#PAGE_PARAMS# #ADS_HEAD_SCRIPTS# #MICRODATA#

Effect of calcium glucoheptonate on proliferation and osteogenesis of osteoblast-like cells in vitro


Authors: Prashant Kumar Modi aff001;  Ashwini Prabhu aff001;  Yashodhar P. Bhandary aff001;  Sudheer Shenoy P. aff001;  Aparna Hegde aff001;  Sindhu Priya ES aff001;  Renjith P. Johnson aff001;  Shankar Prasad Das aff001;  Sahil Vazirally aff002;  Punchappady-Devasya Rekha aff001
Authors place of work: Yenepoya Research Centre, Yenepoya (Deemed to be University), Mangalore, Karnataka, India aff001;  Global Calcium Pvt. Ltd., Bangalore, Karnataka, India aff002
Published in the journal: PLoS ONE 14(9)
Category: Research Article
doi: https://doi.org/10.1371/journal.pone.0222240

Summary

Calcium is the key macromineral having a role in skeletal structure and function, muscle contraction, and neurotransmission. Bone remodeling is maintained through a constant balance between calcium resorption and deposition. Calcium deficiency is resolved through calcium supplementation, and among the supplements, water-soluble organic molecules attracted great pharmaceutical interest. Calcium glucoheptonate is a highly water-soluble organic calcium salt having clinical use; however, detailed investigations on its biological effects are limited. We assessed the effects of calcium glucoheptonate on cell viability and proliferation of osteoblast-like MG-63 cells. Calcium uptake and mineralization were evaluated using Alizarin red staining of osteoblast-like MG-63 cells treated with calcium glucoheptonate. Expression of osteogenic markers were monitored by western blotting, immunofluorescence, and qRT-PCR assays. Increased proliferation and calcium uptake were observed in the MG-63 cells treated with calcium glucoheptonate. The treatment also increased the expression of osteopontin and osteogenic genes such as collagen-1, secreted protein acidic and cysteine rich (SPARC), and osteocalcin. Calcium glucoheptonate treatment did not exert any cytotoxicity on colorectal and renal epithelial cells, indicating the safety of the treatment. This is the first report with evidence for its beneficial effect for pharmaceutical use in addressing calcium deficiency conditions.

Keywords:

Biology and life sciences – Cell biology – Biochemistry – Research and analysis methods – Enzymology – Enzymes – proteins – Cellular types – Animal cells – Anatomy – Medicine and health sciences – Phosphatases – Physiology – Hormones – Physiological processes – Peptide hormones – Biological cultures – Biological tissue – Epithelial cells – Epithelium – Bioassays and physiological analysis – osteocalcin – Bone remodeling – Ossification – Specimen preparation and treatment – Staining – Cell staining – Group-specific staining – Alizarin staining – Cell lines – 293T cells – Biochemical analysis – Colorimetric assays – MTT assay – Enzyme assays

Introduction

Calcium is the most abundant mineral in the body with distinct physiological roles such as key regulator of signal transduction pathways of neurotransmission, muscle contraction and fertilization [1]. Extracellular calcium is critical for bone and teeth formation, blood clotting, nerve impulse transmission, regulation of heartbeat and fluid balance within cells as well as in maintaining the action potential across the cell membrane of excitable cells. Bone tissue acts as a reservoir for calcium, in order to balance the concentrations of calcium in muscle, serum and intracellular fluids [2]. The requirements peak during the period of growth such as childhood, during pregnancy and while breast feeding. It is known to promote osteogenesis by amplifying the effect of BMP2 on SMAD signaling [3]. In aging adults, bone resorption exceeds formation, thereby leading to osteoporosis. Also, long term inadequate intake of dietary calcium causes osteopenia or reduced bone density leading to osteoporosis; muscle cramps, premenstrual cramps, insomnia, dermatitis, cardiovascular disease, high blood pressure, blood clotting, and loss of appetite [4, 5]. It can also contribute to alopecia, eczema and psoriasis [6, 7]. Alteration in calcium levels is critical in nervous system disorders such as dementia and depression.

The global calcium map reveals that many countries have low average calcium intake. According to the International Osteoporosis Foundation (https://www.iofbonehealth.org/facts-statistics) [810], 1 in 3 women and 1 in 5 men over the age of 50 years experience an osteoporotic fracture. 125 million people are estimated to have osteoporosis in Europe, India, Japan, and the USA alone[11]. Calcium deficiency can be overcome by supplementation with calcium salts. The most common salts used are; calcium carbonate, calcium citrate malate, calcium chloride, calcium gluconate, calcium gluceptate, calcium glubionate, and calcium acetate. These salts differ in the calcium content, solubility, bioavailability and taste[12]. Calcium supplements vary in their absorption rates, depending on their solubility. The low solubility of the inorganic calcium salts such as calcium carbonate is one of the major limiting factors in rapid absorption[13, 14]. To improve the bioavailability of inorganic calcium salts, fabrication of the material into nanostructures have been attempted [15].Although calcium carbonate has the highest calcium content, organic salts are more preferred, due to their water soluble property and enhanced bioavailability and absorption of organic calcium salts.

Calcium glucoheptonate is the water-soluble calcium salt of gluconic acid and in solution, calcium is present both in the free ionized form and as calcium glucoheptonate complex[16, 17]. It is used in the treatment of low blood calcium, high blood potassium, magnesium sulphate overdose, hydrofluoric acid burns, hypocalcemia due to neonatal tetany and intestinal malabsorption, for replenishing the electrolytes (http://www.drugbank.ca/drugs/DB00326).

Calcium has a direct role in osteogenesis by increasing the expression of osteopontin and osteocalcin, thereby promoting osteogenesis [18]. Calcium availability enhances the expression of oestrogenic markers namely, alkaline phosphatase (ALP) and collagen -1. The osteogenic ability of calcium via activation of SMAD and RAS family genes is reported [19].

