-
Články
Reklama
- Vzdělávání
- Časopisy
Top články
- Témata
Reklama- Kongresy
- Videa
- Podcasty
Nové podcasty
Reklama- Volná místa
Doporučené pozice
Reklama- Praxe
ReklamaSkin-associated lactic acid bacteria from North American bullfrogs as potential control agents of Batrachochytrium dendrobatidis
Authors: M. V. Niederle aff001; J. Bosch aff002; C. E. Ale aff001; M. E. Nader-Macías aff004; C. Aristimuño Ficoseco aff004; L. F. Toledo aff005; A. Valenzuela-Sánchez aff006; C. Soto-Azat aff006; S. E. Pasteris aff001
Authors place of work: Instituto Superior de Investigaciones Biológicas (INSIBIO), Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET) and Instituto de Biología “Dr. Francisco D. Barbieri”, Facultad de Bioquímica, Química y Farmacia, Universidad Nacional de Tuc aff001; Instituto Superior de Investigaciones Biológicas (INSIBIO), Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET) and Instituto de Biología “Dr. Francisco D. Barbieri”, Facultad de Bioquímica, Química y Farmacia, Universidad Nacional de Tuc aff001; Museo Nacional de Ciencias Naturales, CSIC, Madrid, Spain aff002; Research Unit of Biodiversity (CSIC, UO, PA), Oviedo University—Campus Mieres, Spain aff003; Centro de Referencia para Lactobacilos (CERELA), Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET), San Miguel de Tucumán, Argentina aff004; Laboratório de História Natural de Anfíbios Brasileiros (LaHNAB), Departamento de Biologia Animal, Instituto de Biologia, Universidade Estadual de Campinas, Campinas, São Paulo, Brazil aff005; Centro de Investigación para la Sustentabilidad, Facultad de Ciencias de la Vida, Universidad Andres Bello, Santiago, Chile aff006; Instituto de Ciencias Ambientales y Evolutivas, Facultad de Ciencias, Universidad Austral de Chile, Valdivia, Chile aff007; Organización No Gubernamental (ONG) Ranita de Darwin, Santiago, Chile aff008; Organización No Gubernamental (ONG) Ranita de Darwin, Valdivia, Chile aff009
Published in the journal: PLoS ONE 14(9)
Category: Research Article
doi: https://doi.org/10.1371/journal.pone.0223020Summary
The fungal pathogen Batrachochytrium dendrobatidis (Bd) is the causative agent of chytridiomycosis and has been a key driver in the catastrophic decline of amphibians globally. While many strategies have been proposed to mitigate Bd outbreaks, few have been successful. In recent years, the use of probiotic formulations that protect an amphibian host by killing or inhibiting Bd have shown promise as an effective chytridiomycosis control strategy. The North American bullfrog (Lithobates catesbeianus) is a common carrier of Bd and harbours a diverse skin microbiota that includes lactic acid bacteria (LAB), a microbial group containing species classified as safe and conferring host benefits. We investigated beneficial/probiotic properties: anti-Bd activity, and adhesion and colonisation characteristics (hydrophobicity, biofilm formation and exopolysaccharide-EPS production) in two confirmed LAB (cLAB-Enterococcus gallinarum CRL 1826, Lactococcus garvieae CRL 1828) and 60 presumptive LAB (pLAB) [together named as LABs] isolated from bullfrog skin.We challenged LABs against eight genetically diverse Bd isolates and found that 32% of the LABs inhibited at least one Bd isolate with varying rates of inhibition. Thus, we established a score of sensitivity from highest (BdGPL AVS7) to lowest (BdGPL C2A) for the studied Bd isolates. We further reveal key factors underlying host adhesion and colonisation of LABs. Specifically, 90.3% of LABs exhibited hydrophilic properties that may promote adhesion to the cutaneous mucus, with the remaining isolates (9.7%) being hydrophobic in nature with a surface polarity compatible with colonisation of acidic, basic or both substrate types. We also found that 59.7% of LABs showed EPS synthesis and 66.1% produced biofilm at different levels: 21% weak, 29% moderate, and 16.1% strong. Together all these properties enhance colonisation of the host surface (mucus or epithelial cells) and may confer protective benefits against Bd through competitive exclusion. Correspondence analysis indicated that biofilm synthesis was LABs specific with high aggregating bacteria correlating with strong biofilm producers, and EPS producers being correlated to negative biofilm producing LABs. We performed Random Amplified Polymorphic DNA (RAPD)-PCR analysis and demonstrated a higher degree of genetic diversity among rod-shaped pLAB than cocci. Based on the LAB genetic analysis and specific probiotic selection criteria that involve beneficial properties, we sequenced 16 pLAB which were identified as Pediococcus pentosaceus, Enterococcus thailandicus, Lactobacillus pentosus/L. plantarum, L. brevis, and L. curvatus. Compatibility assays performed with cLAB and the 16 species described above indicate that all tested LAB can be included in a mixed probiotic formula. Based on our analyses, we suggest that E. gallinarum CRL 1826, L. garvieae CRL 1828, and P. pentosaceus 15 and 18B represent optimal probiotic candidates for Bd control and mitigation.
Keywords:
Fungal pathogens – Bacterial biofilms – Amphibians – Lactobacillus – Exopolysaccharides – Enterococcus – probiotics – Lactic acid bacteria
Introduction
Amphibians play an important ecological role in the transport of energy from aquatic environments to terrestrial ecosystems, and several factors have been proposed to contribute to their population declines worldwide [1,2]. Among the threats to amphibian survival, the most commonly cited are habitat loss, pollution, the pet trade, climate change, and emerging infectious diseases (EID) [3]. Chytridiomycosis is a major amphibian EID caused by two congeneric species of chytrid fungi: Batrachochytrium salamandrivorans [4] and B. dendrobatidis (Bd) [5–8]. In anurans, Bd proliferates in the keratinized epithelial cells of post-metamorphic animals and the mouthparts of tadpoles [9] with mortality occurring due to osmotic imbalance and subsequent asystolic cardiac arrest [10]. In addition, Bd has been shown to inhibit normal lymphocyte function and proliferation and disturb cellular energy pathways [11,12].
To date, Bd control in nature has proven difficult [13] since amphibian populations can host multiple Bd genotypes, such as BdGPL (Global Panzootic Lineage), BdHybrid lineages, as well as endemic lineages [14,15]. There is only one effective practical intervention eradicating Bd based on antifungals [16], thus probiotics represent an attractive alternative tool for Bd control in nature [17–19] with potential advantages over antifungal drugs, which are difficult to apply in the wild and may have profound effects to the native microbiota of a host or ecosystem [16,20]. In aquaculture, probiotics may confer benefits to the health of their host or the environment through different modes of action including antagonistic activity against pathogens [15,20–28], enhanced competitive exclusion of pathogens through increased host microbial load and diversity [15,17,29], modulation of pathogen virulence, adhesion to host epithelial cells, stimulation of the immune response [17,30–32] and improvement of water quality [33].
In amphibians, the first line of defence against pathogens is the skin, where two key protective mechanisms may operate: the microbiota associated with the cutaneous structures (epithelial cells and mucus) [34], and the antimicrobial peptides produced by glandular glands and secreted within the host’s skin [35]. Bacterial species of the amphibian skin microbiome can provide protection from Bd infection through competition for nutrients and chemotactic factors [36,37], as well as through the production of antifungal metabolites [21]. Several in vitro studies have reported anti-Bd activity of skin-associated Gram-negative and some Gram-positive bacteria isolated from different amphibian species (Table 1). Based on the ability of bacteria to produce antifungal metabolites (such as violacein, prodigiosin, 2,4-diacetylphloroglucinol, indole-3-carboxaldehyde) some bacterial strains [20–28] or species combinations (e.g. production of tryptophol in Bacillus sp. and Chitinophaga arvensicola mixed communities) [38] have been selected as potential probiotics to mitigate Bd infection and chytridiomycosis development.
Tab. 1. Bacterial species and some of its identified anti-Batrachochytrium dendrobatidis (Bd) metabolites. The normal microbiota of North American bullfrog (Lithobates catesbeianus; from here on referred as “bullfrog”) skin in hatchery conditions is known to include Enterobacteriaceae (Citrobacter freundii, Enterobacter spp., Escherichia coli, E. blattae, Klebsiella spp., Proteus vulgaris), Pseudomonas aeruginosa, Staphylococcus epidermidis, Bacillus spp., Micrococcus spp. and Lactic Acid Bacteria (LAB) [39–43]. This last group is specifically classified as Gram-positive, catalase and oxidase negative, indol and nitrate negative, non-sporulating and usually non-motile microorganisms. According to studies performed in different niches, LAB comprise the following genera: Carnobacterium, Dolosigranulum, Lactobacillus (rods); Aerococcus, Alloiococcus, Enterococcus, Lactococcus, Leuconostoc, Oenococcus, Pediococcus, Streptococcus, Tetragenococcus, Vagococcus (cocci), and Weissella (coccoid or rod-shaped) [44–47].
