2013;43(2):172–83. https://doi.org/10.1111/zsc.12044. 7110.
94. Keegan BF. The macrofauna of maerl substrates on the west coast of Ireland. Cahiers de Biologie Marine. 1974;15(4):513–30. https://doi.org/10.21411/CBM.A.DE0F11E1.
95. Bassindale R, Clark RB. The Gann Flat, Dale: studies on the ecology of a muddy beach. Field Studies. 1960;1(2):1–22.
96. Crothers JH. Dale Fort Marine Fauna (Second Edition). Field Studies. 1966;Supplement 2 : 1–169.
97. Keegan BF, O'Connor BDS, McGrath D, Könnecker G, Ó Foighil D, editors. Littoral and benthic investigations on the south coast of Ireland: II. The macrobenthic fauna off Carnsore Point. Proceedings of the Royal Irish Academy Section B: Biological, Geological, and Chemical Science; 1987: JSTOR.
98. Moyse J, Nelson-Smith A. Effects of the severe cold of 1962–63 upon shore animals in South Wales. In: Crisp DJ, editor. The effects of the severe winter of 1962–63 on marine life in Britain. Journal of Animal Ecology. 1964;33 : 183–90. https://doi.org/10.2307/2355.
99. Boyden CR, Crothers JH, Little C, Mettam C. The intertidal invertebrate fauna of the Severn Estuary. Field Studies 1977;4 : 477–554.
100. Edwards A, Garwood P, Kendall M. The Gann Flat, Dale: thirty years on. Field Studies. 1992;8(1):59–75.
101. Wijnhoven S, Dekker A. Records of a new alien polychaete worm species, Marphysa sanguinea (Montagu, 1815) (Eunicidae) in the Eastern Scheldt, the Netherlands. Aquatic Invasions. 2010;5(4):431–6. http://doi.org/10.3391/ai.2010.5.4.13.
102. van der Have TM, Broeckx PB, Kersbergen A. Risk assessment of live bait. Searching for alien species in live bait used by anglers in the Netherlands. Report nr 15–151. Culemborg, The Netherlands: Bureau Waardenburg bv. Ecologie & Landschap, 2015.
103. Gittenberger A, Rensing M, Wesdorp KH. Non-indigenous marine species in the Netherlands. GiMaRIS report. 2017;2017_13 : 1–39.
104. Newell GE. The marine fauna of Whitstable. Annals and Magazine of Natural History. 1954;7(12):321–50. https://doi.org/10.1080/00222935408651737.
105. Nisbet RH. Marine biology at Skipper's Island. Essex Naturalist. 1960;30(4):247–53.
106. Zintzen V, Massin C. Artificial hard substrata from the Belgian part of the North Sea and their influence on the distributional range of species. Belgian Journal of Zoology. 2010;140(1):20–9.
107. Winsnes IM. Eunicid polychaetes (Annelida) from Scandinavian and adjacent waters. Family Eunicidae. Zoologica Scripta. 1989;18(4):483–500.
108. Crisp DJ, Southward AJ. The distribution of intertidal organisms along the coasts of the English Channel. Journal of the Marine Biological Association of the United Kingdom. 1958;37(1):157–203. https://doi.org/10.1017/S0025315400014909.
109. Monro CCA. The polychaeta errantia collected by Dr. C. Crossland at Colón, in the Panama region, and the Galapagos Islands during the expedition of the S.Y. St. George. Proceedings of the Zoological Society of London. 1933;1933 : 1–96. https://doi.org/10.1111/j.1096-3642.1933.tb01578.x.
110. Fauchald K. Polychaetous annelids of the families Eunicidae, Lumbrineridae, Iphitimidae, Arabellidae, Lysaretidae and Dorvilleidae from western Mexico. Allan Hancock Monogr mar Biol. 1970;5 : 1–335.
111. Allen EJ. Polychaeta of Plymouth and the South Devon coast, including a list of the Archiannelida. Journal of the Marine Biological Association of the United Kingdom (New Series). 1915;10(4):592–646. https://doi.org/10.1017/S002531540000919X.
112. Todd RA. Marine Zoology. In: Page W, editor. The Victoria History of the County of Devon; volume one. London: Archibald Constable and Company Limited; 1906.
113. George JD, Hartmann-Schroeder G. Polychaetes: British Amphinomida, Spintherida and Eunicida. Synopses of the British Fauna (New Series). Vol. 32. London: Linnean Society of London and Estuarine and Brackish-Water Sciences Association; 1985. 221 p.
114. Idris I, Arshad A. Checklist of polychaetous annelids in Malaysia with redescription of two commercially exploited species. Asian Journal of Animal and Veterinary Advances. 2013;8(3):409–36. https://doi.org/10.3923/ajava.2013.409.436.
115. Treadwell AL. Polychaetous annelids from Amoy, China. Proceedings of the United States National Museum. 1936;83(2984):261–79.
116. Arias A, Richter A, Anadón N, Glasby CJ. Revealing polychaetes invasion patterns: Identification, reproduction and potential risks of the Korean ragworm, Perinereis linea (Treadwell), in the Western Mediterranean. Estuarine, Coastal and Shelf Science. 2013;131 : 117–28.
117. Katsanevakis S, Coll M, Piroddi C, Steenbeek J, Ben Rais Lasram F, Zenetos A, et al. Invading the Mediterranean Sea: biodiversity patterns shaped by human activities. Frontiers in Marine Science. 2014;1 : 32. https://doi.org/10.3389/fmars.2014.00032.
118. Day JH. A monograph on the Polychaetes of Southern Africa. Part 1. Errantia. Trustees of the British Museum (Natural History). 1967;656 : 1–656. https://doi.org/10.5962/bhl.title.8596.
119. Fauvel P. The Fauna of India, including Pakistan, Ceylon, Burma and Malaya. Annelida, Polychaeta. Seymour Sewell RB, editor. Allahabad: The Indian Press, Ltd.; 1953. 507 p.
120. Wehe T, Fiege D. Annotated checklist of the polychaete species of the seas surrounding the Arabian Peninsula: Red Sea, Gulf of Aden, Arabian Sea, Gulf of Oman, Arabian Gulf. Fauna of Arabia. 2002;19 : 7–238.
121. Prezant RS, Sutcharit C, Chalermwat K, Kakhai N, Duangdee T, Dumrongrojwattana P. Population study of Laternula truncata (Bivalvia: Anomalodesmata: Laternulidae) in the mangrove sand flat of Kungkrabaen Bay, Thailand, with notes on Laternula cf. corrugata. The Raffles Bulletin of Zoology. 2008;(18):57–73.
122. Garcês J, Costa MH. Trace metals in populations of Marphysa sanguinea (Montagu, 1813) from Sado estuary: effect of body size on accumulation. Scientia Marina. 2009;73(3):605–16. https://doi.org/10.3989/scimar.2009.73n3605.
123. Garcês J, Pereira J. Effect of salinity on survival and growth of Marphysa sanguinea Montagu (1813) juveniles. Aquaculture International. 2011;19(3):523–30. https://doi.org/10.1007/s10499-010-9368-x.
124. Prevedelli D, Massamba N'Siala G, Ansaloni I, Simonini R. Life cycle of Marphysa sanguinea (Polychaeta: Eunicidae) in the Venice Lagoon (Italy). Marine Ecology. 2007;28(3):384–93. https://doi.org/10.1111/j.1439-0485.2007.00160.x.
125. Hutchings P, Kupriyanova E. Cosmopolitan polychaetes–fact or fiction? Personal and historical perspectives. Invertebrate Systematics. 2018;32(1):1–9. https://doi.org/10.1071/IS17035.
Článek Disparate effects of antibiotic-induced microbiome change and enhanced fitness in Daphnia magnaČlánek Phanerochaete chrysosporium strain B-22, a nematophagous fungus parasitizing Meloidogyne incognitaČlánek Do atmospheric events explain the arrival of an invasive ladybird (Harmonia axyridis) in the UK?Článek Growth behavior and glyphosate resistance level in 10 populations of Echinochloa colona in AustraliaČlánek Effects of Transcranial Direct Current Stimulation on GABA and Glx in Children: A pilot studyČlánek Early conservation benefits of a de facto marine protected area at San Clemente Island, CaliforniaČlánek Evaluating risk prediction models for adults with heart failure: A systematic literature reviewČlánek Patient perceived value of teleophthalmology in an urban, low income US population with diabetesČlánek A study to better understand under-utilization of laboratory tests for antenatal care in SenegalČlánek Monitoring the ‘diabetes epidemic’: A framing analysis of United Kingdom print news 1993-2013Článek Trophic ecology of Mexican Pacific harbor seal colonies using carbon and nitrogen stable isotopesČlánek Models of protein production along the cell cycle: An investigation of possible sources of noiseČlánek Fecal transplant prevents gut dysbiosis and anxiety-like behaviour after spinal cord injury in ratsČlánek Phylogeographic analyses point to long-term survival on the spot in micro-endemic Lycian salamandersČlánek Genlisea hawkingii (Lentibulariaceae), a new species from Serra da Canastra, Minas Gerais, BrazilČlánek Modelling the impact of migrants on the success of the HIV care and treatment program in BotswanaČlánek Design and evaluation of a laboratory-based wheelchair castor testing protocol using community dataČlánek Role of ecology in shaping external nasal morphology in bats and implications for olfactory trackingČlánek Allergic inflammation is initiated by IL-33–dependent crosstalk between mast cells and basophilsČlánek Combined fiscal policies to promote healthier diets: Effects on purchases and consumer welfareČlánek Influence of light on the infection of Aureococcus anophagefferens CCMP 1984 by a “giant virus”Článek Manual dexterity of mice during food-handling involves the thumb and a set of fast basic movementsČlánek Quantum isomer searchČlánek Effects of Allium hookeri on gut microbiome related to growth performance in young broiler chickensČlánek Age and altitude of residence determine anemia prevalence in Peruvian 6 to 35 months old childrenČlánek A network analysis revealed the essential and common downstream proteins related to inguinal herniaČlánek Low risk pregnancies after a cesarean section: Determinants of trial of labor and its failureČlánek Identification and characterization of miRNAs involved in cold acclimation of zebrafish ZF4 cellsČlánek Research on motion planning for an indoor spray arm based on an improved potential field methodČlánek Eye-gaze information input based on pupillary response to visual stimulus with luminance modulationČlánek Disruption in daily eating-fasting and activity-rest cycles in Indian adolescents attending schoolČlánek The earliest farming communities north of the Carpathians: The settlement at Gwoździec site 2Článek Eligibility for hepatitis B antiviral therapy among adults in the general population in ZambiaČlánek Characterization of the visceral and neuronal phenotype of 4L/PS-NA mice modeling Gaucher diseaseČlánek Increased inflammation and endothelial markers in patients with late severe post-thrombotic syndromeČlánek Management of veterinary anaesthesia in small animals: A survey of current practice in QuebecČlánek Umbilical cord separation time, predictors and healing complications in newborns with dry careČlánek Analysis of attitudinal components towards statistics among students from different academic degreesČlánek Forecasting stock prices with long-short term memory neural network based on attention mechanismČlánek Enzyme response of activated sludge to a mixture of emerging contaminants in continuous exposureČlánek Quantitative PCR provides a simple and accessible method for quantitative microbiota profilingČlánek Comparison of Monocyte Distribution Width (MDW) and Procalcitonin for early recognition of sepsisČlánek Transcriptome analysis of Actinidia chinensis in response to Botryosphaeria dothidea infectionČlánek Niche modeling reveals life history shifts in birds at La Brea over the last twenty millenniaČlánek Distributed flux balance analysis simulations of serial biomass fermentation by two organismsČlánek Head impulse compensatory saccades: Visual dependence is most evident in bilateral vestibular lossČlánek Sofosbuvir-based regimen for genotype 2 HCV infected patients in Taiwan: A real world experienceČlánek The virulence domain of Shigella IcsA contains a subregion with specific host cell adhesion functionČlánek Short treatment with antalarmin alters adrenal gland receptors in the rat model of endometriosisČlánek Self-esteem and other risk factors for depressive symptoms among adolescents in United Arab EmiratesČlánek Influence of flow on phosphorus-dynamics and particle size in agricultural drainage ditch sedimentsČlánek An information-based approach to handle various types of uncertainty in fuzzy bodies of evidenceČlánek Novel method to measure temporal windows based on eye movements during viewing of the Necker cubeČlánek The impact of rehabilitation frequency on the risk of stroke in patients with rheumatoid arthritisČlánek Vascularization and biocompatibility of poly(ε-caprolactone) fiber mats for rotator cuff tear repairČlánek Disease-specific out-of-pocket healthcare expenditure in urban Bangladesh: A Bayesian analysisČlánek Reassortment and adaptive mutations of an emerging avian influenza virus H7N4 subtype in ChinaČlánek Occupational gender segregation and economic growth in U.S. local labor markets, 1980 through 2010Článek Accuracy of intraocular lens power calculation formulas using a swept-source optical biometerČlánek Characterization of black patina from the Tiber River embankments using Next-Generation SequencingČlánek Impact of long-term storage and freeze-thawing on eight circulating microRNAs in plasma samplesČlánek Obesity, smoking habits, and serum phosphate levels predicts mortality after life-style interventionČlánek Allele specific expression of Dof genes responding to hormones and abiotic stresses in sugarcaneČlánek Structure-function analyses of candidate small molecule RPN13 inhibitors with antitumor propertiesČlánek Multiple fragmented habitat-patch use in an urban breeding passerine, the Short-toed TreecreeperČlánek Predictive factors of first dosage intravenous immunoglobulin-related adverse effects in childrenČlánek Effects of rejection intensity and rejection sensitivity on social approach behavior in womenČlánek The implementation of community-based diabetes and hypertension management care program in IndonesiaČlánek Optimization of cytotoxic activity of Nocardia sp culture broths using a design of experimentsČlánek Investigating Italian disinformation spreading on Twitter in the context of 2019 European electionsČlánek Modelling zero-truncated overdispersed antenatal health care count data of women in BangladeshČlánek Prevalence of antiphospholipid antibodies in Behçet's disease: A systematic review and meta-analysisČlánek Genetic characterization of Bacillus anthracis strains circulating in Italy from 1972 to 2018Článek Adverse reproductive effects of S100A9 on bovine sperm and early embryonic development in vitroČlánek CNP mediated selective toxicity on melanoma cells is accompanied by mitochondrial dysfunctionČlánek Correction: Mutation spectrums of TSC1 and TSC2 in Chinese women with lymphangioleiomyomatosis (LAM)Článek Regional versus local wind speed and direction at a narrow beach with a high and steep foreduneČlánek Computational analysis of functional single nucleotide polymorphisms associated with SLC26A4 geneČlánek MLST-based genetic relatedness of Campylobacter jejuni isolated from chickens and humans in PolandČlánek Does squatting need attention?—A dual-task study on cognitive resources in resistance exerciseČlánek pyKNEEr: An image analysis workflow for open and reproducible research on femoral knee cartilageČlánek Optimization of tissue sampling for Borrelia burgdorferi in white-footed mice (Peromyscus leucopus)Článek Mothers’ oral health literacy and children’s oral health status in Pikine, Senegal: A pilot studyČlánek Redefining transcriptional regulation of the APOE gene and its association with Alzheimer’s diseaseČlánek And the nominees are: Using design-awards datasets to build computational aesthetic evaluation modelČlánek Common mental illness among epilepsy patients in Bahir Dar city, Ethiopia: A cross-sectional studyČlánek Influence of inflammasome NLRP3, and IL1B and IL2 gene polymorphisms in periodontitis susceptibilityČlánek Factors for starting biosimilar TNF inhibitors in patients with rheumatic diseases in the real worldČlánek Revisits, readmissions, and outcomes for pediatric traumatic brain injury in California, 2005-2014Článek Use of magnetic resonance imaging to determine laterality of meniscal size in healthy volunteersČlánek Young women’s reproductive health conversations: Roles of maternal figures and clinical practicesČlánek Dominant negative effects by inactive Spa47 mutants inhibit T3SS function and Shigella virulenceČlánek ICOS-deficient and ICOS YF mutant mice fail to control Toxoplasma gondii infection of the brain
Článek vyšel v časopisePLOS One
Nejčtenější tento týden
2020 Číslo 1- Psilocybin je v Česku od 1. ledna 2026 schválený. Co to znamená v praxi?