Compounds other than calcium such as valproic acid and FBS have promoting role in osteogenic differentiation of mesenchymal stem cells (MSCs) leading to bone formation in vivo [20, 21] and inhibition of miR-34a has been shown as a key strategy in MSC based therapy by inducing their differentiation [22].

Detailed investigations on the molecular action of calcium glucoheptonate on osteogenesis are lacking. Hence, this study was designed to assess the effect of calcium glucoheptonate with higher calcium equivalents on osteoblast-like cells in vitro using cellular and molecular approaches.

Materials and methods

Cell lines and materials

Osteoblast-like cells (MG-63), colorectal epithelial cells (Caco2) and kidney epithelial cells (HEK 293T) were procured from National Centre for Cell Sciences (NCCS), Pune, India. Calcium glucoheptonate was kindly supplied by Global Calcium Pvt. Ltd. (Bangalore, India). All the chemicals were of cell culture grade or analytical grade. Calcium glucoheptonate was prepared in sterile milli-Q water to obtain a final concentration of 25 mg calcium per mL. Details of the antibodies and the reagents used in the study are provided in S1 Table.

Physicochemical characterization of calcium glucoheptonate

The Fourier-transform Infra-red (FT-IR) spectra of calcium glucoheptonate were recorded on a Shimadzu-IRSpirit spectrophotometer at room temperature, and the spectra were taken at the range of 3500−500 cm−1. The scanning electron microscopy (SEM) images of the calcium glucoheptonate and EDX analysis were conducted with a Carl Zeiss-FESEM (Zeiss 1540 XB).

Cell culture conditions

Osteoblast-like MG-63 cells were grown in DMEM media containing 15% Fetal bovine serum (FBS) and antibiotic-antimycotic solution (10000 U Penicillin, 10 mg Streptomycin, and 25 μg amphotericin B). The Caco2 and HEK 293T cells were cultured in DMEM containing 10% FBS and antibiotic-antimycotic solution. The cultures were maintained in T-75 flasks and incubated at 37 oC with 5% CO2.

Cell viability and cell proliferation assays

Effect of calcium glucoheptonate on MG-63, Caco2 and HEK 293T cells were assessed using Methyl Thiazolyl Tetrazolium (MTT) assay [23]. For MTT assay, the cells were seeded at a density of 5000 cells per well in a 96 well microtiter plate and incubated at 37 oC with 5% CO2 for 24 hours. Subsequently, the cultures were treated with 25 mg/mL calcium glucoheptonate aqueous solution in calcium equivalents of 0, 0.125, 0.25, 0.5, 1.0, 2.0 and 4.0 mM. After 48 hours, the spent media from each well was removed, and 100 μL of MTT reagent was added. The plate was incubated at 37°C, 5% CO2 for 4 hours and the formazan crystals formed were solubilized in 100 μL of DMSO. The viability of the cells was evaluated by reading the absorbance at 570 nm using a Multimode plate reader (FluoSTAR Omega, BMG Labtech). The percentage of cell viability was calculated with reference to the untreated control. Cell viability less than 70% was considered as toxic [24]

The effect of calcium glucoheptonate on the viability of MG-63 cells was further evaluated using trypan blue dye exclusion assay. For this, the cells were seeded at a density of 10,000 cells per well in a 24 well microtiter plate and incubated at 37 oC with 5% CO2 for 24 hours. Subsequently, the cells were treated with different concentration of calcium glucoheptonate solutions (0, 0.125, 0.25, 0.5, 1.0, 2.0 and 4.0 mM). After 48 hours of treatment, the cells were trypsinized and resuspended in fresh media. 10 μl of the cell suspension was mixed with 10 μl of trypan blue dye, loaded on to a hemocytometer and counted.

Acridine orange and ethidium bromide (Himedia, India) staining were used for the imaging of the cells [25]. For this, MG-63 cells were seeded (50,000 cells per well) onto 6 well plates and incubated with selected concentrations of calcium glucoheptonate for 48 hours. Cells were washed with PBS, fixed in chilled methanol and stained with acridine orange and ethidium bromide. The stained cells were observed using a fluorescent cell imager (ZOE, BioRad).

Alizarin Red S staining for calcium uptake

Calcium uptake by MG-63 cells was monitored by incubating cells in 6 well plates with selected concentrations of calcium glucoheptonate for seven days. After the incubation period, the treated cells were washed with PBS and fixed in 4% paraformaldehyde at room temperature for 20 minutes. The fixed cells were stained with freshly prepared alizarin red (2% aqueous, pH 4.2) and washed with PBS before microscopic observation. Images of the stained cells were captured using an inverted microscope (PrimoVert, Carl Zeiss) under 10X magnification. The intensity of the stain uptake was used to assess the calcium accumulation and compared with the untreated control [26]. Alizarin red stain, from the cells, was extracted using 10% acetic acid and quantified at 405 nm using a multimode microplate reader (FluoSTAR Omega, BMG Lantech).

Alkaline phosphatase activity

Changes in the alkaline phosphatase activity in calcium glucoheptonate treated MG-63 cells were assessed by culturing them for seven days with fresh media supplementation every alternate day. The total alkaline phosphatase activity was measured from culture supernatant and cell lysate. The culture supernatant was used directly for the enzyme activity. The cell pellet was resuspended in cell lysis buffer (Tris-HCl, 50 mM, pH 7.5) and sonicated (30% amplitude, 30 seconds, two cycles). The activity was quantified using the enzyme kinetic method at 37 oC using the commercial kit (Agappe Diagnostics Ltd. India) according to the manufacturer’s instructions [27]. Enzyme activity in the culture supernatant and the cell lysate was recorded using a semi-automatic biochemical analyzer (Mispa Plus, Agappe Diagnostics Ltd. India). Total alkaline phosphatase activity was calculated and expressed as IU/L.