On the basis of their Generally Regarded as Safe (GRAS) properties (no translocation ability, absence of virulence factors, no antibiotic resistance) [48], Food Grade characteristics and Qualified Presumption as Safety (QPS) for the European Food Safety Authority (EFSA) [49], some LAB species have been proposed as probiotics in aquaculture for infectious diseases control and improvement of zootechnic parameters (animal growth and nutrition) [50–52]. These microorganisms produce a range of antimicrobial metabolites such as organic acids, bacteriocins, diacetyl, and hydrogen peroxide. Bacteriocins are known to inhibit other LAB strains, some Gram-negative pathogens and Gram-positive spoilage bacteria [53,54], as well as moulds and yeasts [55,56].
A broad range of microbial characteristics such antimicrobial activity and adhesion/colonisation properties must be considered when selecting microorganisms to be included in a probiotic formula [48]. In particular, key properties include the hydrophobicity of the bacterial cell surface that can impact bacterial adhesion to skin epithelial cells [57], while auto-aggregation (an interaction phenomenon that occur between microorganisms of the same strain) [58], exopolysaccharide production and biofilm formation [52,59,60] can impede pathogen colonisation of the host skin [61].
Ranaculture is a branch of aquaculture that involves raising amphibians for commercial purposes. The bullfrog is the most globally reared amphibian species and is grown to provide meat while by-products such as the skin are used as a source of compounds in human antitumor therapy [62]. However, bullfrogs are vulnerable to bacterial infection diseases in hatcheries conditions and are also well known for its Bd carrier capability [63–66]. Since LAB are commonly found in the native microbiota of bullfrog hatcheries and some strains have previously been selected as probiotic candidates for control of Red-Leg Syndrome (RLS) [39–43], we evaluated their potential as probiotics by measuring the inhibitory activity of confirmed LAB (cLAB) and presumptive LAB (pLAB) from bullfrog skin on Bd isolates from multiple lineages, in addition to properties related to host adhesion and colonisation. Taking into account that microorganisms intended for inclusion in a probiotic product must be correctly identified [67], we carried out genotypic characterization of selected isolates as well as compatibility assays for the potential formulation of mixed probiotic consortia.
This study contributes to our understanding of probiotic design and demonstrates a potential future use of GRAS microorganisms for Bd control in situ and during the ex situ breeding of endangered amphibian species.
Material and methods
Microorganisms and culture conditions
For the all assays, unless otherwise stated, we used Enterococcus gallinarum CRL 1826, Lactococcus garvieae CRL 1828 (confirmed LAB-cLAB) and 60 presumptive LAB (pLAB) [together named as LABs, n = 62]. All bacteria were previously isolated from ventral and dorsal skin areas of captive bullfrogs in the fattening phase of growth in a hatchery located in central Argentina (Río Cuarto, Córdoba) [43]. All pLAB were classified based on staining (Gram-positive) and key biochemical properties (catalase negative, nitrate and indol negative) [43]. All LABs were grown in de Man, Rogosa and Sharpe broth (MRS in g/L: peptone, 10; meat extract, 10; yeast extract, 5; glucose, 20; sodium acetate, 5; triammonium citrate, 2; K2HPO3, 2; MgSO4.7H2O, 0,2; MnSO4.4H2O, 0,05; polyoxyethylene sorbitan mono-oleate-Tween 80, 1 mL) [68], pH 6.8 at 37°C for 12 h and then adapted by subsequent culture (72 h) in TG (16 g/L tryptone + 1 g/L glucose) broth, pH 7.0. In both culture media, the microorganisms were incubated in microaerophilia (5% CO2 atmosphere). For anti-Bd assays, we used eight Bd isolates belonging to hypervirulent, hypovirulent and hybrid lineages (Table 2). The isolates were cryopreserved in liquid nitrogen and recovered after two passages on tryptone-glucose-agar (0.9% w/v) (TGA) at 20°C for 7 to 10 days.
Tab. 2. Batrachochytrium dendrobatidis (Bd) isolates and their geographical origin. Anti-Batrachochytrium dendrobatidis (Bd) activity of confirmed and presumptive lactic acid bacteria (LABs)
We evaluated the anti-Bd activity of LABs using co-culture assays. Thus, after 4 days of Bd growth (maximum zoospore production), Bd plates were flooded with 3 mL of tryptone broth. After 20 min, the plates were flooded again and left to sit for another 20 min. The resulting liquid was then filtered through sterilized nylon (20 μm) and zoospore density was determined using a haemocytometer [23]. We then inoculated 500 μL of 2.7x106 Bd zoospores/mL on TGA and spread with a Drigalsky's spatula to produce a “lawn”. The plates were allowed to dry in a laminar flow hood until they were slightly moist and 10 μL of 1x105 CFU/mL LABs were streaked across the plates in a straight line and incubated for 7 to 10 days at 20°C. The score for antimicrobial activity was adapted from Park et al. [26] as follows: (A) no antifungal activity: the whole plate was evenly covered with Bd growth; (B) low antifungal activity: a minimal zone of zoospore inhibition; (C) medium antifungal activity: an asymmetrical inhibition area was observed around the bacterial zone of growth; (D) high antifungal activity: the Bd growth was only observed on the limits of the Petri plates; and (E) strong antifungal activity: no Bd growth was detected. A correlation analysis of anti-Bd activity of LABs was performed by using JMP Pro 12.1 software version (SAS Institute Inc.).
Hydrophobicity of the bacterial surface
We determined the hydrophobicity and Lewis acid/base properties of LABs by the Microbial Adhesion to Hydrocarbon (MATH) assay [73] using different organic solvents: xylene (apolar), chloroform (electron acceptor) and ethyl acetate (electron donor). The LABs were grown in MRS broth as indicated above, collected by centrifugation (3,000 g, 4°C) at the early logarithmic growth phase (7 h), washed twice and resuspended by using sterile distilled water to an Optical Density (OD600 nm) of 0.6. Chloroform, ethyl acetate and xylene (0.45 mL) were added to test tubes containing washed cells (2.7 mL). The samples were gently shaken in a vortex for 90 s. The tubes were left to stand for 15 min for separation of the both organic and aqueous phases. Then, the aqueous phase was separated with a 1000 μL micropipette and the OD was determined using a Shimadzu spectrophotometer (Shimadzu Corporation, Japan). The hydrophobicity was calculated using the following formula: % Hydrophobicity = [(OD before mixing-OD after mixing)/OD before mixing] x 100. The degree of bacterial hydrophobicity was classified as low (0–29%), medium (30–59%) or high (60–100%).
Exopolysaccharide (EPS) production and biofilm formation
We studied the EPS synthesis by LABs using the Congo red agar method [74]. The culture medium contained (in g/L): brain heart infusion, 37; sucrose, 50; agar, 10; and Congo red, 0.8. The stain was prepared as a concentrated aqueous solution and autoclaved separately (121°C, 15 min), while sucrose was sterilized using 0.2 μm Millipore membranes. Both stain and sucrose were added when the agar medium achieved 45°C. Plates were inoculated with 10 μL of 1x105 CFU/mL of each LABs and incubated for 48 h at 37°C in microaerophilic conditions. The presence of a dark blue microbial growth indicated that the isolate was an EPS producer. Lactobacillus casei CRL 87 was used as positive control [75].
The biofilm formation was assayed in each LABs using the crystal violet-stained microplate assay [76]. In brief, bacterial cells from the third subculture in MRS medium without Tween 80 were washed and resuspended in PBS solution pH 6.8 to get an OD540 nm of 1.2 (~ 4x108 CFU/mL). We then took a 100 μL bacterial suspensions and inoculated it into 2.5 mL MRS broth without Tween 80, an inhibitory surfactant of biofilm formation [76], and 200 μL aliquots were added to 96-well polystyrene microplates that were incubated under static conditions at 37°C for 72 h. Wells were washed three times using PBS solution at pH 6.8 and the quantification of the biofilm formed was carried out according to Leccese Terraf et al. [59,76]. Briefly, 200 μL crystal violet (0.1%) were added to the wells that were washed as indicated above after 15 min of co-incubation. The biofilm was detached using 200 μL absolute ethanol and quantified by measuring the OD540 nm. Additionally, sterile culture medium was included as negative control. For biofilm quantification, a cut-off (ODc) was defined as the mean OD value of the negative control. Based on the OD values obtained, LABs were classified as: negative (OD≤ODc), weak (ODc<OD≤ 2 x ODc), moderate (2 x ODc<OD≤ 4 x ODc) or strong (4 x ODc<OD) biofilm producers [77].
To interpret adhesion and colonisation properties of LABs, we carried out a multivariate correspondence analysis to evaluate the association between biofilm formation with EPS synthesis and auto-aggregation ability by using the InfoStat (2015p version) statistical software. For auto-aggregation, we used the data previously obtained in our research group [43]. All the assays mentioned above were performed in three independent trials and the average of the data were calculated and represented.
Principal Component Analysis (PCA) of probiotic beneficial/probiotic properties of confirmed and presumptive lactic acid bacteria (LABs)
We carried out a PCA using JMP Pro software version 12.1 (SAS Institute Inc.) to determine and visualize the beneficial/probiotic properties of studied LABs including auto-aggregation ability [43], hydrophobicity, EPS synthesis and biofilm formation.