- Alergie na antibiotika u žen s infekcemi močových cest − poznatky z průřezové studie z USA
- INFOGRAFIKA: Světový den boje proti rakovině... aneb jaké výzvy stojí před českou onkologií?
- AI pomůže personalizovat léčbu fibrilace síní
- Česká gastroenterologie jde s dobou. Už 80 let
-
Všechny články tohoto čísla
- ETAPOD: A forecast model for prediction of black pod disease outbreak in Nigeria
- Disparate effects of antibiotic-induced microbiome change and enhanced fitness in Daphnia magna
- Deliver on Your Own: Disrespectful Maternity Care in rural Kenya
- Quantification of microaerobic growth of Geobacter sulfurreducens
- Number of days required to estimate physical activity constructs objectively measured in different age groups: Findings from three Brazilian (Pelotas) population-based birth cohorts
- Identifying site- and stimulation-specific TMS-evoked EEG potentials using a quantitative cosine similarity metric
- Design and assessment of TRAP-CSP fusion antigens as effective malaria vaccines
- Best compromise nutritional menus for childhood obesity
- Phanerochaete chrysosporium strain B-22, a nematophagous fungus parasitizing Meloidogyne incognita
- Non-disclosure of tuberculosis diagnosis by patients to their household members in south western Uganda
- Patch testing in Lao medical students
- A competence-regulated toxin-antitoxin system in Haemophilus influenzae
- Bund removal to re-establish tidal flow, remove aquatic weeds and restore coastal wetland services—North Queensland, Australia
- Exploring the mechanism of olfactory recognition in the initial stage by modeling the emission spectrum of electron transfer
- Risk of complications among diabetics self-reporting oral health status in Canada: A population-based cohort study
- Family Health Days program contributions in vaccination of unreached and under-immunized children during routine vaccinations in Uganda
- Calcium dobesilate reduces VEGF signaling by interfering with heparan sulfate binding site and protects from vascular complications in diabetic mice
- Predicting factors for long-term survival in patients with out-of-hospital cardiac arrest – A propensity score-matched analysis
- HIV infection does not alter interferon α/β receptor 2 expression on mucosal immune cells
- The impact of body posture on intrinsic brain activity: The role of beta power at rest
- Retraction: DJ-1 Modulates α-Synuclein Aggregation State in a Cellular Model of Oxidative Stress: Relevance for Parkinson's Disease and Involvement of HSP70
- Practical considerations in the use of a porcine model (Sus scrofa domesticus) to assess prevention of postoperative peritubal adhesions
- Do atmospheric events explain the arrival of an invasive ladybird (Harmonia axyridis) in the UK?
- Transcriptional Differences in Peanut (Arachis hypogaea L.) Seeds at the Freshly Harvested, After-ripening and Newly Germinated Seed Stages: Insights into the Regulatory Networks of Seed Dormancy Release and Germination
- First adaptation of quinoa in the Bhutanese mountain agriculture systems
- Identifying maintenance hosts for infection with Dichelobacter nodosus in free-ranging wild ruminants in Switzerland: A prevalence study
- Model order reduction for left ventricular mechanics via congruency training
- The use of mixed collagen-Matrigel matrices of increasing complexity recapitulates the biphasic role of cell adhesion in cancer cell migration: ECM sensing, remodeling and forces at the leading edge of cancer invasion
- Hyponatraemia reversibly affects human myometrial contractility. An in vitro pilot study
- Production, purification and evaluation of biodegradation potential of PHB depolymerase of Stenotrophomonas sp. RZS7
- The impact of a wireless audio system on communication in robotic-assisted laparoscopic surgery: A prospective controlled trial
- Towards a bottom-up understanding of antimicrobial use and resistance on the farm: A knowledge, attitudes, and practices survey across livestock systems in five African countries
- Geographical origin determines responses to salinity of Mediterranean caddisflies
- Non-redundant roles in sister chromatid cohesion of the DNA helicase DDX11 and the SMC3 acetyl transferases ESCO1 and ESCO2
- Seroprevalence of viral and vector-borne bacterial pathogens in domestic dogs (Canis familiaris) in northern Botswana
- Global reach of ageism on older persons’ health: A systematic review
- Musical expertise generalizes to superior temporal scaling in a Morse code tapping task
- Cross-cultural adaptation and psychometric evaluation of the Yoruba version of Oswestry disability index
- Growth behavior and glyphosate resistance level in 10 populations of Echinochloa colona in Australia
- Analysis of the lineage of Phytophthora infestans isolates using mating type assay, traditional markers, and next generation sequencing technologies
- Post-transcriptional regulation of Rad51c by miR-222 contributes cellular transformation
- Targeting chondroitinase ABC to axons enhances the ability of chondroitinase to promote neurite outgrowth and sprouting
- First eight residues of apolipoprotein A-I mediate the C-terminus control of helical bundle unfolding and its lipidation
- Repeated noninvasive stimulation of the ventromedial prefrontal cortex reveals cumulative amplification of pleasant compared to unpleasant scene processing: A single subject pilot study
- Can scientists fill the science journalism void? Online public engagement with science stories authored by scientists
- Retention and predictors of attrition among patients who started antiretroviral therapy in Zimbabwe’s national antiretroviral therapy programme between 2012 and 2015
- Prognostics for pain in osteoarthritis: Do clinical measures predict pain after total joint replacement?
- Infants without health insurance: Racial/ethnic and rural/urban disparities in infant households’ insurance coverage
- HY5 is not integral to light mediated stomatal development in Arabidopsis
- Effects of Transcranial Direct Current Stimulation on GABA and Glx in Children: A pilot study
- Hypertension testing and treatment in Uganda and Kenya through the SEARCH study: An implementation fidelity and outcome evaluation
- Whole genome sequence analysis reveals the broad distribution of the RtxA type 1 secretion system and four novel putative type 1 secretion systems throughout the Legionella genus
- Evaluation of rice wild relatives as a source of traits for adaptation to iron toxicity and enhanced grain quality
- The Malaysian Workplace Bullying Index (MWBI): A new measure of workplace bullying in Eastern countries
- Brief communication: Long-term absence of Langerhans cells alters the gene expression profile of keratinocytes and dendritic epidermal T cells
- APOBEC3B reporter myeloma cell lines identify DNA damage response pathways leading to APOBEC3B expression
- Morphological diversity within a core collection of subterranean clover (Trifolium subterraneum L.): Lessons in pasture adaptation from the wild
- Feasibility of real-time in vivo 89Zr-DFO-labeled CAR T-cell trafficking using PET imaging
- Repository-based plasmid design
- A LAMP at the end of the tunnel: A rapid, field deployable assay for the kauri dieback pathogen, Phytophthora agathidicida
- A new method of recording from the giant fiber of Drosophila melanogaster shows that the strength of its auditory inputs remains constant with age
- Early conservation benefits of a de facto marine protected area at San Clemente Island, California
- Evaluating risk prediction models for adults with heart failure: A systematic literature review
- Age, period and cohort analysis of age-specific maternal mortality trend in Ethiopia: A secondary analysis
- Aberrant cervical innate immunity predicts onset of dysbiosis and sexually transmitted infections in women of reproductive age
- Performance of Qure.ai automatic classifiers against a large annotated database of patients with diverse forms of tuberculosis
- Closed circuit xenon delivery for 72h in neonatal piglets following hypoxic insult using an ambient pressure automated control system: Development, technical evaluation and pulmonary effects
- Safe mobility, socioeconomic inequalities, and aging: A 12-year multilevel interrupted time-series analysis of road traffic death rates in a Latin American country
- THAP11F80L cobalamin disorder-associated mutation reveals normal and pathogenic THAP11 functions in gene expression and cell proliferation
- Lesion of striatal patches disrupts habitual behaviors and increases behavioral variability
- A clinical method for estimating the modulus of elasticity of the human cornea in vivo
- Gamma gap thresholds and HIV, hepatitis C, and monoclonal gammopathy
- Infective endocarditis post-transcatheter aortic valve implantation (TAVI), microbiological profile and clinical outcomes: A systematic review
- Potentiation of curing by a broad-host-range self-transmissible vector for displacing resistance plasmids to tackle AMR
- An acceleration in hypertension-related mortality for middle-aged and older Americans, 1999-2016: An observational study
- Two common disease-associated TYK2 variants impact exon splicing and TYK2 dosage
- Patient perceived value of teleophthalmology in an urban, low income US population with diabetes
- Real-world cost-effectiveness of rivaroxaban compared with vitamin K antagonists in the context of stroke prevention in atrial fibrillation in France
- Spatial risk assessment of global change impacts on Swedish seagrass ecosystems
- The effects of low-carbohydrate diets on cardiovascular risk factors: A meta-analysis
- Computational analysis of functional single nucleotide polymorphisms associated with SLC26A4 gene
- Evidence in support of chromosomal sex influencing plasma based metabolome vs APOE genotype influencing brain metabolome profile in humanized APOE male and female mice
- Accelerated sparsity based reconstruction of compressively sensed multichannel EEG signals
- A multicenter case control study of association of vitamin D with breast cancer among women in Karachi, Pakistan
- Microvesicles from Lactobacillus reuteri (DSM-17938) completely reproduce modulation of gut motility by bacteria in mice
- Chemical profiling of Curatella americana Linn leaves by UPLC-HRMS and its wound healing activity in mice
- “Yellow” laccase from Sclerotinia sclerotiorum is a blue laccase that enhances its substrate affinity by forming a reversible tyrosyl-product adduct
- Dense carbon-nanotube coating scaffolds stimulate osteogenic differentiation of mesenchymal stem cells
- Gamma Knife radiosurgery for vestibular schwannomas: Evaluation of planning using the sphericity degree of the target volume
- Variants in ADIPOQ gene are linked to adiponectin levels and lung function in young males independent of obesity
- Purification and molecular characterization of phospholipase, antigen 5 and hyaluronidases from the venom of the Asian hornet (Vespa velutina)
- Clinical state tracking in serious mental illness through computational analysis of speech
- Why are animal source foods rarely consumed by 6-23 months old children in rural communities of Northern Ethiopia? A qualitative study
- A study to better understand under-utilization of laboratory tests for antenatal care in Senegal
- Monitoring the ‘diabetes epidemic’: A framing analysis of United Kingdom print news 1993-2013
- Heart rate variability helps to distinguish the intensity of menopausal symptoms: A prospective, observational and transversal study
- Physicians’ perspectives regarding non-medical switching of prescription medications: Results of an internet e-survey
- Trophic ecology of Mexican Pacific harbor seal colonies using carbon and nitrogen stable isotopes
- Effectiveness of information technology–enabled ‘SMART Eating’ health promotion intervention: A cluster randomized controlled trial
- Cauda Equina Syndrome Core Outcome Set (CESCOS): An international patient and healthcare professional consensus for research studies
- Incidence and prediction of intraoperative and postoperative cardiac arrest requiring cardiopulmonary resuscitation and 30-day mortality in non-cardiac surgical patients
- Microscopic distance from tumor invasion front to serosa might be a useful predictive factor for peritoneal recurrence after curative resection of T3-gastric cancer
- A new species of Macrocypraea (Gastropoda, Cypraeidae) from Trindade Island, Brazil, including phenotypic differentiation from remaining congeneric species
- The evolving topology of the Lightning Network: Centralization, efficiency, robustness, synchronization, and anonymity
- Avoid jumping to conclusions under uncertainty in Obsessive Compulsive Disorder
- Tanopicobia gen. nov., a new genus of quill mites, its phylogenetic placement in the subfamily Picobiinae (Acariformes: Syringophilidae) and picobiine relationships with avian hosts
- Large-scale spatial variation of chronic stress signals in moose
- Complex situations: Economic insecurity, mental health, and substance use among pregnant women who consider – but do not have – abortions
- Well-being and entrepreneurship: Using establishment size to identify treatment effects and transmission mechanisms
- Models of protein production along the cell cycle: An investigation of possible sources of noise
- Protein-protein interactions underlying the behavioral and psychological symptoms of dementia (BPSD) and Alzheimer’s disease
- Assessing the feasibility of a life history calendar to measure HIV risk and health in older South Africans
- Prevalence of anaemia and low intake of dietary nutrients in pregnant women living in rural and urban areas in the Ashanti region of Ghana
- Enhancing performance of subject-specific models via subject-independent information for SSVEP-based BCIs
- Perceptions of and interest in HIV pre-exposure prophylaxis use among adolescent girls and young women in Lilongwe, Malawi
- Long term conjugated linoleic acid supplementation modestly improved growth performance but induced testicular tissue apoptosis and reduced sperm quality in male rabbit
- A new approach to the temporal significance of house orientations in European Early Neolithic settlements
- Meta-analysis of the radiological and clinical features of Usual Interstitial Pneumonia (UIP) and Nonspecific Interstitial Pneumonia (NSIP)
- Extreme mortality and reproductive failure of common murres resulting from the northeast Pacific marine heatwave of 2014-2016
- Persistence of chikungunya ECSA genotype and local outbreak in an upper medium class neighborhood in Northeast Brazil
- Fecal transplant prevents gut dysbiosis and anxiety-like behaviour after spinal cord injury in rats
- In vivo elongation of thin filaments results in heart failure
- High resolution respirometry to assess function of mitochondria in native homogenates of human heart muscle
- Disparity in depressive symptoms between heterosexual and sexual minority men in China: The role of social support
- Effect of classroom intervention on student food selection and plate waste: Evidence from a randomized control trial
- Cytomegalovirus-specific CD8+ T-cell responses are associated with arterial blood pressure in people living with HIV
- In-depth hepatoprotective mechanistic study of Phyllanthus niruri: In vitro and in vivo studies and its chemical characterization
- Content shared on social media for national cancer survivors day 2018
- Cost-effectiveness of alectinib compared to crizotinib for the treatment of first-line ALK+ advanced non-small-cell lung cancer in France
- Mating strategy is determinant of adenovirus prevalence in European bats
- Preventing HIV and HSV-2 through knowledge and attitudes: A replication study of a multi-component community-based intervention in Zimbabwe
- MLST-based genetic relatedness of Campylobacter jejuni isolated from chickens and humans in Poland
- Unraveling the polychromy and antiquity of the Pachacamac Idol, Pacific coast, Peru
- Randomized clinical trial analyzing maintenance of peripheral venous catheters in an internal medicine unit: Heparin vs. saline
- Hypertension prevalence but not control varies across the spectrum of risk in patients with atrial fibrillation: A RE-LY atrial fibrillation registry sub-study
- Valuing natural habitats for enhancing coastal resilience: Wetlands reduce property damage from storm surge and sea level rise
- Universal coverage but unmet need: National and regional estimates of attrition across the diabetes care continuum in Thailand
- Patient-related factors may influence nursing perception of sleep in the Intensive Care Unit
- A systematic review and meta-analysis of acute kidney injury in the intensive care units of developed and developing countries
- Phylogeographic analyses point to long-term survival on the spot in micro-endemic Lycian salamanders
- A randomized trial of a behavioral intervention to decrease hospital length of stay by decreasing bedrest
- Genlisea hawkingii (Lentibulariaceae), a new species from Serra da Canastra, Minas Gerais, Brazil
- Structural variation and its potential impact on genome instability: Novel discoveries in the EGFR landscape by long-read sequencing