Western blotting and immunofluorescence

The MG-63 cells (1 x 106) treated with calcium glucoheptonate were harvested by centrifugation (12000 rpm for 30 minutes at 4°C), the protein was extracted using lysis buffer (50 mM Tris-HCl, 0.5% SDS, 250 mM NaCl, 5 mM EDTA, 50 mM NaF) and quantified by BCA method [28]. An equal amount of the protein was resolved on 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE). After SDS-PAGE, proteins were transferred to PVDF membrane, and immunoblotting was performed. The membrane was blocked with 5% BSA and incubated with primary antibodies for osteopontin, osteocalcin, collagen1, cleaved caspase 3 and cleaved PARP (Sigma, USA) at 1 : 1000 dilutions at 4°C overnight. This was followed by incubation with the goat anti-rabbit horseradish peroxidase-conjugated secondary antibody (Sigma, USA) at 1 : 5000 dilutions for 1 hour at room temperature. The immunoreactive proteins were visualized using enhanced chemiluminescence detection substrate (Pierce ECL western blotting substrate, Thermo Fisher Scientific, USA) in X-ray film. Expression of osteogenic proteins was quantified by densitometry (ImageJ software, National Institute of Health, Bethesda, MD). β-actin (Sigma, USA) was used as an internal control. Band density values of osteopontin, osteocalcin, and collagen type-1 were normalized with β-actin and expressions of these proteins were represented as an arbitrary ratio compared to untreated control.

For immunofluorescence, MG-63 cells were grown on collagen-coated coverslips in 6 well plates and incubated with calcium glucoheptonate for seven days. Cells were washed with PBS, fixed in 4% paraformaldehyde and permeabilized using 0.3% Triton X-100. Cells were washed, treated with blocking reagent for one hour and incubated overnight with osteopontin primary antibody in a humidified chamber at 4°C. It was further incubated with secondary antibody conjugated with Alexafluor 488 (Sigma, USA) in the dark at room temperature for one hour. Cells were washed and mounted using antifade mountant containing DAPI for counterstaining the nuclei. Images were captured using fluorescent imager (ZOE, Biorad).

qRT-PCR analysis

MG-63 cells were treated with calcium glucoheptonate for seven days. RNA was isolated using the RNeasy RNA isolation kit (Qiagen, USA). Reverse transcription was performed to convert RNA to cDNA by using Prime Script 1st strand cDNA Synthesis kit (TAKARA BIOINC, Japan). Subsequently, after reverse transcription, qPCR was performed by using cDNA, primers for Collagen type I (Forward primer: 5’ GAAGACATCCCACCAATCACC3’, Reverse primer: 5’TCTCGTCACAGATCACGTCATC3’) Osteocalcin (Forward primer: 5’TCACACTCCTCGCCCTATTG3’, Reverse primer: 5’TCGCTGCCCTCCTGCTTG3’) and SPARC (Forward primer: 5’GAAGCCCTGCCTGATGAGACA 3’, Reverse primer: 5’CCACCTCCTCTTCGGTTTCCTC 3’) genes and SYBR Green master mix in a real-time PCR machine (CFX96, BioRad, Singapore).

Statistical analysis

Data are represented as mean ± standard deviation. For statistical comparisons, the data were analyzed by one-way analysis of variance (ANOVA) using SPSS (Version 22.0). p < 0.05 was considered statistically significant.

Results

Physicochemical characteristics of calcium glucoheptonate

The chemical structure, morphology, and elemental composition of the calcium glucoheptonate were characterized by FT-IR spectroscopy and SEM -⁠ EDX analysis. Fig 1A shows all characteristic stretching and bending bands associated with different bonds. The appearance of a strong O-H broad band at 3200 cm-1 confirms the existence of the intermolecular bonded hydroxyl groups in the molecule. The medium O-H bending is seen at 1420 cm-1 indicating the hydroxyl groups. The strong stretching bands at 1710 cm-1 and 1085 cm-1 confirms the presence of C = O and C-O bonds respectively.

Fig. 1.

(A) The FT-IR spectra, (B) FESEM images and (C) EDX spectra of calcium glucoheptonate.

The surface morphological characterization by FESEM (Fig 1B) displayed uniform and micro-sized spherical morphology of the calcium glucoheptonate. The EDX analysis (Fig 1C) confirmed the presence of calcium and other expected elements. Importantly, the absence of any other elements confirmed the purity of the molecule.

Proliferative effect of calcium glucoheptonate on osteoblast-like MG-63 cells

The proliferative effect of calcium glucoheptonate was tested at concentrations between 0–4 mM using MTT assay. Results showed that the MG-63 cells treated with different concentrations (0.25–4 mM) of calcium glucoheptonate for 48 h had significantly higher proliferation compared to control (Fig 2A). The maximum proliferation was observed at 0.25 mM concentration (157.35% as compared to control) followed by 1.0 and 2.0 mM concentrations. However, at 4 mM concentration, there was a significant reduction in the cell viability compared to the control and other concentrations. Similar results were observed in the trypan blue dye exclusion method (Fig 2B).

Fig. 2.

Effect of calcium glucoheptonate on the proliferation of osteoblast-like MG-63 cells.

<h2>Effect of calcium glucoheptonate on the proliferation of osteoblast-like MG-63 cells.</h2>

(A) MTT assay. (B) Cell counts from trypan blue dye exclusion assay. Values are mean ± SD (n = 3). (C) Photomicrographs of live/dead stained osteoblast-like MG-63 cells treated with selected concentrations of calcium glucoheptonate in comparison to untreated control. (Scale bar 100 μm). The green fluorescence represents the nuclei stained with acridine orange indicating viable cells and red fluorescence represent the nuclei stained with ethidium bromide.

Based on the MTT and trypan blue test results, two concentrations (0.25 and 1.0 mM) of calcium glucoheptonate were selected for further studies. The microscopic analysis of the MG-63 cells treated with calcium is shown in Fig 2C. The cells treated with 0.25 mM and 1.0 mM equivalents of calcium from calcium glucoheptonate showed significantly higher number of viable cells with negligible cytotoxicity.