DNA extraction and Random Amplified Polymorphic DNA (RAPD)-PCR analysis
For DNA extraction, LABs were grown in MRS broth as indicated above. Cells were recovered during the exponential growth phase (9 h) by centrifugation (3.000 x g, for 5 min at 4°C). Pellets were washed twice with sterile distilled water (SDW), fractioned in Eppendorf tubes containing 15 μL (SDW) and stored at -20°C. Then, cells were thawed, resuspended in 50 μL MilliQ water and microwaved at 700 W for 5 min [78].
The RAPD-PCR analysis is a simple and reliable method to assess DNA polymorphism. The ability to detect highly variable regions of DNA has application at the first stages of the bacterial species identification [79]. In this work, the M13 primer (5´GAGGGT GGCGGTTCT) [80] was used and the PCRs were performed in a TECHNE TC-512 thermocycler (Bibby Scientific, UK) under the following conditions: 5 min at 94°C of initial denaturation, 40 cycles consisting of 1 min at 94°C, 20 s at 45°C and 2 min at 72°C and a final extension at 72°C for 10 min. The RAPD reactions were carried out in a volume of 12.5 μL containing 3 mM MgCl2, buffer reaction (1x), dNTPs (200 μM each), 1 μM M13 primer, DNA (10–15 ng), and Taq DNA polymerase (0.1 IU; INBIO-Highway, Argentina). The RAPD products underwent electrophoresis at 100 V on a 2.5% agarose gel, stained with Gel Stain (Trans®, Beijing, China) and photographed under UV illumination. The RAPD-PCR patterns were grouped by means of cluster analysis with the Pearson product moment correlation coefficient and the unweighted pair group method using arithmetic averages (UPGMA). The RAPD band patterns (DNA fingerprint gel images) obtained were analysed using GelJ v.2.0 software [81] to obtain a dendrogram for both cocci and rods. Patterns with similarity values over 98% were considered genetically similar.
Genotypic identification of selected beneficial microorganisms
From the RAPD-PCR analysis, we selected 16 pLAB for 16S rDNA sequence analysis by applying two criteria: 1) isolates with antifungal activity against at least two Bd isolates of different lineages and the Expression of one Adhesion/Colonisation-EAC property (hydrophobicity, auto-aggregation, EPS or biofilm production); 2) isolates without anti-Bd activity and the expression of at least two EAC properties. To identify and classify the selected pLAB as LAB, we amplified and sequenced the variable regions of the 16S rDNA gene. The isolates were grown as indicated above and DNA was extracted according to Pospiech and Neumann [82]. The reaction was performed with PCR buffer (1x) (Invitrogen, California, USA), 2.5 mM MgCl2 (Invitrogen, California, USA), 0.2 mM dNTPs (Invitrogen, California, USA), 1 μM MLB16 (5´GGCTGCTGGCACGTAGTTAG) and PLB16 (5´AGAGTTTGATCCTGGCTCAG) primers (used to amplify an ~500 bp region of the 16S rDNA gene, which contained the V1 and V2 variable regions) [83], Taq DNA polymerase (2.5 U) (Invitrogen, California, USA) and MilliQ water, to get a final volume of 50 μL. DNA amplifications were performed in a Bio-Rad MyCycler™ under the following conditions: 4 min at 94°C of initial denaturation, 30 cycles consisting of 30 s at 94°C, 45 s at 52°C and 45 s at 72°C and a final extension at 72°C for 7 min. The PCR products were electrophoresed in 1% agarose gels, purified and sequenced using the DNA sequencing service of CERELA (Tucumán, Argentina). Identification was performed by comparing the obtained 16S rDNA sequences with those deposited in Genbank database using the BLAST algorithm and considering a percentage of identity ≥98% (e-value over 98% is = 0 in a fragment of 500 bp) as traditional species level cut-off.
Compatibility assays
To determine if the selected microorganisms could be included in a mixed probiotic product, we carried out compatibility assays among 18 LAB: E. gallinarum CRL 1826, L. garvieae CRL 1828 and the 16 LAB identified from 16S rDNA sequences analysis using the agar-well diffusion method [40,41,43]. All LAB were grown in TG broth for 9 h and the crude supernatants were used to determine its inhibitory effect. Compatibility assays consisted of 1x106 CFU/mL of one LAB (potentially indicator isolate) in five Petri plates containing soft TGA (0.7% w/v) that were punched to create 6 holes (10 mm each). Then, 100 μL of crude supernatants from each of the other 17 LAB (antagonistic metabolite producer isolates) were added to each well. Moreover, TG broth was used as a negative control. The presence of an inhibitory halo of the bacterial growth indicated that the isolates were not suitable for combining in a mixed probiotic consortia.
Results
Anti-Batrachochytrium dendrobatidis (Bd) activity of confirmed and presumptive lactic acid bacteria (LABs)
The anti-Bd activity of studied LABs against eight Bd isolates is presented in Table 3. Most LABs did not show any anti-Bd activity; however several LABs inhibited all Bd isolates with a score between low to medium. Likewise, three BdGPL and two hybrid isolates were highly inhibited by 10 LABs (Fig 1D and Table 3), while only two BdGPL isolates were strongly inhibited by five LABs (Fig 1E and Table 3). On this basis, we established an inhibitory score of sensitivity from highest to lowest inhibition for the studied Bd isolates: AVS7>CLFT159>CLFT024.02>CLFT001>AVS4>VA02>UM142>C2A.
Fig. 1. Score of in vitro anti-Batrachochytrium dendrobatidis (Bd) activity of confirmed and presumptive lactic acid bacteria isolated from North American bullfrog (Lithobates catesbeianus). Anti-Bd scored as: A) Negative (pLAB: 3 vs. Bd: UM142), B) low (pLAB: 35B vs. Bd: CLFT001), C) medium (pLAB: 16B vs. Bd: VA02), D) high (Enterococcus gallinarum CRL 1826 vs. Bd: AVS7), and E) strong (pLAB: 45B vs. Bd: AVS7). pLAB: presumptive lactic acid bacteria. Tab. 3. Percentage and number of confirmed and presumptive lactic acid bacteria (LABs) with anti-Batrachochytrium dendrobatidis (Bd) activity on eight fungal isolates. We observed that approximately 67.8% of bacterial isolates did not inhibit Bd growth (e.g., pLAB: 3 against Bd: UM142), 16.3% showed low inhibition (e.g., pLAB: 35B against Bd: CLFT 001), 11.3% medium inhibition (e.g., pLAB: 16B against Bd: VA02), 3.6% high inhibition (e.g., Enterococcus gallinarum CRL 1826 against Bd: AVS7) and 1% strong anti-Bd activity (e.g., pLAB: 45B against Bd: AVS7) (Fig 1). A summary of the antimicrobial activity of LABs against Bd isolates of different lineages is shown in Fig 2.
Fig. 2. Summary of the results of probiotic/beneficial properties of confirmed and presumptive lactic acid bacteria (LABs). Dendrogram built based on PCR-fingerprint profiles: A) cocci, B) rods. We show information regarding the anti-Batrachochytrium dendrobatidis (Bd) activity, auto-aggregation, hydrophobicity and biofilm formation for LABs isolated from ventral (VS) and dorsal (DS) skin of bullfrogs. N, negative; S, strong; H, high. Enterococcus gallinarum CRL 1826 was the most promising potential probiotic LAB since it inhibited the growth of all Bd isolates, with an efficacy ranging from low to high (Fig 2A). On the basis of the anti-Bd activity we also selected some tested pLAB as probiotic candidates. They include cocci 38B (medium inhibition against two hybrids, and from high to strong inhibition for two BdGPL isolates), 17B (medium to high inhibition against both two hybrids and three BdGPL isolates), 35B (medium inhibition against one hybrid and one BdGPL isolate) and 45A (from high to strong inhibition against one hybrid, and two BdGPL isolates, respectively) (Fig 2A). Among the rods, we selected the pLAB 1A (high inhibition against one hybrid), 17A and 45B (medium inhibition against one hybrid and from high to strong inhibition against two BdGPL isolates) (Fig 2B). Likewise, a partial correlation analysis used to evaluate the response of the Bd isolates when challenged with LABs revealed the pairs of Bd isolates that showed the highest similarity (i.e. higher positive associations) were VA02/C2A (0.5003), CLFT001/CLFT159 (0.4596) and AVS7/C2A (0.3604) (Table 4).
Tab. 4. Correlation analysis of anti-Batrachochytrium dendrobatidis (Bd) activity of confirmed and presumptive lactic acid bacteria (LABs). Hydrophobicity of the bacterial surface
Most of the LABs (90.3%) presented hydrophilic properties. For the hydrophobic isolates (9.7%), the mean values of adhesion to xylene, ethyl acetate and chloroform were 16.5%, 14.7% and 12.6% respectively. Some bacterial isolates showed both basic and acidic behaviour, such as E. gallinarum CRL 1826 and the pLAB 1B, 4C, 31, 39, 40A, and 40B, which exhibited a medium degree of hydrophobicity with xylene (nonpolar and acidic solvent; basic behaviour of the bacterial surface) as well as the pLAB 3, 10A, 10B, 17B, 22, and 40A with chloroform (monopolar and acidic solvent, basic bacterial surface properties). Likewise, pLAB 3, 22, 29, 38B, 40A, 43 and 42C demonstrated medium hydrophobicity using ethyl acetate (monopolar solvent; acidic bacterial surface character). From this group, we highlight isolate 40A, that adhered to all the solvents at the same level (37–43%) and this behaviour was likely due to the hydrophobic characteristics of its cell surface as observed for isolates 3 and 22, that adhered to chloroform and ethyl acetate (from 30.1 to 36.3%) (Fig 2).