- Assessment of forest cover and carbon stock changes in sub-tropical pine forest of Azad Jammu & Kashmir (AJK), Pakistan using multi-temporal Landsat satellite data and field inventory
- Color image segmentation using adaptive hierarchical-histogram thresholding
- The association between nonalcoholic fatty liver disease and esophageal, stomach, or colorectal cancer: National population-based cohort study
- Effects in spite of tough constraints - A theory of change based investigation of contextual and implementation factors affecting the results of a performance based financing scheme extended to malnutrition in Burundi
- Comparison of motif-based and whole-unique-sequence-based analyses of phage display library datasets generated by biopanning of anti-Borrelia burgdorferi immune sera
- Identification of the cleavage sites leading to the shed forms of human and mouse anti-aging and cognition-enhancing protein Klotho
- Research performance and age explain less than half of the gender pay gap in New Zealand universities
- Do bumblebees have signatures? Demonstrating the existence of a speed-curvature power law in Bombus terrestris locomotion patterns
- A primary healthcare information intervention for communicating cardiovascular risk to patients with poorly controlled hypertension: The Education and Coronary Risk Evaluation (Educore) study—A pragmatic, cluster-randomized trial
- “I did not know it was a medical condition”: Predictors, severity and help seeking behaviors of women with female sexual dysfunction in the Volta region of Ghana
- The role of services content for manufacturing competitiveness: A network analysis
- Mortality and demographic recovery in early post-black death epidemics: Role of recent emigrants in medieval Dijon
- Modelling the impact of migrants on the success of the HIV care and treatment program in Botswana
- Does squatting need attention?—A dual-task study on cognitive resources in resistance exercise
- A human mission to Mars: Predicting the bone mineral density loss of astronauts
- The role of demographic history and selection in shaping genetic diversity of the Galápagos penguin (Spheniscus mendiculus)
- Attitudes towards animal study registries and their characteristics: An online survey of three cohorts of animal researchers
- Risk perception and behavioral change during epidemics: Comparing models of individual and collective learning
- Drug-target interaction prediction using Multi Graph Regularized Nuclear Norm Minimization
- A preliminary study of resting brain metabolism in treatment-resistant depression before and after treatment with olanzapine-fluoxetine combination
- Use of serum KL-6 level for detecting patients with restrictive allograft syndrome after lung transplantation
- Gait asymmetry in glucocerebrosidase mutation carriers with Parkinson’s disease
- Radioiodine therapy and Graves’ disease – Myths and reality
- pyKNEEr: An image analysis workflow for open and reproducible research on femoral knee cartilage
- Creatinine versus cystatin C for renal function-based mortality prediction in an elderly cohort: The Northern Manhattan Study
- Risk factors for third-generation cephalosporin resistant Enterobacteriaceae in gestational urine cultures: A retrospective cohort study based on centralized electronic health records
- Population-based estimates of humoral autoimmunity from the U.S. National Health and Nutrition Examination Surveys, 1960–2014
- Residential neighbourhood greenspace is associated with reduced risk of cardiovascular disease: A prospective cohort study
- Circulating CTRP9 correlates with the prevention of aortic calcification in renal allograft recipients
- Potential socioeconomic impacts from ocean acidification and climate change effects on Atlantic Canadian fisheries
- Prevention and control of cholera with household and community water, sanitation and hygiene (WASH) interventions: A scoping review of current international guidelines
- Kinematic analysis of motor learning in upper limb body-powered bypass prosthesis training
- The treeness of the tree of historical trees of life
- Female finches prefer courtship signals indicating male vigor and neuromuscular ability
- The effect of spatial position and age within an egg-clutch on embryonic development and key metabolic enzymes in two clownfish species, Amphiprion ocellaris and Amphiprion frenatus
- Egg donors’ motivations, experiences, and opinions: A survey of egg donors in South Africa
- Polymer-free sirolimus-eluting stent use in Europe and Asia: Ethnic differences in demographics and clinical outcomes
- How “simple” methodological decisions affect interpretation of population structure based on reduced representation library DNA sequencing: A case study using the lake whitefish
- The impact of translated reminder letters and phone calls on mammography screening booking rates: Two randomised controlled trials
- Application of a genetic algorithm to the keyboard layout problem
- Design and evaluation of a laboratory-based wheelchair castor testing protocol using community data
- Relationship between diabetic macular edema and choroidal layer thickness
- Evaluation of the predictive ability of ultrasound-based assessment of breast cancer using BI-RADS natural language reporting against commercial transcriptome-based tests
- A Comprehensive Data Gathering Network Architecture in Large-Scale Visual Sensor Networks
- Recovery of health-related quality of life after burn injuries: An individual participant data meta-analysis
- Modeling aggressive market order placements with Hawkes factor models
- Higher prevalence of splenic artery aneurysms in hereditary hemorrhagic telangiectasia: Vascular implications and risk factors
- Measuring the diffusion of innovations with paragraph vector topic models
- Role of ecology in shaping external nasal morphology in bats and implications for olfactory tracking
- Neandertals on the beach: Use of marine resources at Grotta dei Moscerini (Latium, Italy)
- Allergic inflammation is initiated by IL-33–dependent crosstalk between mast cells and basophils
- High expression of olfactomedin-4 is correlated with chemoresistance and poor prognosis in pancreatic cancer
- Wattpad as a resource for literary studies. Quantitative and qualitative examples of the importance of digital social reading and readers’ comments in the margins
- Constructing and influencing perceived authenticity in science communication: Experimenting with narrative
- Development and validation of a prognostic model predicting symptomatic hemorrhagic transformation in acute ischemic stroke at scale in the OHDSI network
- Immune recovery markers in a double blind clinical trial comparing dolutegravir and raltegravir based regimens as initial therapy (SPRING-2)
- A non-canonical role for p27Kip1 in restricting proliferation of corneal endothelial cells during development
- Combined fiscal policies to promote healthier diets: Effects on purchases and consumer welfare
- Estimating the impact of drug use on US mortality, 1999-2016
- Complex patterns of cell growth in the placenta in normal pregnancy and as adaptations to maternal diet restriction
- Tofu intake is inversely associated with risk of breast cancer: A meta-analysis of observational studies
- Digging the diversity of Iberian bait worms Marphysa (Annelida, Eunicidae)
- Influence of light on the infection of Aureococcus anophagefferens CCMP 1984 by a “giant virus”
- MESSAR: Automated recommendation of metabolite substructures from tandem mass spectra
- Temporal ordering of input modulates connectivity formation in a developmental neuronal network model of the cortex
- Healthy lifestyle index and its association with hypertension among community adults in Sri Lanka: A cross-sectional study
- Manual dexterity of mice during food-handling involves the thumb and a set of fast basic movements
- Research on an evolutionary game model and simulation of a cluster innovation network based on fairness preference
- Reconstructing Krassilovia mongolica supports recognition of a new and unusual group of Mesozoic conifers
- Selection of memory clinic patients for CSF biomarker assessment can be restricted to a quarter of cases by using computerized decision support, without compromising diagnostic accuracy
- From organ to cell: Multi-level telomere length assessment in patients with idiopathic pulmonary fibrosis
- Training interval in cardiopulmonary resuscitation
- Quantum isomer search
- Ultrastructure of light-activated axons following optogenetic stimulation to produce late-phase long-term potentiation
- Optimization of tissue sampling for Borrelia burgdorferi in white-footed mice (Peromyscus leucopus)
- How do critical care staff respond to organisational challenge? A qualitative exploration into personality types and cognitive processing in critical care
- Symmetric core-cohesive blockmodel in preschool children’s interaction networks
- Effects of supplemental creatine and guanidinoacetic acid on spatial memory and the brain of weaned Yucatan miniature pigs
- Predicting antibacterial activity from snake venom proteomes
- Community-Based Health Planning and Services Plus programme in Ghana: A qualitative study with stakeholders in two Systems Learning Districts on improving the implementation of primary health care
- An investigation of transportation practices in an Ontario swine system using descriptive network analysis
- Comparison of gridded precipitation datasets for rainfall-runoff and inundation modeling in the Mekong River Basin
- Functional interactions in patients with hemianopia: A graph theory-based connectivity study of resting fMRI signal
- PCR for the detection of pathogens in neonatal early onset sepsis
- Mercury and selenium concentrations in fishes of the Upper Colorado River Basin, southwestern United States: A retrospective assessment
- The effects of dual-task cognitive interference on gait and turning in Huntington’s disease
- Effects of Allium hookeri on gut microbiome related to growth performance in young broiler chickens
- Novel imaging biomarkers for mapping the impact of mild mitochondrial uncoupling in the outer retina in vivo
- Hyperkalemia treatment modalities: A descriptive observational study focused on medication and healthcare resource utilization
- Age and altitude of residence determine anemia prevalence in Peruvian 6 to 35 months old children
- Web service QoS prediction using improved software source code metrics
- Long term impact of PositiveLinks: Clinic-deployed mobile technology to improve engagement with HIV care
- Comparison of post-transplantation diabetes mellitus incidence and risk factors between kidney and liver transplantation patients
- Mothers’ oral health literacy and children’s oral health status in Pikine, Senegal: A pilot study
- A definition-by-example approach and visual language for activity patterns in engineering disciplines
- A network analysis revealed the essential and common downstream proteins related to inguinal hernia
- Use of conventional cardiac troponin assay for diagnosis of non-ST-elevation myocardial infarction: ‘The Ottawa Troponin Pathway’
- Low risk pregnancies after a cesarean section: Determinants of trial of labor and its failure
- Exploratory analysis of the potential for advanced diagnostic testing to reduce healthcare expenditures of patients hospitalized with meningitis or encephalitis
- Airway epithelial specific deletion of Jun-N-terminal kinase 1 attenuates pulmonary fibrosis in two independent mouse models
- Identification and characterization of miRNAs involved in cold acclimation of zebrafish ZF4 cells
- Research on motion planning for an indoor spray arm based on an improved potential field method
- Camera-traps are a cost-effective method for surveying terrestrial squamates: A comparison with artificial refuges and pitfall traps
- Detailed analysis of the transverse arch of hallux valgus feet with and without pain using weightbearing ultrasound imaging and precise force sensors
- The role of survivin in the progression of pancreatic ductal adenocarcinoma (PDAC) and a novel survivin-targeted therapeutic for PDAC
- Filling the human resource gap through public-private partnership: Can private, community-based skilled birth attendants improve maternal health service utilization and health outcomes in a remote region of Bangladesh?
- HIV antiretroviral drugs, dolutegravir, maraviroc and ritonavir-boosted atazanavir use different pathways to affect inflammation, senescence and insulin sensitivity in human coronary endothelial cells
- Still standing: Recent patterns of post-fire conifer refugia in ponderosa pine-dominated forests of the Colorado Front Range
- Surrogate R-spondins for tissue-specific potentiation of Wnt Signaling
- Biogeographic study of human gut-associated crAssphage suggests impacts from industrialization and recent expansion
- Apolipoprotein-AI mimetic peptides D-4F and L-5F decrease hepatic inflammation and increase insulin sensitivity in C57BL/6 mice
- Treating patients with driving phobia by virtual reality exposure therapy – a pilot study
- The impact of race relations on NFL attendance: An econometric analysis
- The potential impact of the Affordable Care Act and Medicaid expansion on reducing colorectal cancer screening disparities in African American males
- Efficient processing of raster and vector data
- Rewilding with large herbivores: Positive direct and delayed effects of carrion on plant and arthropod communities
- Early life experience and alterations of group composition shape the social grooming networks of former pet and entertainment chimpanzees (Pan troglodytes)
- Muscarinic modulation of M and h currents in gerbil spherical bushy cells
- Therapeutic hypothermia after out of hospital cardiac arrest improve 1-year survival rate for selective patients
- Carotid plaques and neurological impairment in patients with acute cerebral infarction
- Deep learning based image reconstruction algorithm for limited-angle translational computed tomography
- Subterranean Deuteraphorura Absolon, 1901, (Hexapoda, Collembola) of the Western Carpathians — Troglomorphy at the northern distributional limit in Europe
- Fragmentation and inefficiencies in US equity markets: Evidence from the Dow 30
- Association between coffee drinking and telomere length in the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial
- Hyperbaric oxygen preconditioning and the role of NADPH oxidase inhibition in postischemic acute kidney injury induced in spontaneously hypertensive rats
- Rad51 paralogs and the risk of unselected breast cancer: A case-control study
- Aqueous ethanol extract of Libidibia ferrea (Mart. Ex Tul) L.P. Queiroz (juca) exhibits antioxidant and migration-inhibiting activity in human gastric adenocarcinoma (ACP02) cells
- Diagnostic differences in respiratory breathing patterns and work of breathing indices in children with Duchenne muscular dystrophy
- The role of narrative in collaborative reasoning and intelligence analysis: A case study
- Proportions of CD4 test results indicating advanced HIV disease remain consistently high at primary health care facilities across four high HIV burden countries
- Modelling of amino acid turnover in the horse during training and racing: A basis for developing a novel supplementation strategy
- Single-modal and multi-modal false arrhythmia alarm reduction using attention-based convolutional and recurrent neural networks
- Eye-gaze information input based on pupillary response to visual stimulus with luminance modulation
- Predictive value of comb-push ultrasound shear elastography for the differentiation of reactive and metastatic axillary lymph nodes: A preliminary investigation
- Type 1 diabetes is associated with an increased risk of venous thromboembolism: A retrospective population-based cohort study
- Trends of litter decomposition and soil organic matter stocks across forested swamp environments of the southeastern US
- Post mortem evaluation of inflammation, oxidative stress, and PPARγ activation in a nonhuman primate model of cardiac sympathetic neurodegeneration
- Were ancient foxes far more carnivorous than recent ones?—Carnassial morphological evidence
- Disruption in daily eating-fasting and activity-rest cycles in Indian adolescents attending school
- Plasma proteome profiling of freshwater and seawater life stages of rainbow trout (Oncorhynchus mykiss)
- Association between baseline abundance of Peptoniphilus, a Gram-positive anaerobic coccus, and wound healing outcomes of DFUs
- The earliest farming communities north of the Carpathians: The settlement at Gwoździec site 2
- Trends of the prevalence and incidence of hypertrophic cardiomyopathy in Korea: A nationwide population-based cohort study
- Percent amplitude of fluctuation: A simple measure for resting-state fMRI signal at single voxel level
- Antimicrobial activity of Asteraceae species against bacterial pathogens isolated from postmenopausal women
- Designing information provision to serve as a reminder of altruistic benefits: A case study of the risks of air pollution caused by industrialization
- Are changes in depressive symptoms, general health and residential area socio-economic status associated with trajectories of waist circumference and body mass index?