Calcium glucoheptonate promotes calcium uptake and mineralization

Alizarin Red S staining method was used to study the calcium accumulation in MG-63 cells treated with calcium glucoheptonate for seven days. Based on the staining intensity the calcium accumulation was quantified. The calcium accumulation by the cells increased with the dose as observed by intense red coloration due to the staining of the accumulated mineral by Alizarin Red dye (Fig 3A). The spectrophotometric quantification of Alizarin Red stain in the cells indicated higher calcium uptake and mineralization in the treatment group compared to the control. There was a 30% increase in the calcium uptake at 1.0 mM concentration compared to the control (Fig 3B). A significant increase in alkaline phosphatase activity was observed with 0.25 mM and 1.0 mM concentration of calcium glucoheptonate treatment (p < 0.05) (Fig 3C).

Fig. 3.

Quantification and visualization of calcium uptake and mineralization in osteoblast-like MG-63 cells.

<h2>Quantification and visualization of calcium uptake and mineralization in osteoblast-like MG-63 cells.</h2>

(A) and (B) represents Alizarin Red S staining and quantification for visualization of calcium uptake and mineralization in osteoblast-like MG-63 cells treated with selected concentrations of calcium glucoheptonate. (C) Changes in the alkaline phosphatase activity reflecting osteogenesis in osteoblast-like MG-63 cells treated with calcium glucoheptonate for seven days.

Effect of calcium glucoheptonate on the expression of osteogenic genes and proteins

The qRT-PCR experiments using collagen type I, osteocalcin and secreted protein acidic and cysteine-rich (SPARC) genes showed increased expression in the calcium-supplemented cells (Fig 4A). Treatment of MG-63 cells with 1 mM calcium glucoheptonate resulted in significant (p<0.05) upregulation of collagen type I (1.4 fold), osteocalcin (1.8 fold) and SPARC (1.5 fold) genes.

Fig. 4.

Changes in the expression pattern of osteopontin, osteocalcin, and collagen-1 in MG-63 cells treated with calcium glucoheptonate for seven days.

<h2>Changes in the expression pattern of osteopontin, osteocalcin, and collagen-1 in MG-63 cells treated with calcium glucoheptonate for seven days.</h2>

(A) qRT-PCR results show fold-change in the expression of osteogenic genes in response to calcium glucoheptonate treatment. (B)- Western blot for collagen-1, osteocalcin and osteopontin respectively. (C-E) Densitometric analysis of collagen-1, osteocalcin and osteopontin.* denotes significant difference as compared to control (p<0.05).

Results from the western blotting experiments showed a significant increase in osteopontin, osteocalcin and collagen-1 expression levels compared to control as shown in Fig 4B. Fig 4C–4E—show denstitomertic analysis of western blot for collagen-1, osteocalcin and osteopontin respectively. At all the tested concentrations of calcium glucoheptonate, the expression levels were higher compared to the control. Our results indicated that treatment with selected concentrations of calcium glucoheptonate enhances the osteogenic properties of MG-63 cells.

Osteopontin expression in the cells was visualized using immunofluorescence assay. Cells in 0.25 mM and 1.0 mM calcium glucoheptonate treatment group showed increased levels of osteopontin expression compared to the control. Increased expression was seen at the highest tested concentration of 1.0 mM (Fig 5).

Fig. 5.

Osteopontin expression in response to calcium glucoheptonate treatment in MG-63 cells.

<h2>Osteopontin expression in response to calcium glucoheptonate treatment in MG-63 cells.</h2>

Green fluorescence represents the expression of osteopontin and blue fluorescence indicates the nuclei counterstained with DAPI. (Scale bar: 50 μm).

Calcium glucoheptonate does not affect the viability of epithelial cells

The epithelial cell models of Caco2 and HEK 293T were used to study the direct effect of calcium glucoheptonate. In comparison with the untreated control, Caco2 cells treated with calcium glucoheptonate showed the viability of 88.80% and 110.35% at 0.25 mM and 1.0 mM concentrations respectively (Fig 6A). Similar results were also obtained with kidney epithelial cells (HEK 293T), wherein administration of calcium glucoheptonate did not induce any cytotoxicity. The cell viability was similar to untreated control indicating no significant adverse effect on the renal cells (Fig 6B).

Fig. 6.

Effect of calcium glucoheptonate on epithelial cells.

<h2>Effect of calcium glucoheptonate on epithelial cells.</h2>

(A) colorectal epithelial cells (Caco2) and (B) renal epithelial cells (HEK 293T).

Discussion

In the present study, we investigated the effect of calcium glucoheptonate on viability and proliferation of MG-63 osteoblast-like cells. MG-63 cells are osteosarcoma cells, and have been widely used as a model of osteoblast cells for osteogenic differentiation studies. [2933]. There are reports supporting osteogenic differentiation, stemeness and tumerigenic potential of MG-63 cells [3438].

Calcium plays an essential role in several signal transduction pathways where it works as a second messenger, involved in the release of neurotransmitter from the neurons, muscle contraction, and fertilization [1, 39]. Calcium also acts as a co-factor for many enzymes, aiding their functioning in several physiological processes such as clotting [40, 41]. Reduction in the number and activity of osteoblasts resulting in impaired osteoblastic bone formation has been implicated in osteoporosis [42]. Therefore, promoting osteoblast proliferation by mineral supplementation helps during bone remodeling in osteoporosis [43].

From our study, it is evident that calcium glucoheptonate has a positive effect on cell proliferation of osteoblast-like MG-63 cells. The MG-63 cells treated with calcium glucoheptonate for seven days showed calcium deposition, which can play a role in increase in bone mineral density [44]. Elevated calcium concentrations at the resorptive sites of bone can also regulate osteoblast functions [45]. Accumulation of calcium in the extracellular space and its organization into hydroxyapatite crystals is a key marker of osteoblast maturation [46].