Exopolysaccharide (EPS) production and biofilm formation
Our results show that 59.7% of LABs (n = 37) were EPS producers (e.g. L. garvieae CRL 1828, E. gallinarum CRL 1826 and the isolate 18B) (Fig 3). A total of 66.1% (n = 41) of LABs produced biofilm at different levels: 21% (n = 13) weak, 29% (n = 18) moderate, and 16.1% (n = 10) strong (Fig 2).
Fig. 3. Exopolysaccharide production by confirmed and presumptive lactic acid bacteria. An EPS (+) isolate is indicated by the presence of a dark blue microbial growth line. a) Enterococcus gallinarum CRL 1826; b) pLAB 18B; c) Lactobacillus casei CRL 87 (positive control). Correspondence analysis investigating the interaction between biofilm formation, EPS and auto-aggregation, showed that negative and moderate biofilm producing LABs were associated with non-EPS producers and low auto-aggregating microorganisms. Likewise, strong biofilm formation was associated with high auto-aggregating LABs, while those with weak biofilm production were related to LABs with medium auto-aggregating capability (Fig 4).
Fig. 4. Analysis of correspondence of biofilm formation, exopolysaccharide synthesis and auto-aggregation by confirmed and presumptive lactic acid bacteria. The contribution to Chi-square is indicated in brackets. Principal Component Analysis (PCA) of probiotic beneficial/probiotic properties by confirmed and presumptive lactic acid bacteria (LABs)
The first two components provided by the PCA explained 89.2% of the variation between the samples (79% Component 1 and 10.2% Component 2) (Fig 5). The biplot shows the results of the first two components (F1 and F2). Biofilm, EPS and hydrophobicity with xylene had high positive influence on component 1, while hydrophobicity with ethyl acetate and chloroform had a positive influence on component 2. Although the pLAB 40A and 22 (anti-Bd activity against BdHybrid and BdGPL linages) displayed hydrophobicity, the last pLAB also showed auto-aggregation. Overall, E. gallinarum CRL 1826 exhibited the best profile of beneficial properties including the widest range of anti-Bd activity (Fig 2).
Fig. 5. Principal Component Analysis (PCA) of beneficial properties (hydrophobicity in xylene, ethyl acetate and chloroform and AA-auto-aggregation, exopolysaccharide and biofilm formation) of confirmed and presumptive lactic acid bacteria (LABs). Averaged anti-Bd activity of every LABs for eight studied Bd isolates is shown by different colours (scored from 0: low inhibition for all studied Bd isolates to 4: high inhibition for all studied Bd isolates). Random Amplified Polymorphic DNA (RAPD)-PCR analysis and 16S rDNA gene sequencing
By considering a similarity pattern over 98% for LABs (n = 62), the genetic diversity among the cocci was 51% (21 different genotypes from 41 isolates) while for the rods was 90% (19 different genotypes from 21 isolates). Cluster analysis of RAPD-PCR patterns of LABs (41 cocci and 21 rods) revealed similarity values ranging from 54 to 100%. The cocci could be separated into two distinct main groups with similarity coefficient (SC) between 54–65%. The first main group (SC = 54%) included one subgroup with six genetically close isolates (SC = 97%), while the second main group (SC = 65%) included two subgroups, one comprising 22 isolates and a SC of 74%, and another group with 13 isolates and a SC of 81% (Fig 2A). The cluster analysis also demonstrated the presence of two principal groups of rod-shaped LABs with a SC of 55%. The first main group included two subgroups (SC = 81%) and three isolates each, while the second main group (SC = 74%) contained two subgroups with three and 12 isolates, respectively (Fig 2B). On the basis of RAPD-PCR results as well as established selection criteria, 16 pLAB (11 cocci and five rod-shaped) were selected for bacterial species identification by 16S rDNA gene sequencing analysis. The isolates were subsequently identified as Pediococcus pentosaceus, Enterococcus thailandicus, Lactobacillus pentosus/L. plantarum, L. brevis, and L. curvatus (Table 5). Pediococcus pentosaceus 15 and 16B were isolated from the same animal and showed similar beneficial properties. Likewise, P. pentosaceus 17B, 18B, 30A, 35B, 38B, 22 and 45A were isolated from different animals and expressed different probiotic characteristics. Enterococcus thailandicus 1B and 31, L. pentosus/L. plantarum 1A and 41A, L. brevis 40A and 41B were isolated from different animals and showed similar beneficial properties. Only one isolated was identified as L. curvatus 42C and showed surface properties and anti-Bd activity.
Tab. 5. Genetic identification of presumptive lactic acid bacteria (pLAB) using 16S rDNA sequence analysis. Compatibility assays among selected lactic acid bacteria
Since LAB showed broad-spectrum inhibition across a range of Bd isolates, there is potential to design a multi-strain probiotic that may be effective in mitigating chytridiomycosis outbreaks. To this end, we performed compatibility assays among the 18 LAB that included E. gallinarum CRL 1826, L. garvieae CRL 1828 and the 16 identified LAB listed in Table 5. From our compatibility results, we did not observe any inhibitory halos (data not shown), indicating that all LAB can be combined in the design of a mixed probiotic formula.
Discussion
Considering that Gram-negatives have been proposed as probiotics owing to their high Bd inhibitory activity against BdGPL isolates [21,84,85], that LAB belong to the native microbiota of bullfrogs [39–41,43] and known safety of certain species [48], we evaluated the following physiological parameters of LAB to assess their suitability as probiotics: 1) the in vitro anti-Bd activity of LABs isolated from bullfrog skin against several Bd isolates from diverse genotypes, some of them related to amphibian declines [15], and 2) properties related to host cell adhesion and colonisation. We demonstrate that antifungal activity of tested LABs varied based on Bd isolate, even among closely related Bd genotypes such as AVS4 and AVS7 [71]. The C2A (BdGPL) was the least sensitive isolate in terms of LAB inhibition. Likewise, E. gallinarum CRL 1826 demonstrated promise as a probiotic candidate for Bd control since it showed medium to high anti-Bd activity against all BdGPL isolates. However, the CRL 1826 strain showed low inhibition of Bd hybrids. Conversely, pLAB 17B and 35B inhibited Bd hybrids to a medium degree. These findings support those of Antwis and Harrison [86] who showed that inhibition of different BdGPL isolates by a single bacterial strain is unusual. The diverse Bd inhibitory patterns exhibited by LABs may be explained by the fact that both kind of microorganisms were isolated from different amphibian species and geographical regions. Muletz-Wolz et al. [27] found that in Bd-negative salamander species, a small number of anti-Bd bacterial strains were present on multiple host species at various localities, but none were shared among all species and localities, indicating the strong influence of the environment over the structure of bacterial skin communities. It was also found that bullfrogs can harbour one of the less sensitive BdHybrids: UM142 [66], but also LABs [39–41,43]. Therefore, we can hypothesize that some LAB and the UM142 isolate could have coevolved by developing resistance to some antimicrobial compounds produced by the prokaryote group.
The in vitro anti-Bd activity of LABs observed in this study could be attributed to antagonistic metabolites (hydrogen peroxide, organic acids, aroma compounds, and/or bacteriocins) that diffused from the bacterial growth streak. Hydrogen peroxide generates oxidative stress and affects cellular signalling pathways [87], while the organic (lactic and acetic) acids exert their antimicrobial action after penetrating cell membranes in their undissociated form, leading to a drop in the intercellular pH and to the disruption of metabolic activities [88]. It has been reported that hydrogen peroxide alone or combined with both, acetic and peracetic acids, inhibits Bd growth [89], while bacteriocins and volatile organic compounds may be responsible for Bd inhibition [90]. We hypothesize that some of the metabolic end-products (alone or combined) synthesized by LABs, and probably some of those cited in Table 1 but not studied in LAB, would be responsible of the anti-Bd activity, and the mechanism of inhibition would depend on both LABs and each particular Bd isolate/lineage. However, competitive exclusion during the in vivo assays should not be discarded, especially when the potentially probiotic microorganisms have properties related to adhesion and colonisation processes.