- Extracellular vesicles of U937 macrophage cell line infected with DENV-2 induce activation in endothelial cells EA.hy926
- FlexGraph: Flexible partitioning and storage for scalable graph mining
- Post-weaning infant-to-mother bonding in nutritionally independent female mice
- A little good is good enough: Ethical consumption, cheap excuses, and moral self-licensing
- Link-centric analysis of variation by demographics in mobile phone communication patterns
- Multimodal hand gesture recognition using single IMU and acoustic measurements at wrist
- Variance based weighting of multisensory head rotation signals for verticality perception
- Eligibility for hepatitis B antiviral therapy among adults in the general population in Zambia
- Tobacco smoking and health-related quality of life among university students: Mediating effect of depression
- Drivers of the opioid crisis: An appraisal of financial conflicts of interest in clinical practice guideline panels at the peak of opioid prescribing
- Nutritional inadequacies in commercial vegan foods for dogs and cats
- LTA1 and dmLT enterotoxin-based proteins activate antigen-presenting cells independent of PKA and despite distinct cell entry mechanisms
- The Shapley value for a fair division of group discounts for coordinating cooling loads
- Comparison and evaluation of the morphology of crowns generated by biogeneric design technique with CEREC chairside system
- Assessing risk factors and impact of cyberbullying victimization among university students in Myanmar: A cross-sectional study
- Incidence of hospital-acquired pressure ulcers in patients with "minimal risk" according to the "Norton-MI" scale
- Intra-host symbiont diversity in eastern Pacific cold seep tubeworms identified by the 16S-V6 region, but undetected by the 16S-V4 region
- Lipoprotein(a) plasma levels are not associated with survival after acute coronary syndromes: An observational cohort study
- Use of Nanotrap particles for the capture and enrichment of Zika, chikungunya and dengue viruses in urine
- Pancreatic secretory trypsin inhibitor reduces multi-organ injury caused by gut ischemia/reperfusion in mice
- The effect of diet on the gastrointestinal microbiome of juvenile rehabilitating green turtles (Chelonia mydas)
- Biochemical characterization of Ty1 retrotransposon protease
- Lateral pressure equalisation as a principle for designing support surfaces to prevent deep tissue pressure ulcers
- Immunomodulatory function of the cystic fibrosis modifier gene BPIFA1
- The validation of the Beijing version of the Montreal Cognitive Assessment in Chinese patients undergoing hemodialysis
- All of gene expression (AOE): An integrated index for public gene expression databases
- Characterization of the visceral and neuronal phenotype of 4L/PS-NA mice modeling Gaucher disease
- Inflammasome expression is higher in ovarian tumors than in normal ovary
- HCV genotype profile in Brazil of mono-infected and HIV co-infected individuals: A survey representative of an entire country
- Engaging with change: Information and communication technology professionals’ perspectives on change at the mid-point in the UK/EU Brexit process
- Adherence to iron-folic acid supplement and associated factors among antenatal care attending pregnant mothers in governmental health institutions of Adwa town, Tigray, Ethiopia: Cross-sectional study
- Flower, seed, and fruit development in three Tunisian species of Polygonum: Implications for their taxonomy and evolution of distyly in Polygonaceae
- Development of a risk score for prediction of poor treatment outcomes among patients with multidrug-resistant tuberculosis
- Preclinical evaluation of AT-527, a novel guanosine nucleotide prodrug with potent, pan-genotypic activity against hepatitis C virus
- Aqueous extract from Mangifera indica Linn. (Anacardiaceae) leaves exerts long-term hypoglycemic effect, increases insulin sensitivity and plasma insulin levels on diabetic Wistar rats
- Marine seafood production via intense exploitation and cultivation in China: Costs, benefits, and risks
- Signatures of medical student applicants and academic success
- Discovery of Jogalong virus, a novel hepacivirus identified in a Culex annulirostris (Skuse) mosquito from the Kimberley region of Western Australia
- The effects of extended photoperiod and warmth on hair growth in ponies and horses at different times of year
- Modeling the effect of prolonged ethanol exposure on global gene expression and chromatin accessibility in normal 3D colon organoids
- Clinical, cytogenetic and molecular genetic characterization of a tandem fusion translocation in a male Holstein cattle with congenital hypospadias and a ventricular septal defect
- Severity of misophonia symptoms is associated with worse cognitive control when exposed to misophonia trigger sounds
- Detection of Torque Teno Virus (TTV) and TTV-Like Minivirus in patients with presumed infectious endophthalmitis in India
- CD4 rate of increase is preferred to CD4 threshold for predicting outcomes among virologically suppressed HIV-infected adults on antiretroviral therapy
- The evolution of secondary flow phenomena and their effect on primary shock conditions in shock tubes: Experimentation and numerical model
- Estimating the basic reproduction number of a pathogen in a single host when only a single founder successfully infects
- What drugs modify the risk of iatrogenic impulse-control disorders in Parkinson’s disease? A preliminary pharmacoepidemiologic study
- Evaluating emotional distress and health-related quality of life in patients with heart failure and their family caregivers: Testing dyadic dynamics using the Actor-Partner Interdependence Model
- Community- and trophic-level responses of soil nematodes to removal of a non-native tree at different stages of invasion
- Association of ECG parameters with late gadolinium enhancement and outcome in patients with clinical suspicion of acute or subacute myocarditis referred for CMR imaging
- Sonographic measurement of normal common bile duct diameter and associated factors at the University of Gondar comprehensive specialized hospital and selected private imaging center in Gondar town, North West Ethiopia
- Catchment-scale export of antibiotic resistance genes and bacteria from an agricultural watershed in central Iowa
- Impact of multi-drug resistant bacteria on economic and clinical outcomes of healthcare-associated infections in adults: Systematic review and meta-analysis
- Characterization of a universal screening approach for congenital CMV infection based on a highly-sensitive, quantitative, multiplex real-time PCR assay
- Proof-of-concept for a non-invasive, portable, and wireless device for cardiovascular monitoring in pediatric patients
- On PTV definition for glioblastoma based on fiber tracking of diffusion tensor imaging data
- Multiregional origins of the domesticated tetraploid wheats
- Racism against Totonaco women in Veracruz: Intercultural competences for health professionals are necessary
- Increased inflammation and endothelial markers in patients with late severe post-thrombotic syndrome
- Genes associated with body weight gain and feed intake identified by meta-analysis of the mesenteric fat from crossbred beef steers
- Intraoperative computed tomography imaging for dose calculation in intraoperative electron radiation therapy: Initial clinical observations
- Multiple paedomorphic lineages of soft-substrate burrowing invertebrates: parallels in the origin of Xenocratena and Xenoturbella
- Human lung epithelial BEAS-2B cells exhibit characteristics of mesenchymal stem cells
- Simple non-mydriatic retinal photography is feasible and demonstrates retinal microvascular dilation in Chronic Obstructive Pulmonary Disease (COPD)
- Evaluating poverty alleviation strategies in a developing country
- RNAmountAlign: Efficient software for local, global, semiglobal pairwise and multiple RNA sequence/structure alignment
- Maternal depressive symptoms and children’s cognitive development: Does early childcare and child’s sex matter?
- Pan-cancer analysis of somatic mutations and epigenetic alterations in insulated neighbourhood boundaries
- Evaluation of a bioengineered ACL matrix’s osteointegration with BMP-2 supplementation
- Psychosocial profiles of physical activity fluctuation in office employees: A latent profile analysis
- Prevalence and characteristics of Livestock-Associated Methicillin-Resistant Staphylococcus aureus (LA-MRSA) isolated from chicken meat in the province of Quebec, Canada
- HIV treatment response among female sex workers participating in a treatment as prevention demonstration project in Cotonou, Benin
- Soluble AXL as a marker of disease progression and survival in melanoma
- Using machine learning methods to determine a typology of patients with HIV-HCV infection to be treated with antivirals
- Quantifying tourism booms and the increasing footprint in the Arctic with social media data
- Gender differences influence over insomnia in Korean population: A cross-sectional study
- Impact of scion/rootstock reciprocal effects on metabolomics of fruit juice and phloem sap in grafted Citrus reticulata
- Adapting cognitive diagnosis computerized adaptive testing item selection rules to traditional item response theory
- Usability assessment of seven HIV self-test devices conducted with lay-users in Johannesburg, South Africa
- Autumn shifts in cold tolerance metabolites in overwintering adult mountain pine beetles
- Management of veterinary anaesthesia in small animals: A survey of current practice in Quebec
- Genetic structure of the European hedgehog (Erinaceus europaeus) in Denmark
- Molecular karyotyping of Siberian wild rye (Elymus sibiricus L.) with oligonucleotide fluorescence in situ hybridization (FISH) probes
- Umbilical cord separation time, predictors and healing complications in newborns with dry care
- The strain distribution in the lumbar anterior longitudinal ligament is affected by the loading condition and bony features: An in vitro full-field analysis
- Marine resource congestion in China: Identifying, measuring, and assessing its impact on sustainable development of the marine economy
- Analysis of attitudinal components towards statistics among students from different academic degrees
- Effects of fatigue induced by repeated-sprint on kicking accuracy and velocity in female soccer players
- A pre-clinical validation plan to evaluate analytical sensitivities of molecular diagnostics such as BD MAX MDR-TB, Xpert MTB/Rif Ultra and FluoroType MTB
- Leadership for success in transforming medical abortion policy in Canada
- Clinical correlates associated with the long-term response of bipolar disorder patients to lithium, valproate or lamotrigine: A retrospective study
- Determinants of change in long-acting or permanent contraceptives use in Ethiopia; A multivariate decomposition analysis of data from the Ethiopian demographic and health survey
- Forecasting stock prices with long-short term memory neural network based on attention mechanism
- On the genus Crossaster (Echinodermata: Asteroidea) and its distribution
- Intracellular and in vivo evaluation of imidazo[2,1-b]thiazole-5-carboxamide anti-tuberculosis compounds
- Serum amyloid P component promotes formation of distinct aggregated lysozyme morphologies and reduces toxicity in Drosophila flies expressing F57I lysozyme
- Optogenetically induced cellular habituation in non-neuronal cells
- An integrated vitamin E-coated polymer hybrid nanoplatform: A lucrative option for an enhanced in vitro macrophage retention for an anti-hepatitis B therapeutic prospect
- The effect of strontium and silicon substituted hydroxyapatite electrochemical coatings on bone ingrowth and osseointegration of selective laser sintered porous metal implants
- Modeling the Theory of Planned Behaviour to predict adherence to preventive dental visits in preschool children
- Molecular prevalence of Bartonella, Babesia, and hemotropic Mycoplasma species in dogs with hemangiosarcoma from across the United States
- Color discrimination and gas chromatography-mass spectrometry fingerprint based on chemometrics analysis for the quality evaluation of Schizonepetae Spica
- Comparisons of recurrence-free survival and overall survival between microwave versus radiofrequency ablation treatment for hepatocellular carcinoma: A multiple centers retrospective cohort study with propensity score matching
- Transcriptome-wide identification of novel circular RNAs in soybean in response to low-phosphorus stress
- Oral misoprostol, low dose vaginal misoprostol, and vaginal dinoprostone for labor induction: Randomized controlled trial
- The association between dietary patterns before and in early pregnancy and the risk of gestational diabetes mellitus (GDM): Data from the Malaysian SECOST cohort
- Gene expression noise in a complex artificial toxin expression system
- Dynamic Extreme Aneuploidy (DEA) in the vegetable pathogen Phytophthora capsici and the potential for rapid asexual evolution
- Assertive, trainable and older dogs are perceived as more dominant in multi-dog households
- Prediction of Uropathogens by Flow Cytometry and Dip-stick Test Results of Urine Through Multivariable Logistic Regression Analysis
- Accelerated brain aging towards transcriptional inversion in a zebrafish model of the K115fs mutation of human PSEN2
- Copper to Tuscany – Coals to Newcastle? The dynamics of metalwork exchange in early Italy
- The Brazilian TP53 mutation (R337H) and sarcomas
- Interleukin 6 is increased in preclinical HNSCC models of acquired cetuximab resistance, but is not required for maintenance of resistance
- Detection of amitraz resistance and reduced treatment efficacy in the Varroa Mite, Varroa destructor, within commercial beekeeping operations
- Impact of viral disease hypophagia on pig jejunal function and integrity
- Enzyme response of activated sludge to a mixture of emerging contaminants in continuous exposure
- Molecular evidence for horizontal transmission of chelonid alphaherpesvirus 5 at green turtle (Chelonia mydas) foraging grounds in Queensland, Australia
- Technology anxiety and resistance to change behavioral study of a wearable cardiac warming system using an extended TAM for older adults
- Evaluation and validation of 2D biomechanical models of the knee for radiograph-based preoperative planning in total knee arthroplasty
- Soil-Transmitted Helminth infections reduction in Bhutan: A report of 29 years of deworming
- Age-related differences in the temporal dynamics of spectral power during memory encoding
- cagA gene EPIYA motif genetic characterization from Colombian Helicobacter pylori isolates: Standardization of a molecular test for rapid clinical laboratory detection
- Mugharat an-Nachcharini: A specialized sheep-hunting camp reveals high-altitude habitats in the earliest Neolithic of the Central Levant
- Spectral characteristics of urine from patients with end-stage kidney disease analyzed using Raman Chemometric Urinalysis (Rametrix)
- Clinicians’ communication with patients receiving a MCI diagnosis: The ABIDE project
- Quantitative PCR provides a simple and accessible method for quantitative microbiota profiling
- Fast quantitative time lapse displacement imaging of endothelial cell invasion
- Two novel mutations in MSX1 causing oligodontia
- 7,200 years old constructions and mudbrick technology: The evidence from Tel Tsaf, Jordan Valley, Israel
- Tuberculosis recurrences and predictive factors in a vulnerable population in Catalonia
- Dome-shaped macula in children and adolescents
- Barriers in the access, diagnosis and treatment completion for tuberculosis patients in central and western Nepal: A qualitative study among patients, community members and health care workers
- Evaluation of KRAS, NRAS and BRAF mutations detection in plasma using an automated system for patients with metastatic colorectal cancer
- Targeted transcriptomic study of the implication of central metabolic pathways in mannosylerythritol lipids biosynthesis in Pseudozyma antarctica T-34
- Preliminary evidences of the presence of extracellular DNA single stranded forms in soil
- A comparison of quality of life between patients treated with different dialysis modalities in Taiwan
- The effectiveness of substance use interventions for homeless and vulnerably housed persons: A systematic review of systematic reviews on supervised consumption facilities, managed alcohol programs, and pharmacological agents for opioid use disorder
- Spatiotemporal characteristics and driving forces of construction land expansion in Yangtze River economic belt, China
- Comparison of Monocyte Distribution Width (MDW) and Procalcitonin for early recognition of sepsis
- Morphological association between the muscles and bones in the craniofacial region
- Transcriptome analysis of Actinidia chinensis in response to Botryosphaeria dothidea infection
- Evaluating two decision aids for Australian men supporting informed decisions about prostate cancer screening: A randomised controlled trial
- Serum galectins as potential biomarkers of inflammatory bowel diseases
- Linguistic Z-number weighted averaging operators and their application to portfolio selection problem
- Comparative study on skin protection activity of polyphenol-rich extract and polysaccharide-rich extract from Sargassum vachellianum
- Real-world data about emotional stress, disability and need for social care in a German IBD patient cohort
- The regenerative compatibility: A synergy between healthy ecosystems, environmental attitudes, and restorative experiences
- Fusion of augmented reality imaging with the endoscopic view for endonasal skull base surgery; a novel application for surgical navigation based on intraoperative cone beam computed tomography and optical tracking
- Functional characterization of NK cells in Mexican pediatric patients with acute lymphoblastic leukemia: Report from the Mexican Interinstitutional Group for the Identification of the Causes of Childhood Leukemia
- Radiomics signature for prediction of lateral lymph node metastasis in conventional papillary thyroid carcinoma
- Antenatal depression and its association with adverse birth outcomes in low and middle-income countries: A systematic review and meta-analysis
- Perceptions of risk and influences of choice in pregnant women with obesity. An evidence synthesis of qualitative research
- The role of refugee and migrant migration status on medication adherence: Mediation through illness perceptions
- Job stress and emotional exhaustion at work in Spanish workers: Does unhealthy work affect the decision to drive?