Alkaline phosphatase is expressed during early development on the cell surface and in matrix vesicles. During the later developmental stages, while other genes such as osteocalcin are up-regulated, the expression of alkaline phosphatase declines [47]. Our results indicated that treatment with 0.25 and 1.0 mM calcium glucoheptonate significantly increased the alkaline phosphatase activity compared to control. Bone formation, metabolism, and regeneration are regulated by the genes COL-1 and osteocalcin which have a direct relationship with calcium availability. Osteocalcin is known to conjugate with hydroxyapatite and calcium is highly expressed in expanding skeletal tissue helping in bone mineralization and bone turnover processes [48, 49]. We observed that calcium glucoheptonate treatment up-regulated the expression of osteocalcin, COL-1, and SPARC genes. These results are in close agreement with a few previous studies, wherein, an increase in osteocalcin mRNA expression is observed due to elevated concentrations of extracellular calcium [50, 51]. Coral sand which is a rich calcium source increased COL-1 mRNA expression in Wistar rats [52].

Similarly, collagen is implicated in matrix mineralization during bone cell differentiation [53]. We observed an increase in the levels of intracellular COL-1 with calcium glucoheptonate treatment in MG-63 osteoblast-like cells, compared to control. Enhancement of COL-1 may promote the maturation and mineralization of osteoblast matrix. Osteopontin is an acidic phosphoprotein containing phosphorylated serine residues that binds to calcium crystals to modulate bone mineralization and osteogenesis [54]. It is also considered as an important factor in bone remodeling. Its function in recruiting osteoclasts to the mineral matrix of bones is imperative [55]. Results of immunofluorescence and western blotting experiments indicated the increased expression of osteopontin in calcium glucoheptonate treated cells confirming its osteogenic potential. Osteopontin binds to cell surface receptors and extracellular matrix proteins such as fibronectin, and collagen, mediating cell adhesion and migration [56]. Binding of osteopontin to calcium occurs through Runx2, 1, 25-dihydroxyvitamin D3 and Notch signaling pathways that regulate osteopontin concentration in osteoblasts and subsequent bone remodeling [57]. Calcium glucoheptonate did not have any apoptotic effect on MG-63 cells (S1 Fig).

Calcium salts may damage the epithelial cells on direct contact during the absorption process or may burden the renal system during excretion [58, 59]. Caco-2 cell line is a widely used model for the evaluating the absorption of the ingested formulations [60]. HEK 293T cells are utilized in drug induced nephrotoxicity studies [61, 62]. To test whether calcium glucoheptonate has any such adverse effect, Caco2 and HEK-293T cells were used and the results did not show any cytotoxic effect.

The overall results from the in vitro experiments suggest that calcium glucoheptonate can be exploited as a safe source of calcium in the pharmaceutical industry.

Conclusion

Calcium glucoheptonate can exert cell proliferative effect on osteoblast-like MG-63 cells. The calcium released from glucoheptonate enhances the expression of collagen-1, osteocalcin and osteopontin, thereby promoting bone mineralization and osteogenesis. Calcium glucoheptonate can be a promising calcium supplement for calcium deficiency indications or for population with limited dietary calcium intake.

Supporting information

S1 Table [doc]
Details of the antibodies and the reagents used in the study.

S1 Fig [tif]
Effect of calcium glucoheptonate on apoptotic proteins.


Zdroje

1. Brini M, Ottolini D, Cali T, Carafoli E. Calcium in health and disease. Met Ions Life Sci. 2013;13 : 81–137. Epub 2014/01/29. doi: 10.1007/978-94-007-7500-8_4 24470090.

2. Wilson CH, Ali ES, Scrimgeour N, Martin AM, Hua J, Tallis GA, et al. Steatosis inhibits liver cell store-operated Ca(2)(+) entry and reduces ER Ca(2)(+) through a protein kinase C-dependent mechanism. Biochem J. 2015;466(2):379–90. Epub 2014/11/26. doi: 10.1042/BJ20140881 25422863.

3. Aquino-Martinez R, Artigas N, Gamez B, Rosa JL, Ventura F. Extracellular calcium promotes bone formation from bone marrow mesenchymal stem cells by amplifying the effects of BMP-2 on SMAD signalling. PLoS One. 2017;12(5):e0178158. Epub 2017/05/26. doi: 10.1371/journal.pone.0178158 28542453; PubMed Central PMCID: PMC5444778.

4. Sunyecz JA. The use of calcium and vitamin D in the management of osteoporosis. Ther Clin Risk Manag. 2008;4(4):827–36. Epub 2009/02/12. doi: 10.2147/tcrm.s3552 19209265; PubMed Central PMCID: PMC2621390.

5. Wang M, Yang X, Wang F, Li R, Ning H, Na L, et al. Calcium-deficiency assessment and biomarker identification by an integrated urinary metabonomics analysis. BMC Med. 2013;11 : 86. Epub 2013/03/30. doi: 10.1186/1741-7015-11-86 23537001; PubMed Central PMCID: PMC3652781.

6. Ruan X, Tey HL. Hypocalcemia: low incidence in flares of pustular and chronic plaque psoriasis. Int J Dermatol. 2017;56(6):e133–e5. Epub 2017/02/16. doi: 10.1111/ijd.13549 28198000.

7. Knuever J, Tantcheva-Poor I. Generalized pustular psoriasis: A possible association with severe hypocalcaemia due to primary hypoparathyroidism. J Dermatol. 2017;44(12):1416–7. Epub 2017/01/21. doi: 10.1111/1346-8138.13724 28106254.

8. Melton LJ, Atkinson EJ 3rd, O'Connor MK, O'Fallon WM, Riggs BL. Bone density and fracture risk in men. J Bone Miner Res. 1998;13(12):1915–23. Epub 1998/12/09. doi: 10.1359/jbmr.1998.13.12.1915 9844110.

9. Kanis JA, Johnell O, Oden A, Sembo I, Redlund-Johnell I, Dawson A, et al. Long-term risk of osteoporotic fracture in Malmo. Osteoporos Int. 2000;11(8):669–74. Epub 2000/11/30. 11095169.