The microbial surface plays an important role in how microbes interact with other microorganisms and the environment, mainly through adhesion to bacteria, eukaryotic cells [91] and other surfaces that allow colonisation of different ecosystems/hosts [92,93]. The mechanisms of bacterial adhesion include electrostatic and hydrophobic interactions (low affinity mechanisms) for which the acidic or basic characteristics (polarity) of the cell surface have a relevant role and can be used as criteria to predict adhesion capability [73,94]. Since hydrophobicity of the bacterial surface may be related to bacterial growth on hydrophobic substrates, auto-aggregation, biofilm formation and adhesion to host cells [57,95], this surface property must be considered as a relevant criterion for probiotics selection. The high proportion of hydrophilic microorganisms found in our experiments could be related to both the aqueous environment and the chemical nature of the mucus [96], and support the reported results for LAB isolated from another bullfrog hatchery in Argentina [39,41]. Hydrophilic LABs appear to be suitable probiotic candidates since they adhere better to the host mucus than epithelium, and would eliminate Bd by competitive exclusion and/or anti-Bd activity together with other components of the mucosome [14]. Considering that Bd is a keratinophilic pathogen [97] and thus must go through the mucus barrier to reach the outer epidermal layers, hydrophobic LABs may be relevant because they can adhere to the skin epithelial cells and inhibit fungal infections by specific blockage of cell receptors or inhibiting host attachment by steric interactions. Our hydrophobic LABs showed different patterns of surface polarity (acidic or basic). In Lactobacillus strains it has been shown that following an initial nonspecific contact with host epithelial cells, specific interactions occur between specialized molecules (adhesins) and epithelial cell receptors, in addition to S-coat proteins [98]. Therefore, based on our findings we propose that E. gallinarum CRL 1826 and pLAB 17B (medium hydrophobicity, auto-aggregating, anti-Bd activity), L. garvieae CRL 1828 (hydrophilic, auto-aggregating, without anti-Bd activity), the pLAB: 22, 29, 35B, 38B, 40A, and 40B (medium hydrophobicity, with anti-Bd activity), 43 (medium hydrophobicity, without anti-Bd activity), and 1A, 15, 18B, 30A, 41A and 45A (hydrophilic, with anti-Bd activity) may be potential probiotic candidates.
Bacterial surface polysaccharides are considered key macromolecules in determining microbe-host interactions through passive forces, electrostatic interactions, and hydrophobic and steric forces [99,100]. Surface polysaccharide production is widely reported in LAB isolates, in particular among members of the Lactobacillus genus [101,102]. Since polysaccharides display a high diversity among LAB [103], they are thought to be involved in determining relevant strain-specific properties for probiotic action, such as the degree of bacterial adhesion to host cells [104–106,60]. We evaluated EPS synthesis by LABs to inform the selection of potentially probiotic isolates with the goal of obtaining a high proportion of EPS producers. This beneficial property and those cited above, support the selection of E. gallinarum CRL 1826 and the pLAB 1A, 15, 18B, 40B, and 41A as potential probiotic candidates. Recently, Ringø et al. [52] established that live LAB from fish aquaculture can produce bioactive compounds such as EPS that maintain the natural state of microbe-associated molecular patterns (MAMP) structures contributing to the superiority of immunostimulant effects over the inactivated form of LAB.
Biofilm formation by LAB promotes mucosal colonisation and can mask epithelial cell receptors by preventing pathogen adhesion by competitive exclusion [107,108]. Our results indicate that approximately 45% of tested LABs were moderate/strong biofilm producers. This ability, together with the anti-Bd activity and surface properties, suggest the following bacterial isolates in the selection of probiotic candidates: E. gallinarum CRL 1826, L. garvieae CRL 1828 and the pLAB 15, 18B and 43. Although bacterial aggregation and EPS synthesis have a role on biofilm formation [109,110], our correspondence analysis indicated that biofilm synthesis was LABs specific with high aggregating bacteria correlating with strong biofilm producers, and EPS producers being correlated to negative biofilm producing LABs. With respect to aquaculture, Lamari et al. [111] reported biofilm production on abiotic surfaces in potentially probiotic Lactobacillus casei strains from Artemia sp. cultures and proposed the possible ability of LAB to colonise the gut, and to further antagonize pathogens.
Our RAPD-PCR results for LABs indicated a higher degree of genetic diversity among the rods than the cocci when using similarity patterns over 98%. However, other authors have been less rigorous and reported that similarity patterns over a reproducibility level of 83 and 85% were considered genetically similar for LAB from fermentation processes [112,113]. In line with our specified criteria, we selected 16 pLAB (cocci and rods) for 16S rDNA sequencing that allowed us to classify them as LAB, with E. thailandicus being reported for the first time from bullfrog skin, but not the other identified species [39,41].
Interestingly, the same genus and species identified in this work has been isolated from different bullfrog specimens and skin (ventral and dorsal) areas. These findings could be explained by the life-history of hosts, which carry out their biological cycle in aquatic and terrestrial environments, facilitating an ongoing microbiota exchange. Although we detected differences in the probiotic characteristics expressed by isolates of the same genus and species, these are likely due to strain-specific factors. Additional studies are therefore required to identify LAB species at the strain level.
The use of microbial consortia in probiotic formulations would provide advantages over single microorganisms, in part due to the wider range of beneficial functions conferred by a community [114–116]. Our results indicate that all LAB selected as probiotic candidates can be used in the design of a mixed formula, effective against all Bd isolates studied in this work. In this bacterial consortium, each bacterial strain would participate with a specific probiotic property (anti-Bd activity against one or more Bd lineage, and/or characteristics related to adhesion and colonisation) that could potentially act in synergy.
The experimental framework presented here represents the basis to select LAB as probiotics for Bd control, but other in vitro assays such as adhesion to keratin and resistance to amphibian antimicrobial peptides present in the skin mucus must be performed to select suitable LAB for in vivo studies. Considering that bacteria with anti-Bd activity have had variable success for Bd control by bioaugmentation [27], experimental assays with selected LAB strains (alone or in bacterial consortia) must include different amphibian species from diverse geographical regions to guarantee their effectiveness. These studies will allow us to determine long-term persistence of the administered LAB and to propose a specific protocol of LAB administration for a particular amphibian species.
Conclusion
This is the first report on skin-associated LAB from bullfrogs to advance in the design of a probiotic product with applications in Bd control and mitigation. Our analysis of anti-Bd activity and adhesion/colonisation properties have allowed us to select 18 LAB, with E. gallinarum CRL 1826, L. garvieae CRL 1828, P. pentosaceus 15 and 18B being the best probiotic candidates.
Zdroje
1. Catenazzi A. State of the world's amphibians. Annu Rev Environ Resour.2015; 40 : 91–119.
2. Scheele BC, Pasmans F, Skerratt LF, Berger L, Martel A, Beukema W et al. Amphibian fungal panzootic causes catastrophic and ongoing loss of biodiversity. Science.2019; 363(6434):1459–1463. doi: 10.1126/science.aav0379 30923224
3. Stuart SN, Chanson JS, Cox NA, Young BE, Rodrigues ASL, Fischman DL. The status of the world's land and marine mammals: diversity, threat, and knowledge. Science.2008; 322(5899):225–230. doi: 10.1126/science.1165115 18845749
4. Martel A, Spitzen-van der Sluijs A, Blooi M, Bert W, Ducatelle R, Fisher MC et al. Batrachochytrium salamandrivorans sp. nov. causes lethal chytridiomycosis in amphibians. Proc Natl Acad Sci.2013; 110(38):15325–15329. doi: 10.1073/pnas.1307356110 24003137
5. Longcore JE, Pessier AP, Nichols DK. Batrachochytrium dendrobatidis gen. et sp. nov., a chytrid pathogenic to amphibians. Mycologia.1999; 91 : 219–227.
6. Gower DJ, Doherty-Bone T, Loader SP, Wilkinson M, Kouete MT, Tapley B et al. Batrachochytrium dendrobatidis infection and lethal chytridiomycosis in caecilian amphibians (Gymnophiona). Ecohealth.2013; 10(2):173–183. doi: 10.1007/s10393-013-0831-9 23677560
7. Rendle M, Tapley B, Perkins M, Bittencourt-Silva G, Gower DJ, Wilkinson M. Itraconazole treatment of Batrachochytrium dendrobatidis (Bd) infection in captive caecilians (Amphibia: Gymnophiona) and the first case of Bd infection in a wild neotropical caecilian. J Zoo Aquar Res.2015; 3(4):137–140.
8. Lambertini C, Becker CG, Bardier C, da Silva Leite D, Toledo LF. Spatial distribution of Batrachochytrium dendrobatidis in South American caecilians. Dis Aquat Organ.2017; 124(2):109–116. doi: 10.3354/dao03114 28425424
9. Berger L, Hyatt AD, Speare R, Longcore JE. Life cycle stages of the amphibian chytrid Batrachochytrium dendrobatidis. Dis Aquat Organ.2005; 68 : 51–63. doi: 10.3354/dao068051 16465834
10. Voyles J, Young S, Berger L, Campbell C, Voyles WF, Dinudom A et al. Pathogenesis of chytridiomycosis, a cause of catastrophic amphibian declines. Science.2009; 326(5952):582–585. doi: 10.1126/science.1176765 19900897
11. Fites JS, Reinert LK, Chappell TM, Rollins-Smith LA. Inhibition of local immune responses by the frog-killing fungus Batrachochytrium dendrobatidis. Infection and Immunity.2014; 82(11): 4698–4706. doi: 10.1128/IAI.02231-14 25156734
12. Grogan LF, Robert J, Berger L, Skerratt LF, Scheele BC, Castley JG et al. Review of the amphibian immune response to chytridiomycosis, and future directions. Front Immunol.2018; 9 : 2536. doi: 10.3389/fimmu.2018.02536 30473694
13. Garner TW, Schmidt BR, Martel A, Pasmans F, Muths E, Cunningham AAet al. Mitigating amphibian chytridiomycoses in nature. Philos Trans R Soc Lond B Biol Sci.2016; 371 : 1709.