- Correction: Amphibians on the hotspot: Molecular biology and conservation in the South American Atlantic Rainforest
- Sexual risk classes among youth experiencing homelessness: Relation to childhood adversities, current mental symptoms, substance use, and HIV testing
- Time for change is now: Experiences of participants in a community-based approach for iron and folic acid supplementation in a rural county in Kenya, a qualitative study
- Non-invasive genetic monitoring for the threatened valley elderberry longhorn beetle
- Statistical learning for turboshaft helicopter accidents using logistic regression
- Vegetation change over seven years in the largest protected Pacific Northwest Bunchgrass Prairie remnant
- The effect of various metal-salts on the sedimentation of soil in a water-based suspension
- Using electronic health record system triggers to target delivery of a patient-centered intervention to improve venous thromboembolism prevention for hospitalized patients: Is there a differential effect by race?
- Effects of CK2β subunit down-regulation on Akt signalling in HK-2 renal cells
- Novel broad-spectrum activity-based probes to profile malarial cysteine proteases
- Health-related quality of life in cancer patients treated with immune checkpoint inhibitors: A systematic review on reporting of methods in randomized controlled trials
- Environmental tobacco smoke (ETS) and hyperlipidemia modified by perceived work stress
- Association between opioid analgesic therapy and initiation of buprenorphine management: An analysis of prescription drug monitoring program data
- Effect of a community-based approach of iron and folic acid supplementation on compliance by pregnant women in Kiambu County, Kenya: A quasi-experimental study
- Radiocarbon dating of two old African baobabs from India
- Improvement project in higher education institutions: A BPEP-based model
- An updated evaluation of serum sHER2, CA15.3, and CEA levels as biomarkers for the response of patients with metastatic breast cancer to trastuzumab-based therapies
- Genome-wide association study of metabolic syndrome in Korean populations
- The diagnostic accuracy of liver fibrosis in non-viral liver diseases using acoustic radiation force impulse elastography: A systematic review and meta-analysis
- Drug therapy problems and treatment satisfaction among ambulatory patients with epilepsy in a specialized hospital in Ethiopia
- Short- & long-term effects of monetary and non-monetary incentives to cooperate in public good games: An experiment
- Niche modeling reveals life history shifts in birds at La Brea over the last twenty millennia
- Morphological consequences of artificial cranial deformation: Modularity and integration
- Distributed flux balance analysis simulations of serial biomass fermentation by two organisms
- Plasma kynurenines and prognosis in patients with heart failure
- Occurrence and distribution of anthropogenic persistent organic pollutants in coastal sediments and mud shrimps from the wetland of central Taiwan
- Intensified visual clutter induces increased sympathetic signalling, poorer postural control, and faster torsional eye movements during visual rotation
- Restoration of cortical symmetry and binaural function: Cortical auditory evoked responses in adult cochlear implant users with single sided deafness
- A smartphone-enabled wireless and batteryless implantable blood flow sensor for remote monitoring of prosthetic heart valve function
- Gut microbiota composition alterations are associated with the onset of diabetes in kidney transplant recipients
- Shock index and TIMI risk index as valuable prognostic tools in patients with acute coronary syndrome complicated by cardiogenic shock
- Merit overrules theory of mind when young children share resources with others
- Economic burden of maternal morbidity – A systematic review of cost-of-illness studies
- Comparison of balance changes after inspiratory muscle or Otago exercise training
- Correction: Escherichia coli and Salmonella spp. isolated from Australian meat chickens remain susceptible to critically important antimicrobial agents
- Metabolic analysis of amino acids and vitamin B6 pathways in lymphoma survivors with cancer related chronic fatigue
- Cell-free DNA donor fraction analysis in pediatric and adult heart transplant patients by multiplexed allele-specific quantitative PCR: Validation of a rapid and highly sensitive clinical test for stratification of rejection probability
- Immunopathogenesis of canine chronic ulcerative stomatitis
- Correction: Quantification of speech and synchrony in the conversation of adults with autism spectrum disorder
- Efficacy and safety of ultrasonic circular cyclocoagulation with second-generation probe in glaucoma: A retrospective study
- Generalizing findings from a randomized controlled trial to a real-world study of the iLookOut, an online education program to improve early childhood care and education providers’ knowledge and attitudes about reporting child maltreatment
- Self-selection of food ingredients and agricultural by-products by the house cricket, Acheta domesticus (Orthoptera: Gryllidae): A holistic approach to develop optimized diets
- Machine learning detection of Atrial Fibrillation using wearable technology
- Comparative proteomic analysis of different stages of breast cancer tissues using ultra high performance liquid chromatography tandem mass spectrometer
- A cross-sectional study of psychopathy and khat abuse among prisoners in the correctional institution in Jimma, Ethiopia
- Head impulse compensatory saccades: Visual dependence is most evident in bilateral vestibular loss
- Complementarity of empirical and process-based approaches to modelling mosquito population dynamics with Aedes albopictus as an example—Application to the development of an operational mapping tool of vector populations
- Pepsin promotes laryngopharyngeal neoplasia by modulating signaling pathways to induce cell proliferation
- When and what to test for: A cost-effectiveness analysis of febrile illness test-and-treat strategies in the era of responsible antibiotic use
- Comparison of effects and safety in providing controlled hypotension during surgery between dexmedetomidine and magnesium sulphate: A meta-analysis of randomized controlled trials
- The gene encoding the ketogenic enzyme HMGCS2 displays a unique expression during gonad development in mice
- Seroepidemiological study of rubella in Vojvodina, Serbia: 24 years after the introduction of the MMR vaccine in the national immunization programme
- Efficacy of a mitochondrion-targeting agent for reducing the level of urinary protein in rats with puromycin aminonucleoside-induced minimal-change nephrotic syndrome
- Association of endothelial nitric oxide synthase (NOS3) gene polymorphisms with primary open-angle glaucoma in a Saudi cohort
- Antitrust analysis with upward pricing pressure and cost efficiencies
- Machine learning models for identifying preterm infants at risk of cerebral hemorrhage
- Natural selection contributes to food web stability
- Pyramiding QTLs controlling tolerance against drought, salinity, and submergence in rice through marker assisted breeding
- Diversity and plant growth-promoting functions of diazotrophic/N-scavenging bacteria isolated from the soils and rhizospheres of two species of Solanum
- Sustainability effects of motor control stabilisation exercises on pain and function in chronic nonspecific low back pain patients: A systematic review with meta-analysis and meta-regression
- Sofosbuvir-based regimen for genotype 2 HCV infected patients in Taiwan: A real world experience
- The virulence domain of Shigella IcsA contains a subregion with specific host cell adhesion function
- Sequencing artifacts derived from a library preparation method using enzymatic fragmentation
- Analysis of the Rdr1 gene family in different Rosaceae genomes reveals an origin of an R-gene cluster after the split of Rubeae within the Rosoideae subfamily
- Concomitant phytonutrient and transcriptome analysis of mature fruit and leaf tissues of tomato (Solanum lycopersicum L. cv. Oregon Spring) grown using organic and conventional fertilizer
- Quantitative analysis of adsorption and desorption of volatile organic compounds on reusable zeolite filters using gas chromatography
- Comparing bioinformatic pipelines for microbial 16S rRNA amplicon sequencing
- TMEM98 is a negative regulator of FRAT mediated Wnt/ß-catenin signalling
- Modeling migration patterns in the USA under sea level rise
- Quo vadis Pantanal? Expected precipitation extremes and drought dynamics from changing sea surface temperature
- Cloud-computing and machine learning in support of country-level land cover and ecosystem extent mapping in Liberia and Gabon
- An exploratory study on the quality of patient screening and counseling for hypertension management in Tanzania
- Relation of fibroblast growth factor receptor 2 expression to hepatocellular carcinoma recurrence after liver resection
- The Brief Measure of Emotional Preoperative Stress (B-MEPS) as a new predictive tool for postoperative pain: A prospective observational cohort study
- The impact of diabetes mellitus medication on the incidence of endogenous endophthalmitis
- Correction: Chl1 DNA helicase and Scc2 function in chromosome condensation through cohesin deposition
- Clinical and pathological features of thrombotic microangiopathy influencing long-term kidney transplant outcomes
- Multidisciplinary investigation of two Egyptian child mummies curated at the University of Tartu Art Museum, Estonia (Late/Graeco-Roman Periods)
- Occupational exposure to particulate matter from air pollution in the outdoor workplaces in Almaty during the cold season
- Morphological adjustment in free-living Steinernema feltiae infective juveniles to increasing concentration of Nemafric-BL phytonematicide
- Murine Surf4 is essential for early embryonic development
- Using mHealth to improve health care delivery in India: A qualitative examination of the perspectives of community health workers and beneficiaries
- Algorithmic handwriting analysis of the Samaria inscriptions illuminates bureaucratic apparatus in biblical Israel
- Key necroptotic proteins are required for Smac mimetic-mediated sensitization of cholangiocarcinoma cells to TNF-α and chemotherapeutic gemcitabine-induced necroptosis
- Concurrent lipidomics and proteomics on malignant plasma cells from multiple myeloma patients: Probing the lipid metabolome
- Short treatment with antalarmin alters adrenal gland receptors in the rat model of endometriosis
- Is it really always only the others who are to blame? GP’s view on medical overuse. A questionnaire study
- Serum visfatin and vaspin levels in hepatocellular carcinoma (HCC)
- Retraction: SDR9C7 Promotes Lymph Node Metastases in Patients with Esophageal Squamous Cell Carcinoma
- iTRAQ proteomics reveals the regulatory response to Magnaporthe oryzae in durable resistant vs. susceptible rice genotypes
- A smartphone-based test for the assessment of attention deficits in delirium: A case-control diagnostic test accuracy study in older hospitalised patients
- Association between tuberculosis and depression on negative outcomes of tuberculosis treatment: A systematic review and meta-analysis
- Incidence and predictors of loss to follow up among adult HIV patients on antiretroviral therapy in University of Gondar Comprehensive Specialized Hospital: A competing risk regression modeling
- Point-of-care diagnostic (POCD) method for detecting Bursaphelenchus xylophilus in pinewood using recombinase polymerase amplification (RPA) with the portable optical isothermal device (POID)
- Bioluminescent imaging of Arabidopsis thaliana using an enhanced Nano-lantern luminescence reporter system
- Biosynthetic pathway of indole-3-acetic acid in ectomycorrhizal fungi collected from northern Thailand
- Clinical implications of elevated serum interleukin-6 in IgG4-related disease
- Downscaling NLDAS-2 daily maximum air temperatures using MODIS land surface temperatures
- Sex-specific and opposite modulatory aspects revealed by PPI network and pathway analysis of ischemic stroke in humans
- Plasma Trimethylamine-N-oxide and impaired glucose regulation: Results from The Oral Infections, Glucose Intolerance and Insulin Resistance Study (ORIGINS)
- Self-esteem and other risk factors for depressive symptoms among adolescents in United Arab Emirates
- Control of the microsporidian parasite Nosema ceranae in honey bees (Apis mellifera) using nutraceutical and immuno-stimulatory compounds
- The effect of storage conditions on microbial communities in stool
- Role of donor genotype in RT-QuIC seeding activity of chronic wasting disease prions using human and bank vole substrates
- Influence of flow on phosphorus-dynamics and particle size in agricultural drainage ditch sediments
- A prospective, randomized, double-blind trial to compare body weight-adjusted and fixed doses of palonosetron for preventing postoperative nausea and vomiting in obese female patients
- Application of computerized 3D-CT texture analysis of pancreas for the assessment of patients with diabetes
- Predictive validation and forecasts of short-term changes in healthcare expenditure associated with changes in smoking behavior in the United States
- An information-based approach to handle various types of uncertainty in fuzzy bodies of evidence