10. Melton LJ, Chrischilles EA 3rd, Cooper C, Lane AW, Riggs BL. Perspective. How many women have osteoporosis? J Bone Miner Res. 1992;7(9):1005–10. Epub 1992/09/01. doi: 10.1002/jbmr.5650070902 1414493.

11. van MO. Osteoporosis and the Nature of Fragility Fracture: An Overview. In: Hertz K., Santy-Tomlinson J. (eds). Fragility Fracture Nursing Perspectives in Nursing Management and Care for Older AdultsSpringer, Cham. 2018. doi: 10.1007/978-3-319-76681-2_1

12. Trailokya A, Srivastava A, Bhole M, Zalte N. Calcium and Calcium Salts. J Assoc Physicians India. 2017;65(2):100–3. Epub 2017/05/01. 28457049.

13. Kressel GW, M. Hahn A. Bioavailability and Solubility of Different Calcium-Salts as a Basis for Calcium Enrichment of Beverages. Food and Nutrition Sciences. 2010;1(2):6. doi: 10.4236/fns.2010.12009

14. Roth Bassell HAC F.M. In Vitro Solubility Characteristics of Six Calcium Salts. Journal of Food Protection. 1992;55(12):3.

15. Li X YX, Liu X, He W, Huang Q, Li S, Feng Q. Calcium carbonate nanoparticles promote osteogenesis compared to adipogenesis in human bone-marrow mesenchymal stem cells. Progress in Natural Science: Materials International. 2018;28(5):11. doi: 10.1016/j.pnsc.2018.09.004

16. Calcium salts. The American Society of Health System Pharmacists 2017.

17. Drop LJ, Cullen DJ. Comparative effects of calcium chloride and calcium gluceptate. Br J Anaesth. 1980;52(5):501–5. Epub 1980/05/01. doi: 10.1093/bja/52.5.501 7387803.

18. An S, Gao Y, Ling J, Wei X, Xiao Y. Calcium ions promote osteogenic differentiation and mineralization of human dental pulp cells: implications for pulp capping materials. J Mater Sci Mater Med. 2012;23(3):789–95. Epub 2011/12/23. doi: 10.1007/s10856-011-4531-0 22190198.

19. Viti F, Landini M, Mezzelani A, Petecchia L, Milanesi L, Scaglione S. Osteogenic Differentiation of MSC through Calcium Signaling Activation: Transcriptomics and Functional Analysis. PLoS One. 2016;11(2):e0148173. Epub 2016/02/02. doi: 10.1371/journal.pone.0148173 26828589; PubMed Central PMCID: PMC4734718.

20. La Noce M, Mele L, Laino L, Iolascon G, Pieretti G, Papaccio G, et al. Cytoplasmic Interactions between the Glucocorticoid Receptor and HDAC2 Regulate Osteocalcin Expression in VPA-Treated MSCs. Cells. 2019;8(3). Epub 2019/03/08. doi: 10.3390/cells8030217 30841579; PubMed Central PMCID: PMC6468918.

21. Spina A, Montella R, Liccardo D, De Rosa A, Laino L, Mitsiadis TA, et al. NZ-GMP Approved Serum Improve hDPSC Osteogenic Commitment and Increase Angiogenic Factor Expression. Front Physiol. 2016;7 : 354. Epub 2016/09/07. doi: 10.3389/fphys.2016.00354 27594842; PubMed Central PMCID: PMC4990559.

22. Zhang F, Cui J, Liu X, Lv B, Xie Z, Yu B. Roles of microRNA-34a targeting SIRT1 in mesenchymal stem cells. Stem Cell Res Ther. 2015;6 : 195. Epub 2015/10/09. doi: 10.1186/s13287-015-0187-x 26446137; PubMed Central PMCID: PMC4597437.

23. Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods. 1983;65(1–2):55–63. Epub 1983/12/16. doi: 10.1016/0022-1759(83)90303-4 [pii]. 6606682.

24. Wu B, Zhu JS, Zhang Y, Shen WM, Zhang Q. Predictive value of MTT assay as an in vitro chemosensitivity testing for gastric cancer: one institution's experience. World J Gastroenterol. 2008;14(19):3064–8. Epub 2008/05/22. doi: 10.3748/wjg.14.3064 18494060; PubMed Central PMCID: PMC2712176.

25. Liu K, Liu PC, Liu R, Wu X. Dual AO/EB staining to detect apoptosis in osteosarcoma cells compared with flow cytometry. Med Sci Monit Basic Res. 2015;21 : 15–20. Epub 2015/02/11. doi: 10.12659/MSMBR.893327 25664686; PubMed Central PMCID: PMC4332266.

26. Gregory CA, Gunn WG, Peister A, Prockop DJ. An Alizarin red-based assay of mineralization by adherent cells in culture: comparison with cetylpyridinium chloride extraction. Anal Biochem. 2004;329(1):77–84. Epub 2004/05/12. doi: 10.1016/j.ab.2004.02.002 15136169.

27. Schlebusch H RW, Lang M, Knedel M. Normbereiche der Aktivitäten klinisch wichtiger Enzyme. Dtsch Med Wochenschr 1974;99 : 2.

28. Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, et al. Measurement of protein using bicinchoninic acid. Anal Biochem. 1985;150(1):76–85. Epub 1985/10/01. doi: 10.1016/0003-2697(85)90442-7 3843705.

29. Luo X, Barbieri D, Davison N, Yan Y, de Bruijn JD, Yuan H. Zinc in calcium phosphate mediates bone induction: in vitro and in vivo model. Acta Biomater. 2014;10(1):477–85. Epub 2013/10/22. doi: 10.1016/j.actbio.2013.10.011 24140609.

30. Wegler C, Wikvall K, Norlin M. Effects of Osteoporosis-Inducing Drugs on Vitamin D-Related Gene Transcription and Mineralization in MG-63 and Saos-2 Cells. Basic Clin Pharmacol Toxicol. 2016;119(5):436–42. Epub 2016/04/22. doi: 10.1111/bcpt.12612 27098343.