14. Antwis RE, Weldon C. Amphibian skin defences show variation in ability to inhibit growth of Batrachochytrium dendrobatidis isolates from the Global Panzootic Lineage. Microbiology. 2017; 63 : 1835–1838.
15. Greenspan SE, Lambertini C, Carvalho T, James TY, Toledo LF, Haddad CFB et al. Hybrids of amphibian chytrid show high virulence in native hosts. Sci Rep.2018; 8 : 9600. doi: 10.1038/s41598-018-27828-w 29941894
16. Bosch J, Sanchez-Tomé E, Fernández-Loras A, Oliver JA, Fisher MC, Garner TW. Successful elimination of a lethal wildlife infectious disease in nature. Biol Lett.2015; 11(11):e20150874.
17. Bletz MC, Loudon AH, Becker MH, Bell SC, Woodhams DC, Minbiole KP et al. Mitigating amphibian chytridiomycosis with bioaugmentation: characteristics of effective probiotics and strategies for their selection and use. Ecol Lett.2013; 16(6):807–820. doi: 10.1111/ele.12099 23452227
18. Küng D, Bigler L, Davis LR, Gratwicke B, Griffith E, Woodhams DC. Stability of microbiota facilitated by host immune regulation: informing probiotic strategies to manage amphibian disease. PLoS One.2014; 9(1):e87101. doi: 10.1371/journal.pone.0087101 24489847
19. Rebollar EA, Simonetti SJ, Shoemaker WR, Harris RN. Direct and indirect horizontal transmission of the antifungal probiotic bacterium Janthinobacterium lividum on green frog (Lithobates clamitans) tadpoles. Appl Environ Microbiol.2016; 82 : 2457–2466. doi: 10.1128/AEM.04147-15 26873311
20. Antwis RE, Preziosi RF, Harrison XA, Garner TW. Amphibian symbiotic bacteria do not show a universal ability to inhibit growth of the global panzootic lineage of Batrachochytrium dendrobatidis.2015; 81(11):3706–3711.
21. Woodhams DC, LaBumbard BC, Barnhart KL, Becker MH, Bletz MC, Escobar LA et al. Prodigiosin, violacein, and volatile organic compounds produced by widespread cutaneous bacteria of amphibians can inhibit two Batrachochytrium fungal pathogens. Microb Ecol.2018; 75(4):1049–1062. doi: 10.1007/s00248-017-1095-7 29119317
22. Brucker RM, Reid N, Harris CR, Gallaher TN, Flaherty DC, Lam BA et al. Amphibian chemical defense: antifungal metabolites of the microsymbiont Janthinobacterium lividum on the salamander Plethodon cinereus. J Chem Ecol.2008; 34 : 1422–1429. doi: 10.1007/s10886-008-9555-7 18949519
23. Harris RN, Brucker RM, Walke JB, Becker MH, Schwantes CR, Flaherty DC et al. Skin microbes on frogs prevent morbidity and mortality caused by a lethal skin fungus. ISME J.2009; 3(7):818–824. doi: 10.1038/ismej.2009.27 19322245
24. Harris RN, Lauer A, Simon MA, Banning JL, Alford RA. Addition of antifungal skin bacteria to salamanders ameliorates the effects of chytridiomycosis. Dis Aquat Organ.2009; 83(1):11–16. doi: 10.3354/dao02004 19301631
25. Becker MH, Harris RN. Cutaneous bacteria of the redback salamander prevent morbidity associated with a lethal disease. PLoS One.2010; 5(6):e10957. doi: 10.1371/journal.pone.0010957 20532032
26. Park ST, Collingwood AM, St-Hilaire S, Sheridan PP. Inhibition of Batrachochytrium dendrobatidis caused by bacteria isolated from the skin of boreal toads, Anaxyrus (Bufo) boreas boreas, from Grand Teton National Park, Wyoming, USA. Microbiol Insights.2014; 7 : 1–8. doi: 10.4137/MBI.S13639 24826077
27. Muletz-Wolz CR, DiRenzo GV, Yarwood SA, Campbell Grant EH, Fleischer RC, Lips KR. Antifungal bacteria on woodland salamander skin exhibit high taxonomic diversity and geographic variability. Appl Environ Microbiol.2017; 83(9):e00186–17. doi: 10.1128/AEM.00186-17 28213545
28. Piovia-Scott J, Rejmanek D, Woodhams DC, Worth SJ, Kenny H, McKenzie V et al. Greater species richness of bacterial skin symbionts better suppresses the amphibian fungal pathogen Batrachochytrium dendrobatidis. Microb Ecol.2017; 74(1):217–226. doi: 10.1007/s00248-016-0916-4 28064360
29. Kueneman JG, Woodhams DC, Harris R, Archer HM, Knight R, McKenzie VJ. Probiotic treatment restores protection against lethal fungal infection lost during amphibian captivity. Proc Biol Sci.2016; 283 : 1839.
30. Lazado CC, Caipang CM. Mucosal immunity and probiotics in fish. Fish Shellfish Immun.2014; 39(1):78–89.
31. Fdhila K, Haddaji N, Chakroun I, Dhiaf A, Macherki MEE, Khouildi B et al. Culture conditions improvement of Crassostrea gigas using a potential probiotic Bacillus sp strain. Microb Pathog.2017; 110 : 654–658. doi: 10.1016/j.micpath.2017.07.017 28710014
32. Batista S, Medina A, Pires MA, Moriñigo MA, Sansuwan K, Fernandes KJM et al. Innate immune response, intestinal morphology and microbiota changes in Senegalese sole fed plant protein diets with probiotics or autolysed yeast. Appl Microbiol Biotechnol.2016; 100(16):7223–7238. doi: 10.1007/s00253-016-7592-7 27183997
33. Hai NV. The use of probiotics in aquaculture. J Appl Microbiol.2015; 119(4):917–935. doi: 10.1111/jam.12886 26119489
34. Belden LK, Harris RN. Infectious diseases in wildlife: the community ecology context. Front Ecol Environ.2007; 10(5):533–539.
35. Rollins-Smith L, Conlon JM. Antimicrobial peptide defenses against chytridiomycosis, an emerging infectious disease of amphibian populations. Dev Comp Immunol.2005; 29(7):589–598. doi: 10.1016/j.dci.2004.11.004 15784290
36. Toledo RC, Jared C. Cutaneous granular glands and amphibian venoms. Camp Biochem Physiol.1995; 1(1):1–29.
37. Moss AS, Reddy NS, Dortaj IM, San Francisco MJ. Chemotaxis of the amphibian pathogen Batrachochytrium dendrobatidis and its response to a variety of attractants. Mycologia.2008; 100(1):1–5. 18488347
38. Loudon AH, Holland JA, Umile TP, Burzynski EA, Minbiole KP, Harris RN. Interactions between amphibians' symbiotic bacteria cause the production of emergent anti-fungal metabolites. Front Microbiol.2014; 5 : 441. doi: 10.3389/fmicb.2014.00441 25191317
39. Pasteris SE, Bühler MI, Nader-Macías ME. Microbiological and histological studies in farmed-bullfrog (Rana catesbeiana) displaying red-leg syndrome. Aquaculture.2006; 251 : 11–18.
40. Pasteris SE, Roig Babot G, Otero MC, Bühler MI, Nader MEF. Beneficial properties of lactic acid bacteria isolated from a Rana castesbeiana hatchery. Aquac Res.2009; 40 : 1605–1615.
41. Pasteris SE, Vera Pingitore E, Roig Babot G, Otero MC, Bühler MI, Nader-Macías ME. Characterization of the beneficial properties of lactobacilli isolated from bullfrog (Rana catesbeiana) hatchery. Antonie van Leeuwenhoek. 2009; 95 : 375–385.
42. Pasteris SE, Montel Mendoza G, Llanos RJ, Pucci Alcaide FJ, Nader‐Macías MEF. Preliminary assessment of in vivo safety of potentially probiotic lactic acid bacteria for American bullfrog culture. Aquac Res.2017; 48(5):2157–2172.