- Oral magnesium supplementation for leg cramps in pregnancy—An observational controlled trial
- Health care professionals’ knowledge of commonly used sedative, analgesic and neuromuscular drugs: A single center (Rambam Health Care Campus), prospective, observational survey
- Campylobacter portucalensis sp. nov., a new species of Campylobacter isolated from the preputial mucosa of bulls
- OGG1 deficiency alters the intestinal microbiome and increases intestinal inflammation in a mouse model
- Transgenic interleukin 11 expression causes cross-tissue fibro-inflammation and an inflammatory bowel phenotype in mice
- Novel method to measure temporal windows based on eye movements during viewing of the Necker cube
- Whole blood transcriptomic analysis of beef cattle at arrival identifies potential predictive molecules and mechanisms that indicate animals that naturally resist bovine respiratory disease
- Effects of smoke flavoring using different wood chips and barbecuing on the formation of polycyclic aromatic hydrocarbons and heterocyclic aromatic amines in salmon fillets
- Sleep quality and sex modify the relationships between trait energy and fatigue on state energy and fatigue
- The role of peer, parental, and school norms in predicting adolescents’ attitudes and behaviours of majority and different minority ethnic groups in Croatia
- Filtered beauty in Oslo and Tokyo: A spatial frequency analysis of facial attractiveness
- The impact of rehabilitation frequency on the risk of stroke in patients with rheumatoid arthritis
- Availability, prices and affordability of selected antibiotics and medicines against non-communicable diseases in western Cameroon and northeast DR Congo
- The effect of mutations derived from mouse-adapted H3N2 seasonal influenza A virus to pathogenicity and host adaptation
- Detection of posttraumatic pneumothorax using electrical impedance tomography—An observer-blinded study in pigs with blunt chest trauma
- Educators’ perceptions of organisational readiness for implementation of a pre-adolescent transdisciplinary school health intervention for inter-generational outcomes
- Beyond the heterodimer model for mineralocorticoid and glucocorticoid receptor interactions in nuclei and at DNA
- The effects of sport expertise and shot results on basketball players’ action anticipation
- Framework and algorithms for identifying honest blocks in blockchain
- Efficacy and safety of anti-viral therapy for Hepatitis B virus-associated glomerulonephritis: A meta-analysis
- Selective transmission of some HIV-1 subtype C variants might depend on Envelope stimulating dendritic cells to secrete IL-10
- Noise reduction and quantification of fiber orientations in greyscale images
- Exploring the impact of terminology differences in blood and organ donor decision making
- Ontogenetic similarities between giraffe and sauropod neck osteological mobility
- Load transfer mechanism and critical length of anchorage zone for anchor bolt
- Income inequalities in stroke incidence and mortality: Trends in stroke-free and stroke-affected life years based on German health insurance data
- Community’s perception, experiences and health seeking behavior towards newborn illnesses in Debre Libanos District, North Shoa, Oromia, Ethiopia: Qualitative study
- Platelet indices significantly correlate with liver fibrosis in HCV-infected patients
- Reanalysis of the Bridge et al. study of suicide following release of 13 Reasons Why
- Validation of the easyscreen flavivirus dengue alphavirus detection kit based on 3base amplification technology and its application to the 2016/17 Vanuatu dengue outbreak
- The nitrate content of fresh and cooked vegetables and their health-related risks
- Bioreactor for mobilization of mesenchymal stem/stromal cells into scaffolds under mechanical stimulation: Preliminary results
- Serotonin transporter dependent modulation of food-seeking behavior
- Implicit task switching in Parkinson’s disease is preserved when on medication
- Root treatment with oxathiapiprolin, benthiavalicarb or their mixture provides prolonged systemic protection against oomycete foliar pathogens
- Real-world effectiveness and safety of ranibizumab for the treatment of myopic choroidal neovascularization: Results from the LUMINOUS study
- Non-gradient and genotype-dependent patterns of RSV gene expression
- Multiplex real-time PCR for the detection of Clavibacter michiganensis subsp. michiganensis, Pseudomonas syringae pv. tomato and pathogenic Xanthomonas species on tomato plants
- The 24-hour urinary cortisol in post-traumatic stress disorder: A meta-analysis
- Parasites modulate the gut-microbiome in insects: A proof-of-concept study
- The dynamics of shapes of vesicle membranes with time dependent spontaneous curvature
- Vascularization and biocompatibility of poly(ε-caprolactone) fiber mats for rotator cuff tear repair
- The shield of self-compassion: A buffer against disordered eating risk from physical appearance perfectionism
- Disease-specific out-of-pocket healthcare expenditure in urban Bangladesh: A Bayesian analysis
- Advanced biofilm analysis in streams receiving organic deicer runoff
- Upregulation of long non-coding RNA ROR1-AS1 promotes cell growth and migration in bladder cancer by regulation of miR-504
- Method development and validation for rapid identification of epigallocatechin gallate using ultra-high performance liquid chromatography
- Neonatal sepsis in Iran: A systematic review and meta-analysis on national prevalence and causative pathogens
- Drug-eluting versus bare-metal stents for first myocardial infarction in patients with atrial fibrillation: A nationwide population-based cohort study
- Same-day antiretroviral therapy initiation for HIV-infected adults in South Africa: Analysis of routine data
- Health-related quality of life among patients with type 2 diabetes mellitus in Eastern Province, Saudi Arabia: A cross-sectional study
- Photocatalytic biocidal effect of copper doped TiO2 nanotube coated surfaces under laminar flow, illuminated with UVA light on Legionella pneumophila
- The interoceptive hippocampus: Mouse brain endocrine receptor expression highlights a dentate gyrus (DG)–cornu ammonis (CA) challenge–sufficiency axis
- Educational attainment and HIV testing and counselling service utilisation during antenatal care in Ghana: Analysis of Demographic and Health Surveys
- Dissection of flag leaf metabolic shifts and their relationship with those occurring simultaneously in developing seed by application of non-targeted metabolomics
- Centromeres of Cucumis melo L. comprise Cmcent and two novel repeats, CmSat162 and CmSat189
- Acute high-intensity and moderate-intensity interval exercise do not change corticospinal excitability in low fit, young adults
- “I like the way I am, but I feel like I could get a little bit bigger”: Perceptions of body image among adolescents and youth living with HIV in Durban, South Africa
- Nanoparticle-based ‘turn-on’ scattering and post-sample fluorescence for ultrasensitive detection of water pollution in wider window
- The relationship of moral sensitivity and patient safety attitudes with nursing students’ perceptions of disclosure of patient safety incidents: A cross-sectional study
- Insights into the strategy of micro-environmental adaptation: Transcriptomic analysis of two alvinocaridid shrimps at a hydrothermal vent
- Thirty-day readmission after medical-surgical hospitalization for people who experience imprisonment in Ontario, Canada: A retrospective cohort study
- The effect of long-term brine discharge from desalination plants on benthic foraminifera
- Hyper-spectral response and estimation model of soil degradation in Kenli County, the Yellow River Delta
- Prescribing trends of glaucoma drugs in six major cities of China from 2013 to 2017
- Significant changes in synovial fluid microRNAs after high tibial osteotomy in medial compartmental knee osteoarthritis: Identification of potential prognostic biomarkers
- Reassortment and adaptive mutations of an emerging avian influenza virus H7N4 subtype in China
- Ischemia and reperfusion injury in superficial inferior epigastric artery-based vascularized lymph node flaps
- High failure rates of protease inhibitor-based antiretroviral treatment in rural Tanzania – A prospective cohort study
- Switchable resolution in soft x-ray tomography of single cells
- Mitochondrial DNA variations and mitochondrial dysfunction in Fanconi anemia
- Extended-spectrum beta-lactamase (ESBL)-producing and non-ESBL-producing Escherichia coli isolates causing bacteremia in the Netherlands (2014 – 2016) differ in clonal distribution, antimicrobial resistance gene and virulence gene content
- Molecular characterization of blaKHM-1 encoding plasmid in an Enterobacter hormaechei subsp. hoffmannii isolate from blood culture
- PR3 levels are impaired in plasma and PBMCs from Arabs with cardiovascular diseases
- Sex differences in self-regulation in early, middle and late adolescence: A large-scale cross-sectional study
- Interaction between elevated temperature and different types of Na-salicylate treatment in Brachypodium dystachion
- A highway crash risk assessment method based on traffic safety state division
- A brain connectivity characterization of children with different levels of mathematical achievement based on graph metrics
- Quantifying the level of difficulty to treat major depressive disorder with antidepressants: Treatment Resistance to Antidepressants Evaluation Scale
- Occupational gender segregation and economic growth in U.S. local labor markets, 1980 through 2010
- The association of telomere length and telomerase activity with adverse outcomes in older patients with non-ST-elevation acute coronary syndrome
- Construction of a high-density genetic map and fine mapping of a candidate gene locus for a novel branched-spike mutant in barley
- Alterations of aqueous humor Aβ levels in Aβ-infused and transgenic mouse models of Alzheimer disease
- Parameters impacting the live birth rate per transfer after frozen single euploid blastocyst transfer
- Deep2Full: Evaluating strategies for selecting the minimal mutational experiments for optimal computational predictions of deep mutational scan outcomes
- Economic compensation interventions to increase uptake of voluntary medical male circumcision for HIV prevention: A systematic review and meta-analysis
- Distinctive effect of anesthetics on the effect of limb remote ischemic postconditioning following ischemic stroke
- Natural hybridization between Phyllagathis and Sporoxeia species produces a hybrid without reproductive organs
- Preliminary evaluation of a novel nine-biomarker profile for the prediction of autism spectrum disorder
- The impact of peer attachment on prosocial behavior, emotional difficulties and conduct problems in adolescence: The mediating role of empathy
- Spatial and climatic variables independently drive elevational gradients in ant species richness in the Eastern Himalaya
- What is the qualitative evidence concerning the risks, diagnosis, management and consequences of gastrointestinal infections in the community in the United Kingdom? A systematic review and meta-ethnography
- Naringenin protects AlCl3/D-galactose induced neurotoxicity in rat model of AD via attenuation of acetylcholinesterase levels and inhibition of oxidative stress
- Key barriers and enablers associated with uptake and continuation of oral pre-exposure prophylaxis (PrEP) in the public sector in Zimbabwe: Qualitative perspectives of general population clients at high risk for HIV
- Characterizing the University of California’s tenure-track teaching position from the faculty and administrator perspectives
- Restoration of Mal overcomes the defects of apoptosis in lung cancer cells
- Patient preferences for maintenance therapy in Crohn’s disease: A discrete-choice experiment
- Diagnostic performance of serum interferon gamma, matrix metalloproteinases, and periostin measurements for pulmonary tuberculosis in Japanese patients with pneumonia
- Hesperidin improves insulin resistance via down-regulation of inflammatory responses: Biochemical analysis and in silico validation
- Accuracy of intraocular lens power calculation formulas using a swept-source optical biometer
- Characterization of black patina from the Tiber River embankments using Next-Generation Sequencing
- Comparison of blood lactate and perceived exertion responses in two matched time-under-tension protocols
- Fibrin hydrogels are safe, degradable scaffolds for sub-retinal implantation
- Post-translational modifications of Drosophila melanogaster HOX protein, Sex combs reduced
- Problem gambling, associations with comorbid health conditions, substance use, and behavioural addictions: Opportunities for pathways to treatment
- Liganded T3 receptor β2 inhibits the positive feedback autoregulation of the gene for GATA2, a transcription factor critical for thyrotropin production
- Characterization of METTL16 as a cytoplasmic RNA binding protein
- Impact of long-term storage and freeze-thawing on eight circulating microRNAs in plasma samples
- Nanosheet wrapping-assisted coverslip-free imaging for looking deeper into a tissue at high resolution
- Assessment of dynamic cerebral autoregulation in humans: Is reproducibility dependent on blood pressure variability?