31. Zofkova I, Davis M, Blahos J. Trace elements have beneficial, as well as detrimental effects on bone homeostasis. Physiol Res. 2017;66(3):391–402. Epub 2017/03/02. doi: 933454 28248532.

32. Plikerd WD, Mahendra Kumar Branton, Alice Trivedi, Dahryn Nayak, Gopal Gangwar, Mayank Jana, Snehasis. Impact of Biofield Energy Healing Treated Vitamin D3 on Human Osteoblast Cell Line (MG-63) for Bone Health. American Journal of Clinical and Experimental Medicine. 2018;6(1):9. Epub Jan. 10, 2018. doi: 10.11648/j.ajcem.20180601.11

33. Ghorbanzadeh A, Aminsobhani M, Khoshzaban A, Abbaszadeh A, Bolhari B, Shamshiri AR. Cytotoxic Effects and Osteogenic Activity of Calcium Sulfate with and without Recombinant Human Bone Morphogenetic Protein 2 and Nano-Hydroxyapatite Adjacent to MG-63 Cell Line. J Dent (Tehran). 2015;12(5):352–63. Epub 2016/02/16. 26877731; PubMed Central PMCID: PMC4749100.

34. Sun L, Pereira D, Wang Q, Barata DB, Truckenmuller R, Li Z, et al. Controlling Growth and Osteogenic Differentiation of Osteoblasts on Microgrooved Polystyrene Surfaces. PLoS One. 2016;11(8):e0161466. Epub 2016/08/30. doi: 10.1371/journal.pone.0161466 27571520; PubMed Central PMCID: PMC5003369.

35. Yang JY, Ting YC, Lai JY, Liu HL, Fang HW, Tsai WB. Quantitative analysis of osteoblast-like cells (MG63) morphology on nanogrooved substrata with various groove and ridge dimensions. J Biomed Mater Res A. 2009;90(3):629–40. Epub 2008/06/20. doi: 10.1002/jbm.a.32130 18563818.

36. Xiong Y, Yang HJ, Feng J, Shi ZL, Wu LD. Effects of alendronate on the proliferation and osteogenic differentiation of MG-63 cells. J Int Med Res. 2009;37(2):407–16. Epub 2009/04/23. doi: 10.1177/147323000903700216 19383235.

37. La Noce M, Paino F, Mele L, Papaccio G, Regad T, Lombardi A, et al. HDAC2 depletion promotes osteosarcoma's stemness both in vitro and in vivo: a study on a putative new target for CSCs directed therapy. J Exp Clin Cancer Res. 2018;37(1):296. Epub 2018/12/05. doi: 10.1186/s13046-018-0978-x 30509303; PubMed Central PMCID: PMC6276256.

38. Papaccio F, Paino F, Regad T, Papaccio G, Desiderio V, Tirino V. Concise Review: Cancer Cells, Cancer Stem Cells, and Mesenchymal Stem Cells: Influence in Cancer Development. Stem Cells Transl Med. 2017;6(12):2115–25. Epub 2017/10/27. doi: 10.1002/sctm.17-0138 29072369; PubMed Central PMCID: PMC5702541.

39. Brini M, Cali T, Ottolini D, Carafoli E. Intracellular calcium homeostasis and signaling. Met Ions Life Sci. 2013;12 : 119–68. Epub 2013/04/19. doi: 10.1007/978-94-007-5561-1_5 23595672.

40. Palta S, Saroa R, Palta A. Overview of the coagulation system. Indian J Anaesth. 2014;58(5):515–23. Epub 2014/12/24. doi: 10.4103/0019-5049.144643 25535411; PubMed Central PMCID: PMC4260295.

41. Ferguson JH. THE BLOOD CALCIUM AND THE CALCIUM FACTOR IN BLOOD COAGULATION. Physiological Reviews. 1936;16(4):31. doi: 10.1152/physrev.1936.16.4.640

42. Manolagas SC, Parfitt AM. What old means to bone. Trends Endocrinol Metab. 2010;21(6):369–74. Epub 2010/03/13. doi: 10.1016/j.tem.2010.01.010 20223679; PubMed Central PMCID: PMC2880220.

43. Marie PJ, Kassem M. Osteoblasts in osteoporosis: past, emerging, and future anabolic targets. Eur J Endocrinol. 2011;165(1):1–10. Epub 2011/05/06. doi: 10.1530/EJE-11-0132 21543379.

44. Tai V, Leung W, Grey A, Reid IR, Bolland MJ. Calcium intake and bone mineral density: systematic review and meta-analysis. BMJ. 2015;351:h4183. Epub 2015/10/01. doi: 10.1136/bmj.h4183 26420598; PubMed Central PMCID: PMC4784773.

45. Maeno S, Niki Y, Matsumoto H, Morioka H, Yatabe T, Funayama A, et al. The effect of calcium ion concentration on osteoblast viability, proliferation and differentiation in monolayer and 3D culture. Biomaterials. 2005;26(23):4847–55. Epub 2005/03/15. doi: 10.1016/j.biomaterials.2005.01.006 15763264.

46. Bermudez-Reyes B, Del Refugio Lara-Banda M, Reyes-Zarate E, Rojas-Martinez A, Camacho A, Moncada-Saucedo N, et al. Effect on growth and osteoblast mineralization of hydroxyapatite-zirconia (HA-ZrO2) obtained by a new low temperature system. Biomed Mater. 2018;13(3):035001. Epub 2018/02/21. doi: 10.1088/1748-605X/aaa3a4 29461975.

47. Golub EEB-B, Kathleen. The role of alkaline phosphatase in minerlization. Current Opinion in Orthopaedics. 2007;18(5):5. doi: 10.1097/BCO.0b013e3282630851

48. Feng H, Cheng T, Pavlos NJ, Yip KH, Carrello A, Seeber R, et al. Cytoplasmic terminus of vacuolar type proton pump accessory subunit Ac45 is required for proper interaction with V(0) domain subunits and efficient osteoclastic bone resorption. J Biol Chem. 2008;283(19):13194–204. Epub 2008/01/30. doi: 10.1074/jbc.M709712200 18227071; PubMed Central PMCID: PMC2442344.