43. Montel Mendoza GM, Pasteris SE, Ale CE, Otero MC, Bühler MI, Nader-Macías ME. Cultivable microbiota of Lithobates catesbeianus and advances in the selection of lactic acid bacteria as biological control agents in raniculture. Res Vet Sci.2012; 93 : 1160–1167. doi: 10.1016/j.rvsc.2012.05.007 22695175
44. Ahmed FE. Genetically modified probiotics in foods. Trends Biotechnol.2003; 21(11):491–497. doi: 10.1016/j.tibtech.2003.09.006 14573362
45. Walter J, Schwab C, Loach DM, Gänzle MG, Tannock GW. Glucosyltransferase A (GtfA) and inulosucrase (Inu) of Lactobacillus reuteri TMW1.106 contribute to cell aggregation, in vitro biofilm formation, and colonization of the mouse gastrointestinal tract. Microbiology.2008; 154 : 72–80. doi: 10.1099/mic.0.2007/010637-0 18174127
46. Ventura M, O'Flaherty S, Claesson MJ, Turroni F, Klaenhammer TR, van Sinderen Det al. Genome-scale analyses of health-promoting bacteria: probiogenomics. Nat Rev Microbiol.2009; 7(1):61–71. doi: 10.1038/nrmicro2047 19029955
47. Fusco V, Quero GM, Cho GS, Kabisch J, Meske D, Neve H et al. The genus Weissella: taxonomy, ecology and biotechnological potential. Front Microbiol.2015; 6 : 155. doi: 10.3389/fmicb.2015.00155 25852652
48. Reid G, Sanders ME, Gaskins HR, Gibson GR, Mercenier A, Rastall R et al. New scientific paradigms for probiotics and prebiotics. J Clin Gastroenterol.2003; 37(2):105–118. doi: 10.1097/00004836-200308000-00004 12869879
49. European Food Safety Authority. EFSA Journal 2008; 732 : 1–15.
50. Zorriehzahra MJ, Delshad ST, Adel M, Tiwari R, Karthik K, Dhama K et al. Probiotics as beneficial microbes in aquaculture: an update on their multiple modes of action: a review. Vet Q.2016; 36(4):228–241. doi: 10.1080/01652176.2016.1172132 27075688
51. Gao X, Zhang M, Li X, Han Y, Wu F, Liu Y. The effects of feeding Lactobacillus pentosus on growth, immunity, and disease resistance in Haliotis discus hannai Ino. Fish Shellfish Immun.2018; 78 : 42–51.
52. Ringø E, Hoseinifar SH, Ghosh K, Doan HV, Beck BR, Song SK. Lactic acid bacteria in finfish-an update. Front Microbiol.2018; 9 : 1818. doi: 10.3389/fmicb.2018.01818 30147679
53. Quintana G, Niederle MV, Minahk CJ, Picariello G, Nader-Macías MEF, Pasteris SE. Nisin Z produced by Lactococcus lactis from bullfrog hatchery is active against Citrobacter freundii, a red-leg syndrome related pathogen. World J Microbiol Biotechnol.2017; 33 : 186. doi: 10.1007/s11274-017-2353-z 28956240
54. Sarika AR, Lipton AP, Aishwarya MS, Rachana Mol RS. Lactic acid bacteria from marine fish: antimicrobial resistance and production of bacteriocin effective against L. monocytogenes in situ. J Food Microbiol Saf Hyg.2017; 2 : 4.
55. Digaitiene A, Hansen ÅS, Juodeikiene G, Eidukonyte D, Josephsen J. Lactic acid bacteria isolated from rye sourdoughs produce bacteriocin-like inhibitory substances active against Bacillus subtilis and fungi. J App Microbiol.2012; 112(4):732–742.
56. Graham CE, Cruz MR, Garsin DA, Lorenz MC. Enterococcus faecalis bacteriocin EntV inhibits hyphal morphogenesis, biofilm formation, and virulence of Candida albicans. Proc Natl Acad Sci USA.2017; 114(17):4507–4512. doi: 10.1073/pnas.1620432114 28396417
57. Ringø E, Løvmo L, Kristiansen M, Bakken Y, Salinas I, Myklebust R et al. Lactic acid bacteria vs. pathogens in the gastrointestinal tract of fish: A review. J Aquac Res Dev. 2010; 41 : 451–467.
58. Kaktcham PM, Temgoua JB, Zambou FN, Diaz-Ruiz G, Wacher C, Pérez-Chabela ML. In vitro evaluation of the probiotic and safety properties of bacteriocinogenic and non-bacteriocinogenic lactic acid bacteria from the intestines of Nile tilapia and common carp for their use as probiotics in aquaculture. Probiotics Antimicrob Proteins.2018; 10(1):98–109. doi: 10.1007/s12602-017-9312-8 28752423
59. Leccese Terraf MC, Mendoza LM, Juárez Tomás MS, Silva C, Nader-Macías ME. Phenotypic surface properties (aggregation, adhesion and biofilm formation) and presence of related genes in beneficial vaginal lactobacilli. J Appl Microbiol.2014; 117(6):1761–1772. doi: 10.1111/jam.12642 25195810
60. Živković M, Miljković MS, Ruas-Madiedo P, Markelić MB, Veljović K, Tolinački M et al. EPS-SJ exopolysaccharide produced by the strain Lactobacillus paracasei subsp. paracasei BGSJ2-8 is involved in adhesion to epithelial intestinal cells and decrease on E. coli association to Caco-2 cells. Front Microbiol.2016; 7 : 286. doi: 10.3389/fmicb.2016.00286 27014210
61. Watters C, Fleming D, Bishop D, Rumbaugh KP. Host responses to biofilm. Prog Mol Biol Transl Sci. 2016; 142 : 193–239. doi: 10.1016/bs.pmbts.2016.05.007 27571696
62. Amaral-Machado L, Xavier-Júnior FH, Rutckeviski R, Morais AR, Alencar ÉN, Dantas TRet al. New trends on antineoplastic therapy research: bullfrog (Rana catesbeiana Shaw) oil nanostructured systems. Molecules.2016; 21(5).
63. Garner TW, Perkins MW, Govindarajulu P, Seglie D, Walker S, Cunningham AAet al. The emerging amphibian pathogen Batrachochytrium dendrobatidis globally infects introduced populations of the North American bullfrog, Rana catesbeiana. Biol Lett.2006; 2(3):455–459. doi: 10.1098/rsbl.2006.0494 17148429
64. Schloegel LM, Ferreira CM, James TY, Hipolito M, Longcore J. E., Hyatt A. D. et al. The North American bullfrog as a reservoir for the spread of Batrachochytrium dendrobatidis in Brazil. Anim Conserv.2009;13(s1):53–61.
65. Bataille A, Fong JJ, Cha M, Wogan GOU, Baek HJ, Lee H et al. Genetic evidence for a high diversity and wide distribution of endemic strains of the pathogenic chytrid fungus Batrachochytrium dendrobatidis in wild Asian amphibians. Mol Ecol.2013; 22(16):4196–4209. doi: 10.1111/mec.12385 23802586
66. Schloegel LM, Toledo LF, Longcore JE, Greenspan SE, Vieira CA, Lee M et al. Novel, panzootic and hybrid genotypes of amphibian chytridiomycosis associated with the bullfrog trade. Mol Ecol 2012; 21(21):5162–5177. doi: 10.1111/j.1365-294X.2012.05710.x 22857789
67. FAO/WHO (2001) Health and nutritional properties of probiotics in food including powder milk with live lactic acid bacteria. http://www.who.int/foodsafety/publications/fs_management/en/probiotics.pd
68. de Man JC, Rogosa M, Sharpe ME. Medium for the cultivation of lactobacilli. J App Bacteriol.1960; 23 : 130–135.
69. Rosenblum EB, James TY, Zamudio KR, Poorten TJ, Ilut D, Rodriguez D et al. Complex history of the amphibian-killing chytrid fungus revealed with genome resequencing data. Proc Natl Acad Sci USA.2013; 110(23):9385–9390. doi: 10.1073/pnas.1300130110 23650365
70. Mesquita AFC, Lambertini C, Lyra M, Malagoli LR, James TY, Toledo LFet al. Low resistance to chytridiomycosis in direct-developing amphibians. Sci Rep.2017; 7(1):16605. doi: 10.1038/s41598-017-16425-y 29192210
71. Valenzuela-Sánchez A, O'Hanlon SJ, Alvarado-Rybak M, Uribe-Rivera DE, Cunningham AA, Fisher MC et al. Genomic epidemiology of the emerging pathogen Batrachochytrium dendrobatidis from native and invasive amphibian species in Chile. Transbound Emerg Dis.2018; 65(2):309–314. doi: 10.1111/tbed.12775 29205924
72. O'Hanlon SJ, Rieux A, Farrer RA, Rosa GM, Waldman B, Bataille A et al. Recent Asian origin of chytrid fungi causing global amphibian declines. Science.2018; 360(6389):621–627. doi: 10.1126/science.aar1965 29748278
73. Rosenberg M, Doyle RJ. Microbial cell surface hydrophobicity: History, measurement, and significance. MBio.1990; 1–38.
74. Freeman DJ, Falkiner FR, Keane CT. New method for detecting slime production by coagulase negative staphylococci. J Clin Pathol.1989; 42 : 872–874. doi: 10.1136/jcp.42.8.872 2475530
75. Mozzi F, Gerbino E, Font de Valdez G, Torino MI. Functionality of exopolysaccharides produced by lactic acid bacteria in an in vitro gastric system. J Appl Microbiol.2009; 107(1):56–64. doi: 10.1111/j.1365-2672.2009.04182.x 19291238
76. Leccese Terraf MC, Juárez Tomás MS, Nader-Macías ME, Silva C. Screening of biofilm formation by beneficial vaginal lactobacilli and influence of culture media components. J Appl Microbiol.2012; 113(6):1517–1529. doi: 10.1111/j.1365-2672.2012.05429.x 22897406
77. Borges SF, Silva JG, Teixeira PC. Survival and biofilm formation of Listeria monocytogenes in simulated vaginal fluid: influence of pH and strain origin. FEMS Immunol Med Microbiol.2011; 62(3):315–320. doi: 10.1111/j.1574-695X.2011.00815.x 21569122
78. Reyes-Escogido L, Balam-Chi M, Rodríguez-Buenfil I, Valdés J, Kameyama L, Martínez-Pérez F. Purification of bacterial genomic DNA in less than 20 min using chelex-100 microwave: examples from strains of lactic acid bacteria isolated from soil samples. Antonie van Leeuwenhoek.2010; 98(4):465–474. doi: 10.1007/s10482-010-9462-0 20556655
79. Fraga J, Pelayo L, Sariego I, Rojas L, Nuñez FA. RAPD technique: Obtention genetic markers of pathogenesis in infections by Trichomonas vaginalis and Giardia lamblia. Rev Soc Ven Microbiol.2004; 24(1):238–245.