- Early diagnosis of sepsis in emergency departments, time to treatment, and association with mortality: An observational study
- Validity of cerebrovascular ICD-9-CM codes in healthcare administrative databases. The Umbria Data-Value Project
- Tuberculoid leprosy: An in vivo microvascular evaluation of cutaneous lesions
- Neuromuscular blockers in the acute respiratory distress syndrome: A meta-analysis
- Identification of putative Type-I sex pheromone biosynthesis-related genes expressed in the female pheromone gland of Streltzoviella insularis
- Redefining transcriptional regulation of the APOE gene and its association with Alzheimer’s disease
- Disease-relevant mutations alter amino acid co-evolution networks in the second nucleotide binding domain of CFTR
- A bushel of viruses: Identification of seventeen novel putative viruses by RNA-seq in six apple trees
- Torque teno virus viral load is related to age, CMV infection and HLA type but not to Alzheimer's disease
- The variability of bacterial communities in both the endosphere and ectosphere of different niches in Chinese chives (Allium tuberosum)
- Tripartite factors leading to molecular divergence between human and murine smooth muscle
- Characterization of dermal skin innervation in fibromyalgia syndrome
- A neonatal nonhuman primate model of gestational Zika virus infection with evidence of microencephaly, seizures and cardiomyopathy
- A scoping review of importation and predictive models related to vector-borne diseases, pathogens, reservoirs, or vectors (1999–2016)
- Assessment of climate change impact on the malaria vector Anopheles hyrcanus, West Nile disease, and incidence of melanoma in the Vojvodina Province (Serbia) using data from a regional climate model
- Associations of cigarette smoking and burden of thoracic aortic calcification in asymptomatic individuals: A dose-response relationship
- Healthcare utilization of Mexican-American Medicare beneficiaries with and without Alzheimer’s disease and related dementias
- Evaluation of questionnaire as an instrument to measure the level of nutritional and weight gain knowledge in pregnant women in Poland. A pilot study
- TranCEP: Predicting the substrate class of transmembrane transport proteins using compositional, evolutionary, and positional information
- Non-Invasive Functional-Brain-Imaging with an OPM-based Magnetoencephalography System
- Expression of acyl-CoA-binding protein 5 from Rhodnius prolixus and its inhibition by RNA interference
- Transforming assessment of speech in children with cleft palate via online crowdsourcing
- High prevalence of off-label and unlicensed paediatric prescribing in a hospital in Indonesia during the period Aug.—Oct. 2014
- General practice management of rotator cuff related shoulder pain: A reliance on ultrasound and injection guided care
- Estimating the population size of female sex workers and transgender women in Sri Lanka
- Can helmet decrease mortality of craniocerebral trauma patients in a motorcycle accident?: A propensity score matching
- Obesity, smoking habits, and serum phosphate levels predicts mortality after life-style intervention
- Treatment of children under 4 years of age with medulloblastoma and ependymoma in the HIT2000/HIT-REZ 2005 trials: Neuropsychological outcome 5 years after treatment
- Can a semi-quantitative method replace the current quantitative method for the annual screening of microalbuminuria in patients with diabetes? Diagnostic accuracy and cost-saving analysis considering the potential health burden
- A two-arm parallel double-blind randomised controlled pilot trial of the efficacy of Omega-3 polyunsaturated fatty acids for the treatment of women with endometriosis-associated pain (PurFECT1)
- Association of benzodiazepines, opioids and tricyclic antidepressants use and falls in trauma patients: Conditional effect of age
- Burden and risk factors of cutaneous leishmaniasis in a peri-urban settlement in Kenya, 2016
- Predicting strike susceptibility and collision patterns of the common buzzard at wind turbine structures in the federal state of Brandenburg, Germany
- Embryonic thermal manipulation has short and long-term effects on the development and the physiology of the Japanese quail
- High-order radiomics features based on T2 FLAIR MRI predict multiple glioma immunohistochemical features: A more precise and personalized gliomas management
- Human-raptor conflict in rural settlements of Colombia
- Regional adaptations and parallel mutations in Feline panleukopenia virus strains from China revealed by nearly-full length genome analysis
- Long-term ecological research in southern Brazil grasslands: Effects of grazing exclusion and deferred grazing on plant and arthropod communities
- Assessment of peritoneal microbial features and tumor marker levels as potential diagnostic tools for ovarian cancer
- Survival analysis of 230 patients with unresectable hepatocellular carcinoma treated with bland transarterial embolization
- Adverse drug reaction reporting practice and associated factors among medical doctors in government hospitals in Addis Ababa, Ethiopia
- TaWAK6 encoding wall-associated kinase is involved in wheat resistance to leaf rust similar to adult plant resistance
- Deficiency syndromes in top predators associated with large-scale changes in the Baltic Sea ecosystem
- The inhibitor of apoptosis proteins antagonist Debio 1143 promotes the PD-1 blockade-mediated HIV load reduction in blood and tissues of humanized mice
- Allele specific expression of Dof genes responding to hormones and abiotic stresses in sugarcane
- Perceived relative social status and cognitive load influence acceptance of unfair offers in the Ultimatum Game
- Quantitative evaluation of choriocapillaris using optical coherence tomography and optical coherence tomography angiography in patients with central serous chorioretinopathy after half-dose photodynamic therapy
- Structure-function analyses of candidate small molecule RPN13 inhibitors with antitumor properties
- Extracting lung function measurements to enhance phenotyping of chronic obstructive pulmonary disease (COPD) in an electronic health record using automated tools
- Multiple fragmented habitat-patch use in an urban breeding passerine, the Short-toed Treecreeper
- Histological and immunohistochemical characterization of the porcine ocular surface
- Household environmental tobacco smoke exposure in healthy young children in Hong Kong: Prevalence and risk factors
- Wind energy development and wildlife conservation in Lithuania: A mapping tool for conflict assessment
- Characteristics and prognosis of primary treatment-naïve oral cavity squamous cell carcinoma in Norway, a descriptive retrospective study
- Effect of epoch length on intensity classification and on accuracy of measurement under controlled conditions on treadmill: Towards a better understanding of accelerometer measurement
- Peer distribution of HIV self-test kits to men who have sex with men to identify undiagnosed HIV infection in Uganda: A pilot study
- Error rates of human reviewers during abstract screening in systematic reviews
- Faecal analyses and alimentary tracers reveal the foraging ecology of two sympatric bats
- Urethral realignment with maximal urethral length and bladder neck preservation in robot-assisted radical prostatectomy: Urinary continence recovery
- Error metrics determination in functionally approximated circuits using SAT solvers
- Spatial movement pattern recognition in soccer based on relative player movements
- A novel visual ranking system based on arterial spin labeling perfusion imaging for evaluating perfusion disturbance in patients with ischemic stroke
- Prospective Validation of the Laboratory Risk Indicator for Necrotizing Fasciitis (LRINEC) Score for Necrotizing Fasciitis of the Extremities
- The importance of transporters and cell polarization for the evaluation of human stem cell-derived hepatic cells
- Incidence, trends, and outcomes of infection sites among hospitalizations of sepsis: A nationwide study
- Morphological and functional characteristics of mitral annular calcification and their relationship to stroke
- And the nominees are: Using design-awards datasets to build computational aesthetic evaluation model
- Service delivery interventions to increase uptake of voluntary medical male circumcision for HIV prevention: A systematic review
- Multidimensional Scales of Perceived Self-Efficacy (MSPSE): Measurement invariance across Italian and Colombian adolescents
- Diversity of Mycobacteriaceae from aquatic environment at the São Paulo Zoological Park Foundation in Brazil
- A graph-based algorithm for RNA-seq data normalization
- Parents’ underestimation of their child’s weight status. Moderating factors and change over time: A cross-sectional study
- Pharmacokinetics, absolute bioavailability and tolerability of ketamine after intranasal administration to dexmedetomidine sedated dogs
- Spatial variation in fertilizer prices in Sub-Saharan Africa
- Knowledge, beliefs, and concerns about bone health from a systematic review and metasynthesis of qualitative studies
- Successful isolation of Treponema pallidum strains from patients’ cryopreserved ulcer exudate using the rabbit model
- Effects of size and elasticity on the relation between flow velocity and wall shear stress in side-wall aneurysms: A lattice Boltzmann-based computer simulation study
- Pupil response to noxious corneal stimulation
- Incidence, risk factors and healthcare costs of central line-associated nosocomial bloodstream infections in hematologic and oncologic patients
- The impact of computed radiography and teleradiology on patients’ diagnosis and treatment in Mweso, the Democratic Republic of Congo
- Differential effects of synthetic psychoactive cathinones and amphetamine stimulants on the gut microbiome in mice
- Hepatitis B and C virus infection among HIV patients within the public and private healthcare systems in Chile: A cross-sectional serosurvey
- Increased episodes of aspiration on videofluoroscopic swallow study in children with nasogastric tube placement
- Obstructive sleep apnea and hypopnea syndrome in patients admitted in a tertiary hospital in Cameroon: Prevalence and associated factors
- Association of single nucleotide polymorphisms with dyslipidemia in antiretroviral exposed HIV patients in a Ghanaian population: A case-control study
- Sonic Hedgehog upregulation does not enhance the survival and engraftment of stem cell-derived cardiomyocytes in infarcted hearts
- The pharmacokinetic parameters and the effect of a single and repeated doses of memantine on gastric myoelectric activity in experimental pigs
- Blind method for discovering number of clusters in multidimensional datasets by regression on linkage hierarchies generated from random data
- Predictive factors of first dosage intravenous immunoglobulin-related adverse effects in children
- Description and characterization of the artisanal elasmobranch fishery on Guatemala’s Caribbean coast
- Individual and community level determinants of short birth interval in Ethiopia: A multilevel analysis
- Effects of rejection intensity and rejection sensitivity on social approach behavior in women
- The impact of IoT security labelling on consumer product choice and willingness to pay
- The development and validation of a measurement instrument to investigate determinants of health care utilisation for low back pain in Ethiopia
- Validity of the French version of the Autonomy Preference Index and its adaptation for patients with advanced cancer
- The epidemiological characteristics and spatio-temporal analysis of childhood hand, foot and mouth disease in Korea, 2011-2017
- Exponential random graph model parameter estimation for very large directed networks
- The implementation of community-based diabetes and hypertension management care program in Indonesia
- Effect of temperature variation on hospital admissions and outcomes in dogs with myxomatous mitral valve disease and new onset pulmonary edema
- The development of the Police Practices Scale: Understanding policing approaches towards street-based female sex workers in a U.S. City
- A capability approach to assess aquaculture sustainability standard compliance
- Pre-collecting lymphatic vessels form detours following obstruction of lymphatic flow and function as collecting lymphatic vessels
- Construct validity and reliability of the Talent Development Environment Questionnaire in Caribbean youth track and field athletes
- Optimization of cytotoxic activity of Nocardia sp culture broths using a design of experiments
- Tissue-resident macrophages can be generated de novo in adult human skin from resident progenitor cells during substance P-mediated neurogenic inflammation ex vivo
- Microbiota in foods from Inuit traditional hunting
- Investigating Italian disinformation spreading on Twitter in the context of 2019 European elections
- In vivo expression of peptidylarginine deiminase in Drosophila melanogaster
- Modelling zero-truncated overdispersed antenatal health care count data of women in Bangladesh
- Detection and density of breeding marsh birds in Iowa wetlands
- A lineage-specific rapid diagnostic test (Chagas Sero K-SeT) identifies Brazilian Trypanosoma cruzi II/V/VI reservoir hosts among diverse mammalian orders
- Aromatase deficiency in hematopoietic cells improves glucose tolerance in male mice through skeletal muscle-specific effects
- If host is refractory, insistent parasite goes berserk: Trypanosomatid Blastocrithidia raabei in the dock bug Coreus marginatus
- Antimicrobial resistance patterns and molecular resistance markers of Campylobacter jejuni isolates from human diarrheal cases
- Protective role of brain derived neurotrophic factor (BDNF) in obstructive sleep apnea syndrome (OSAS) patients
- An IL-18-centered inflammatory network as a biomarker for cerebral white matter injury
- Prevalence of antiphospholipid antibodies in Behçet's disease: A systematic review and meta-analysis
- Chemical analysis of snus products from the United States and northern Europe
- Effect of prednisolone on glyoxalase 1 in an inbred mouse model of aristolochic acid nephropathy using a proteomics method with fluorogenic derivatization-liquid chromatography-tandem mass spectrometry
- Impact of early-onset persistent stunting on cognitive development at 5 years of age: Results from a multi-country cohort study
- Aggregation of CAT tails blocks their degradation and causes proteotoxicity in S. cerevisiae
- Expression of concern: Compensatory increase of transglutaminase 2 is responsible for resistance to mTOR inhibitor treatment
- Common mental illness among epilepsy patients in Bahir Dar city, Ethiopia: A cross-sectional study
- Staging dementia based on caregiver reported patient symptoms: Implications from a latent class analysis
- Health-related quality of life and its determinants among ambulatory patients with epilepsy at Ambo General Hospital, Ethiopia: Using WHOQOL-BREF
- In silico analysis and high-risk pathogenic phenotype predictions of non-synonymous single nucleotide polymorphisms in human Crystallin beta A4 gene associated with congenital cataract
- Fungal diversity in canopy soil of silver beech, Nothofagus menziesii (Nothofagaceae)
- Referral decisions and its predictors related to orthopaedic care. A retrospective study in a novel primary care setting
- Readiness to prescribe: Using educational design to untie the Gordian Knot
- Influence of gelation on the retention of purple cactus pear extract in microencapsulated double emulsions
- Factors related to met needs for rehabilitation 6 years after stroke
- Association of cataract and sun exposure in geographically diverse populations of India: The CASE study. First Report of the ICMR-EYE SEE Study Group
- Investigation of injury severity in urban expressway crashes: A case study from Beijing
- Clinical outcomes of incident peritoneal dialysis patients coming from kidney transplantation program: A case-control study
- Evaluation of the factors influencing the housing safety awareness of residents in Shanghai
- Morphometric study of the diaphragmatic surface of the liver in the human fetus
- Food insecurity and dietary diversity among lactating mothers in the urban municipality in the mountains of Nepal
- Genetic characterization of Bacillus anthracis strains circulating in Italy from 1972 to 2018
- Promising antifungal activity of new oxadiazole against Candida krusei
- An atlas of personality, emotion and behaviour
- Long-term effects of intracranial islet grafting on cognitive functioning in a rat metabolic model of sporadic Alzheimer's disease-like dementia
- Compartmentalized profiling of amniotic fluid cytokines in women with preterm labor
- Comparison of the myometrial transcriptome from singleton and twin pregnancies by RNA-Seq
- Adverse reproductive effects of S100A9 on bovine sperm and early embryonic development in vitro
- Functional dynamics of bacterial species in the mouse gut microbiome revealed by metagenomic and metatranscriptomic analyses
- Astrocyte senescence promotes glutamate toxicity in cortical neurons
- Primary ciliary dyskinesia and psychological well-being in adolescence
- Dipeptidyl peptidase-4 is increased in the abdominal aortic aneurysm vessel wall and is associated with aneurysm disease processes
- Primary care physician knowledge, attitudes, and diagnostic testing practices for norovirus and acute gastroenteritis
- Microfluidic-prepared DOTAP nanoparticles induce strong T-cell responses in mice
- Intraocular scattering as a predictor of driving performance in older adults with cataracts
- Reduced bone mineral density among HIV infected patients on anti-retroviral therapy in Blantyre, Malawi: Prevalence and associated factors
- Correction: Extraversion personality, perceived health and activity participation among community-dwelling aging adults in Hong Kong
- A rainwater control optimization design approach for airports based on a self-organizing feature map neural network model
- Influence of inflammasome NLRP3, and IL1B and IL2 gene polymorphisms in periodontitis susceptibility
- 18F-FDG-PET/MRI in the diagnostic work-up of limbic encephalitis
- The socioeconomic impact of orthopaedic trauma: A systematic review and meta-analysis
- Treatment patterns among patients with moderate-to-severe ulcerative colitis in the United States and Europe
- City to city learning and knowledge exchange for climate resilience in southern Africa
- Nuclear translocation of Atox1 potentiates activin A-induced cell migration and colony formation in colon cancer
- Activity-dependent switches between dynamic regimes of extracellular matrix expression
- Molecular sequencing and morphological identification reveal similar patterns in native bee communities across public and private grasslands of eastern North Dakota
- A mathematical model for assessing the effectiveness of controlling relapse in Plasmodium vivax malaria endemic in the Republic of Korea
- Cryo-focused ion beam preparation of perovskite based solar cells for atom probe tomography
- Physiological and transcriptomic responses of Lanzhou Lily (Lilium davidii, var. unicolor) to cold stress
- Unusual genome expansion and transcription suppression in ectomycorrhizal Tricholoma matsutake by insertions of transposable elements
- Estimating associations between antidepressant use and incident mild cognitive impairment in older adults with depression
- The use of telephone communication between nurse navigators and their patients
- CNP mediated selective toxicity on melanoma cells is accompanied by mitochondrial dysfunction
- HIV RNA measurement in dried blood spots of HIV-infected patients in Thailand using Abbott m2000 system
- Retraction: Oncogenic Fibulin-5 Promotes Nasopharyngeal Carcinoma Cell Metastasis through the FLJ10540/AKT Pathway and Correlates with Poor Prognosis
- Ultra-rapid cooling of ibex sperm by spheres method does not induce a vitreous extracellular state and increases the membrane damages
- Some animals are more equal than others: Validation of a new scale to measure how attitudes to animals depend on species and human purpose of use
- Observation and quantification of the morphological effect of trypan blue rupturing dead or dying cells
- The visual perception of emotion from masks
- Hexavalent chromium removal and total chromium biosorption from aqueous solution by Quercus crassipes acorn shell in a continuous up-flow fixed-bed column: Influencing parameters, kinetics, and mechanism
- The predictive value of anthropometric indices for cardiometabolic risk factors in Chinese children and adolescents: A national multicenter school-based study
- Lean back and wait for the alarm? Testing an automated alarm system for nosocomial outbreaks to provide support for infection control professionals
- Regional disparities in health care resources in traditional Chinese medicine county hospitals in China
- Analysis on hydraulic characteristics of improved sandy soil with soft rock
- Development and use of a scale to assess gender differences in appraisal of mistreatment during childbirth among Ethiopian midwifery students
- Factors for starting biosimilar TNF inhibitors in patients with rheumatic diseases in the real world
- Correction: Force field generalization and the internal representation of motor learning
- Prevalence and foetomaternal effects of iron deficiency anaemia among pregnant women in Lagos, Nigeria
- Socioeconomic risk factors for fatal opioid overdoses in the United States: Findings from the Mortality Disparities in American Communities Study (MDAC)
- Microbiome signatures in neonatal central line associated bloodstream infections
- Interventions for incarcerated adults with opioid use disorder in the United States: A systematic review with a focus on social determinants of health
- Opening gap width influences distal tibial rotation below the osteotomy site following open wedge high tibial osteotomy
- The impact of lowbush blueberry (Vaccinium angustifolium Ait.) and cranberry (Vaccinium macrocarpon Ait.) pollination on honey bee (Apis mellifera L.) colony health status
- Surveys of knowledge and awareness of antibiotic use and antimicrobial resistance in general population: A systematic review
- Managerial capacity among district health managers and its association with district performance: A comparative descriptive study of six districts in the Eastern Region of Ghana
- Knee joint distraction in regular care for treatment of knee osteoarthritis: A comparison with clinical trial data
- Reconstruction of a regulated two-cell metabolic model to study biohydrogen production in a diazotrophic cyanobacterium Anabaena variabilis ATCC 29413
- Cochlear dysfunction is associated with styrene exposure in humans
- Intra-individual variation of particles in exhaled air and of the contents of Surfactant protein A and albumin
- Revisits, readmissions, and outcomes for pediatric traumatic brain injury in California, 2005-2014
- Enhanced handover mechanism using mobility prediction in wireless networks
- Association between regular exercise and asthma control among adults: The population-based Northern Finnish Asthma Study
- Pharyngeal microbiome alterations during Neisseria gonorrhoeae infection
- Assessment of the clinical utility of four NGS panels in myeloid malignancies. Suggestions for NGS panel choice or design
- Assessment of time management practice and associated factors among primary hospitals employees in north Gondar, northwest Ethiopia
- Genetic diversity and population structure of feral rapeseed (Brassica napus L.) in Japan
- Are the current gRNA ranking prediction algorithms useful for genome editing in plants?