49. Feng J, Shi Z, Ye Z. Effects of metabolites of the lignans enterolactone and enterodiol on osteoblastic differentiation of MG-63 cells. Biol Pharm Bull. 2008;31(6):1067–70. Epub 2008/06/04. doi: 10.1248/bpb.31.1067 [pii]. 18520031.

50. Cheng YH, Hooker RA, Nguyen K, Gerard-O'Riley R, Waning DL, Chitteti BR, et al. Pyk2 regulates megakaryocyte-induced increases in osteoblast number and bone formation. J Bone Miner Res. 2013;28(6):1434–45. Epub 2013/01/31. doi: 10.1002/jbmr.1876 23362087; PubMed Central PMCID: PMC3663900.

51. Welldon KJ, Findlay DM, Evdokiou A, Ormsby RT, Atkins GJ. Calcium induces pro-anabolic effects on human primary osteoblasts associated with acquisition of mature osteocyte markers. Mol Cell Endocrinol. 2013;376(1–2):85–92. Epub 2013/06/25. doi: 10.1016/j.mce.2013.06.013 23791847.

52. Li Z, Lu WW, Chiu PK, Lam RW, Xu B, Cheung KM, et al. Strontium-calcium coadministration stimulates bone matrix osteogenic factor expression and new bone formation in a large animal model. J Orthop Res. 2009;27(6):758–62. Epub 2008/11/26. doi: 10.1002/jor.20818 19025756.

53. Mathews S, Gupta PK, Bhonde R, Totey S. Chitosan enhances mineralization during osteoblast differentiation of human bone marrow-derived mesenchymal stem cells, by upregulating the associated genes. Cell Prolif. 2011;44(6):537–49. Epub 2011/10/21. doi: 10.1111/j.1365-2184.2011.00788.x 22011046.

54. Fisher LW, Fedarko NS. Six genes expressed in bones and teeth encode the current members of the SIBLING family of proteins. Connect Tissue Res. 2003;44 Suppl 1 : 33–40. Epub 2003/09/04. 12952171.

55. Choi ST, Kim JH, Kang EJ, Lee SW, Park MC, Park YB, et al. Osteopontin might be involved in bone remodelling rather than in inflammation in ankylosing spondylitis. Rheumatology (Oxford). 2008;47(12):1775–9. Epub 2008/10/16. doi: 10.1093/rheumatology/ken385 18854347.

56. Alford AI, Hankenson KD. Matricellular proteins: Extracellular modulators of bone development, remodeling, and regeneration. Bone. 2006;38(6):749–57. Epub 2006/01/18. doi: 10.1016/j.bone.2005.11.017 16412713.

57. Shen Q, Christakos S. The vitamin D receptor, Runx2, and the Notch signaling pathway cooperate in the transcriptional regulation of osteopontin. J Biol Chem. 2005;280(49):40589–98. Epub 2005/10/01. doi: 10.1074/jbc.M504166200 16195230.

58. Khaskhali MH, Byer KJ, Khan SR. The effect of calcium on calcium oxalate monohydrate crystal-induced renal epithelial injury. Urol Res. 2009;37(1):1–6. Epub 2008/11/14. doi: 10.1007/s00240-008-0160-6 19005647; PubMed Central PMCID: PMC3615550.

59. Sun XY, Gan QZ, Ouyang JM. Calcium oxalate toxicity in renal epithelial cells: the mediation of crystal size on cell death mode. Cell Death Discov. 2015;1 : 15055. Epub 2015/01/01. doi: 10.1038/cddiscovery.2015.55 27551481; PubMed Central PMCID: PMC4979418.

60. Etcheverry P, Wallingford JC, Miller DD, Glahn RP. The effect of calcium salts, ascorbic acid and peptic pH on calcium, zinc and iron bioavailabilities from fortified human milk using an in vitro digestion/Caco-2 cell model. Int J Vitam Nutr Res. 2005;75(3):171–8. Epub 2005/07/21. doi: 10.1024/0300-9831.75.3.171 16028632.

61. Astashkina AI, Mann BK, Prestwich GD, Grainger DW. 'Erratum to "Comparing predictive drug nephrotoxicity biomarkers in kidney 3-D primary organoid culture and immortalized cell lines" [Biomaterials 33 (2012) 4712–4721]'. Biomaterials. 2015;38 : 108. Epub 2014/12/17. doi: 10.1016/j.biomaterials.2014.10.072 25499931.

62. Tiong HY, Huang P, Xiong S, Li Y, Vathsala A, Zink D. Drug-induced nephrotoxicity: clinical impact and preclinical in vitro models. Mol Pharm. 2014;11(7):1933–48. Epub 2014/02/08. doi: 10.1021/mp400720w 24502545.


Článek vyšel v časopise

PLOS One


2019 Číslo 9
Nejčtenější tento týden
Nejčtenější v tomto čísle
Kurzy

Zvyšte si kvalifikaci online z pohodlí domova

Mazová zátka a její řešení
nový kurz

Svět praktické medicíny 2/2026 (znalostní test z časopisu)

Citikolin v neuroprotekci a neuroregeneraci – nové poznatky
Autoři: MUDr. Petr Výborný, CSc., FEBO

Revma Focus: Spondyloartritidy

Denzitometrie v praxi: od kvalitního snímku po správnou interpretaci
Autoři: prof. MUDr. Vladimír Palička, CSc., Dr.h.c., doc. MUDr. Václav Vyskočil, Ph.D., MUDr. Petr Kasalický, CSc., MUDr. Jan Rosa, Ing. Pavel Havlík, Ing. Jan Adam, Hana Hejnová, DiS., Jana Křenková

Všechny kurzy
Přihlášení
Zapomenuté heslo

Zadejte e-mailovou adresu, se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.

Přihlášení

Nemáte účet?  Registrujte se

#ADS_BOTTOM_SCRIPTS#