- Difference between physical therapist estimation and psychological patient-reported outcome measures in patients with low back pain
- Heterogeneity in the distribution of 159 drug-response related SNPs in world populations and their genetic relatedness
- Metabolic and lipidomic profiling of steatotic human livers during ex situ normothermic machine perfusion guides resuscitation strategies
- Investigating cumulative effects of pre-performance routine interventions in beach volleyball serving
- Dispensing of antibiotics without prescription and associated factors in drug retail outlets of Eritrea: A simulated client method
- MicroRNA expression and DNA methylation profiles do not distinguish between primary and recurrent well-differentiated liposarcoma
- Assessment of acyl-CoA cholesterol acyltransferase (ACAT-1) role in ovarian cancer progression—An in vitro study
- Cytoplasmic factories, virus assembly, and DNA replication kinetics collectively constrain the formation of poxvirus recombinants
- The wavelet power spectrum of perfusion weighted MRI correlates with tumor vascularity in biopsy-proven glioblastoma samples
- Agreement between cardiovascular disease risk assessment tools: An application to the United Arab Emirates population
- Constructing HLM to examine multi-level poverty-contributing factors of farmer households: Why and how?
- Patterns of symptoms possibly indicative of cancer and associated help-seeking behaviour in a large sample of United Kingdom residents—The USEFUL study
- An automated alarm system for food safety by using electronic invoices
- Neural effects of acute stress on appetite: A magnetoencephalography study
- Use of magnetic resonance imaging to determine laterality of meniscal size in healthy volunteers
- Co-prevalence of extracranial carotid aneurysms differs between European intracranial aneurysm cohorts
- Thermal biology of two tropical lizards from the Ecuadorian Andes and their vulnerability to climate change
- When weight is an encumbrance; avoidance of stairs by different demographic groups
- Non-mycosis fungoides cutaneous lymphomas in a referral center in Taiwan: A retrospective case series and literature review
- From the host's point of view: Effects of variation in burying beetle brood care and brood size on the interaction with parasitic mites
- Kernel-based Gaussian process for anomaly detection in sparse gamma-ray data
- Unmet care needs of children with ADHD
- Accelerometer-assessed outdoor physical activity is associated with meteorological conditions among older adults: Cross-sectional results from the OUTDOOR ACTIVE study
- Identification of Korean cancer survivors’ unmet needs and desired psychosocial assistance: A focus group study
- Evaluation of inactivated Bordetella pertussis as a delivery system for the immunization of mice with Pneumococcal Surface Antigen A
- The role of moral reasoning & personality in explaining lyrical preferences
- Would you like to participate in this trial? The practice of informed consent in intrapartum research in the last 30 years
- Correction: Mutation spectrums of TSC1 and TSC2 in Chinese women with lymphangioleiomyomatosis (LAM)
- Forward lunge before and after anterior cruciate ligament reconstruction: Faster movement but unchanged knee joint biomechanics
- Challenges associated with homologous directed repair using CRISPR-Cas9 and TALEN to edit the DMD genetic mutation in canine Duchenne muscular dystrophy
- Integrated targeted serum metabolomic profile and its association with gender, age, disease severity, and pattern identification in acne
- A prospective case-control study on miRNA circulating levels in subjects born small for gestational age (SGA) evaluated from childhood into young adulthood
- Polymer-fiber-coupled field-effect sensors for label-free deep brain recordings
- Global depth perception alters local timing sensitivity
- How to detect a polytrauma patient at risk of complications: A validation and database analysis of four published scales
- Module for SWC neuron morphology file validation and correction enabled for high throughput batch processing
- Reduced gray matter volume and cortical thickness associated with traffic-related air pollution in a longitudinally studied pediatric cohort
- Recombinant human soluble thrombomodulin is associated with attenuation of sepsis-induced renal impairment by inhibition of extracellular histone release
- Human and climatic drivers affect spatial fishing patterns in a multiple-use marine protected area: The Galapagos Marine Reserve
- Correction: Leisure-time physical activity and sports in the Brazilian population: A social disparity analysis
- Application of the mixture item response theory model to the Self-Administered Food Security Survey Module for Children
- Numerical simulation of atmospheric CO2 concentration and flux over the Korean Peninsula using WRF-VPRM model during Korus-AQ 2016 campaign
- Feline irradiated diet-induced demyelination; a model of the neuropathology of sub-acute combined degeneration?
- Improved multi-parametric prediction of tissue outcome in acute ischemic stroke patients using spatial features
- Genome-wide association and epistatic interactions of flowering time in soybean cultivar
- Correction: Association between workplace bullying and burnout, professional quality of life, and turnover intention among clinical nurses
- Correction: Estimation of membrane bending modulus of stiffness tuned human red blood cells from micropore filtration studies
- Correction: Limited indirect effects of an infant pneumococcal vaccination program in an aging population
- Correction: Targeting of the Plzf Gene in the Rat by Transcription Activator-Like Effector Nuclease Results in Caudal Regression Syndrome in Spontaneously Hypertensive Rats
- Fieldwork-based determination of design priorities for point-of-use drinking water quality sensors for use in resource-limited environments
- Young women’s reproductive health conversations: Roles of maternal figures and clinical practices
- Correction: Differential recordings of local field potential: A genuine tool to quantify functional connectivity
- Survival of medial versus lateral unicompartmental knee arthroplasty: A meta-analysis
- Novel MscL agonists that allow multiple antibiotics cytoplasmic access activate the channel through a common binding site
- Is it time to stop sweeping data cleaning under the carpet? A novel algorithm for outlier management in growth data
- Changes in oak (Quercus robur) photosynthesis after winter moth (Operophtera brumata) herbivory are not explained by changes in chemical or structural leaf traits
- Mutual interaction between motor cortex activation and pain in fibromyalgia: EEG-fNIRS study
- Evaluation of liposomal ciprofloxacin formulations in a murine model of anthrax
- Analysis of cholesterol in mouse brain by HPLC with UV detection
- Sugar, amino acid and inorganic ion profiling of the honeydew from different hemipteran species feeding on Abies alba and Picea abies
- Exploring prior diseases associated with incident late-onset Alzheimer’s disease dementia
- Hypertension prevalence in patients attending tertiary pain management services, a registry-based Australian cohort study
- SRL pathogenicity island contributes to the metabolism of D-aspartate via an aspartate racemase in Shigella flexneri YSH6000
- Correction: Comprehensive genome-wide analysis of the pear (Pyrus bretschneideri) laccase gene (PbLAC) family and functional identification of PbLAC1 involved in lignin biosynthesis
- Epilepsy in a melanocyte-lineage mTOR hyperactivation mouse model: A novel epilepsy model
- Water consumption and prevalence of irritable bowel syndrome among adults
- Mixed evidence for the relationship between periodontitis and Alzheimer’s disease: A bidirectional Mendelian randomization study
- Correction: Health conditions associated with overweight in climacteric women
- Correction: Determining Glomerular Filtration Rate in Homozygous Sickle Cell Disease: Utility of Serum Creatinine Based Estimating Equations
- Modelling the number of antenatal care visits in Bangladesh to determine the risk factors for reduced antenatal care attendance
- Correction: Cumulative viral load as a predictor of CD4+ T-cell response to antiretroviral therapy using Bayesian statistical models
- Dominant negative effects by inactive Spa47 mutants inhibit T3SS function and Shigella virulence
- ICOS-deficient and ICOS YF mutant mice fail to control Toxoplasma gondii infection of the brain
- Diel patterns in swimming behavior of a vertically migrating deepwater shark, the bluntnose sixgill (Hexanchus griseus)
- Life history of northern Gulf of Mexico Warsaw grouper Hyporthodus nigritus inferred from otolith radiocarbon analysis
- Physiology education for intensive care medicine residents: A 15-minute interactive peer-led flipped classroom session
- Strengthening capacity for natural sciences research: A qualitative assessment to identify good practices, capacity gaps and investment priorities in African research institutions
- Systematic scoping review of the concept of ‘genetic identity’ and its relevance for germline modification
- Height of overburden fracture based on key strata theory in longwall face
- Laboratory strains of Bacillus anthracis lose their ability to rapidly grow and sporulate compared to wildlife outbreak strains
- Improvement of classification performance of Parkinson’s disease using shape features for machine learning on dopamine transporter single photon emission computed tomography
- Comparative pharmacokinetics and pharmacodynamics of the advanced Retinol-Binding Protein 4 antagonist in dog and cynomolgus monkey
- Correction: A handy method to remove bacterial contamination from fungal cultures
- Correction: Effect of statin on life prognosis in Japanese patients undergoing hemodialysis
- Retraction: Outer Membrane Protein A (OmpA) of Shigella flexneri 2a Induces TLR2-Mediated Activation of B Cells: Involvement of Protein Tyrosine Kinase, ERK and NF-κB
- Retraction: Biofabrication of streptomycin-conjugated calcium phosphate nanoparticles using red ginseng extract and investigation of their antibacterial potential
- Receiver operating characteristic curve analysis of clinical signs for screening of convergence insufficiency in young adults
- Correction: Drivers of deforestation in the basin of the Usumacinta River: Inference on process from pattern analysis using generalised additive models
- Efficacy of fertilizing method for different potash sources in cotton (Gossypium hirsutum L.) nutrition under arid climatic conditions
- Podocyte autophagy is associated with foot process effacement and proteinuria in patients with minimal change nephrotic syndrome
- Effect of Lactobacillus acidophilus D2/CSL (CECT 4529) supplementation in drinking water on chicken crop and caeca microbiome
- Retraction: MiR-30a-5p Antisense Oligonucleotide Suppresses Glioma Cell Growth by Targeting SEPT7
- Correction: Dynamics of plasma micronutrient concentrations and their correlation with serum proteins and thyroid hormones in patients with paracoccidioidomycosis
- Impact of lower limb osteoarthritis on health-related quality of life: A cross-sectional study to estimate the expressed loss of utility in the Spanish population
- Correction: Prevalence of damaged and missing teeth among women in the southern plains of Nepal: Findings of a simplified assessment tool
- Correction: Tissue-Specific Expressed Antibody Variable Gene Repertoires
- Retraction: Immunoglobulin G Expression in Lung Cancer and Its Effects on Metastasis
- Correction: Causal knowledge promotes behavioral self-regulation: An example using climate change dynamics
- Retraction: Use of Granulocyte Colony-Stimulating Factor for the Treatment of Thin Endometrium in Experimental Rats
- Correction: Dynamic mechanical and nanofibrous topological combinatory cues designed for periodontal ligament engineering
- Correction: Evaluating the foundations that help avert antimicrobial resistance: Performance of essential water sanitation and hygiene functions in hospitals and requirements for action in Kenya
- From seed to flour: Sowing sustainability in the use of cantaloupe melon residue (Cucumis melo L. var. reticulatus)
- Core Scientific Dataset Model: A lightweight and portable model and file format for multi-dimensional scientific data
- Accounting for measurement error to assess the effect of air pollution on omic signals
- Leucine zipper transcription factor-like 1 binds adaptor protein complex-1 and 2 and participates in trafficking of transferrin receptor 1
- Barriers for tuberculosis case finding in Southwest Ethiopia: A qualitative study
- Genetic predisposition to celiac disease in Kazakhstan: Potential impact on the clinical practice in Central Asia
- A lower psoas muscle volume was associated with a higher rate of recurrence in male clear cell renal cell carcinoma
- Two angles of overqualification-the deviant behavior and creative performance: The role of career and survival job
- Cost-utility analysis of de-escalating biological disease-modifying anti-rheumatic drugs in patients with rheumatoid arthritis
- Efficient estimation of stereo thresholds: What slope should be assumed for the psychometric function?
- Learning efficient haptic shape exploration with a rigid tactile sensor array
- Effects of dietary supplementation with a microalga (Schizochytrium sp.) on the hemato-immunological, and intestinal histological parameters and gut microbiota of Nile tilapia in net cages
- Regional versus local wind speed and direction at a narrow beach with a high and steep foredune
- Fragmented QRS complex in patients with systemic lupus erythematosus at the time of diagnosis and its relationship with disease activity
- Severe thiamine deficiency in eastern Baltic cod (Gadus morhua)
- Transfer entropy as a variable selection methodology of cryptocurrencies in the framework of a high dimensional predictive model
- Psychometric validation of Czech version of the Sport Motivation Scale
- Correction: Multiple innate antibacterial immune defense elements are correlated in diverse ungulate species
- Recognition of personality disorder and anxiety disorder comorbidity in patients treated for depression in secondary psychiatric care
- Correction: Strategies for achieving high sequencing accuracy for low diversity samples and avoiding sample bleeding using illumina platform
- PLOS One
- Archiv čísel
- Aktuální číslo
- Informace o časopisu
Nejčtenější v tomto čísle- Severity of misophonia symptoms is associated with worse cognitive control when exposed to misophonia trigger sounds
- Chemical analysis of snus products from the United States and northern Europe
- Calcium dobesilate reduces VEGF signaling by interfering with heparan sulfate binding site and protects from vascular complications in diabetic mice
- Effect of Lactobacillus acidophilus D2/CSL (CECT 4529) supplementation in drinking water on chicken crop and caeca microbiome
Kurzy
Zvyšte si kvalifikaci online z pohodlí domova
Autoři: prof. MUDr. Vladimír Palička, CSc., Dr.h.c., doc. MUDr. Václav Vyskočil, Ph.D., MUDr. Petr Kasalický, CSc., MUDr. Jan Rosa, Ing. Pavel Havlík, Ing. Jan Adam, Hana Hejnová, DiS., Jana Křenková
Autoři: MUDr. Irena Krčmová, CSc.
Autoři: MDDr. Eleonóra Ivančová, PhD., MHA
Autoři: prof. MUDr. Eva Kubala Havrdová, DrSc.
Všechny kurzyPřihlášení#ADS_BOTTOM_SCRIPTS#Zapomenuté hesloZadejte e-mailovou adresu, se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.
- Vzdělávání