80. Huey B, Hall J. Hypervariable DNA fingerprinting in Escherichia coli: minisatellite probe from bacteriophage M13. J Bacteriol.1989; 171(5):2528–2532. doi: 10.1128/jb.171.5.2528-2532.1989 2565332
81. Heras J, Domínguez C, Mata E, Pascual V, Lozano C, Torres C et al. Gel J–a tool for analysing DNA fingerprint gel images. BMC Bioinformatics.2015; 16 : 270. doi: 10.1186/s12859-015-0703-0 26307353
82. Pospiech A, Neumann B. A versatile quick-prep of genomic DNA from gram-positive bacteria. Trends Genet.1995; 11(6):217–218. doi: 10.1016/s0168-9525(00)89052-6 7638902
83. Kullen MJ, Sanozky-Dawes RB, Crowell DC, Klaenhammer TR. Use of the DNA sequence of variable regions of the 16S rRNA gene for rapid and accurate identification of bacteria in the Lactobacillus acidophilus complex. J Appl Microbiol.2000; 89 : 511–516. doi: 10.1046/j.1365-2672.2000.01146.x 11021584
84. Becker MH, Walke JB, Cikanek S, Savage AE, Mattheus N, Santiago CNet al. Composition of symbiotic bacteria predicts survival in Panamanian golden frogs infected with a lethal fungus. Proc R Soc Lond.2015; 282 : 20142881.
85. Becker MH, Walke JB, Murrill L, Woodhams DC, Reinert LK, Rollins-Smith LAet al. Phylogenetic distribution of symbiotic bacteria from Panamanian amphibians that inhibit growth of the lethal fungal pathogen Batrachochytrium dendrobatidis. Mol Ecol.2015; 24 : 1628–1641. doi: 10.1111/mec.13135 25737297
86. Antwis RE, Harrison XA. Probiotic consortia are not uniformly effective against different amphibian chytrid pathogen isolates. Mol Ecol.2017; 27(2):577–589.
87. Linley E, Denyer SP, McDonnell G, Simons C, Maillard JY. Use of hydrogen peroxide as a biocide: new consideration of its mechanisms of biocidal action. J Antimicrob Chemother.2012; 67 : 1589–1596. doi: 10.1093/jac/dks129 22532463
88. Guimarães A, Venancio A, Abrunhosa L. Antifungal effect of organic acids from lactic acid bacteria on Penicillium nordicum. Food Addit Contam Part A Chem Anal Control Expo Risk Assess.2018; 35(9):1803–1818. doi: 10.1080/19440049.2018.1500718 30016195
89. Van Rooij P, Pasmans F, Coen Y, Martel A. Efficacy of chemical disinfectants for the containment of the salamander chytrid fungus Batrachochytrium salamandrivorans. PLoS One.2017; 12(10):e0186269. doi: 10.1371/journal.pone.0186269 29023562
90. Woodhams DC, Bletz M, Kueneman J, McKenzie V. Managing amphibian disease with skin microbiota. Trends Microbiol.2016; 24(3):161–164. doi: 10.1016/j.tim.2015.12.010 26916805
91. Ly MH, Vo H, Le TM, Belin JM, Waché Y. Diversity of the surface properties of lactococci and consequences on adhesion to food components. Colloids Surf B Biointerfaces.2006; 52(2):149–153. doi: 10.1016/j.colsurfb.2006.04.015 16844359
92. Etzold S, Juge N. Structural insights into bacterial recognition of intestinal mucins. Curr Opin Struct Biol.2014; 28 : 23–31. doi: 10.1016/j.sbi.2014.07.002 25106027
93. Mercier-Bonin M, Chapot-Chartier M-P. Surface proteins of Lactococcus lactis: bacterial resources for muco-adhesion in the gastrointestinal tract. Front Microbiol.2017; 8 : 2247. doi: 10.3389/fmicb.2017.02247 29218032
94. Ofek I, Doyle R. Methods, models and analysis of bacterial adhesion. In: Ofek I, Doyle R, editors. Bacterial adhesion to cells and tissues. Chapman and Hall, New York.1994. pp.16–20.
95. Sánchez-Ortiz AC, Luna-González A, Campa-Córdova A I, Escamilla-Montes R, Flores-Miranda MC, Mazón-Suástegui JM. Isolation and characterization of potential probiotic bacteria from pustulose ark (Anadara tuberculosa) suitable for shrimp farming. Lat Am J Aquat Res.2015; 43(1):123–136.
96. Fontana C, Cocconcelli PS, Vignolo G. Direct molecular approach to monitoring bacterial colonization on vacuum-packaged beef. Appl Environ Microbiol. 2006; 72(8):5618–5622. doi: 10.1128/AEM.00029-06 16885317
97. Berger L, Hyatt AD, Speare R, Longcore JE. Life cycle stages of the amphibian chytrid Batrachochytrium dendrobatidis. Dis Aquat Organ.2005; 68 : 51–63. doi: 10.3354/dao068051 16465834
98. Otero MC, Ocaña VS, Nader-Macías ME. Bacterial surface characteristics applied to selection of probiotic microorganisms. Methods Mol Biol. 2004; 268 : 435–440. doi: 10.1385/1-59259-766-1 : 435 15156054
99. Servin AL. Antagonistic activities of lactobacilli and bifidobacteria against microbial pathogens. FEMS Microbiol Rev.2004; 28 : 405–440. doi: 10.1016/j.femsre.2004.01.003 15374659
100. Lebeer S, Verhoeven SLA, Francius G, Schoofs G, Lambrichts I, Dufrêne Y. Identification of a gene cluster for the biosynthesis of a long, galactose-rich exopolysaccharide in Lactobacillus rhamnosus GG and functional analysis of the priming glycosyltransferase. Appl Environ Microbiol.2009; 75(11): 3554–3563. doi: 10.1128/AEM.02919-08 19346339
101. Wang X, Shao C, Liu L, Guo X, Xu Y, Lü X et al. Optimization, partial characterization and antioxidant activity of an exopolysaccharide from Lactobacillus plantarum KX041. Int J Biol Macromol.2017; 103 : 1173–1184. doi: 10.1016/j.ijbiomac.2017.05.118 28551435
102. Tu NHK, Dat NV, Canh LV, Vinh DTT. Detection of the potential inactivation of Tetrodotoxin by lactic acid bacterial exopolysaccharide. Toxins.2018; 10(7).
103. Puertas AI, Ibarburua I, Elizaquivel P, Zuriarraina A, Berregia I, López P. Disclosing diversity of exopolysaccharide-producing lactobacilli from Spanish natural ciders. Int J Food Sci Technol.2018; 90 : 469–474.
104. Ruas-Madiedo P, Gueimonde M, Margolles A, de los Reyes-Gavilán CG, Salminen S. Exopolysaccharides produced by probiotic strains modifies the adhesion of probiotics and enteropathogens to human intestinal mucus. J Food Prot.2006; 69 : 2011–2015. doi: 10.4315/0362-028x-69.8.2011 16924934
105. Polak-Berecka M, Wa´sko A, Paduch R, Skrzypek T, Sroka-Bartnicka A. The effect of cell surface components on adhesion ability of Lactobacillus rhamnosus. Antonie van Leeuwenhoek.2014; 106 : 751–762. doi: 10.1007/s10482-014-0245-x 25090959
106. Dertli E, Mayer MJ Narbad A. Impact of the exopolysaccharide layer on biofilms, adhesion and resistance to stress in Lactobacillus johnsonii FI9785. BMC Microbiol.2015; 15 : 8. doi: 10.1186/s12866-015-0347-2 25648083
107. Martín R, Soberón N, Vaneechoutte M, Flórez AB, Vázquez F, Suárez JE. Characterization of indigenous vaginal lactobacilli from healthy women as probiotic candidates. Int Microbiol.2008; 11 : 261–266. doi: 10.2436/20.1501.01.70 19204898
108. Borisa S, Barbés C. Role played by lactobacilli in controlling the population of vaginal pathogens. Microbes Infect.2017; 2(5):543–546.
109. Rickard AH, Gilbert P, High NJ, Kolenbrander PE, Handley PS. Bacterial coaggregation: an integral process in the development of multi-species biofilms. Trends Microbiol.2003; 11 : 94–100. doi: 10.1016/s0966-842x(02)00034-3 12598132
110. Lebeer S, Verhoeven TLA, Perea Velez M, Vanderleyden J, De Keersmaecker SCJ. Impact of environmental and genetic factors on biofilm formation by the probiotic strain Lactobacillus rhamnosus GG. J Appl Environ Microbiol.2007; 73(21):6768–6775.
111. Lamari F, Mahdhi A, Chakroun I, Esteban MA, Mazurais D, Amina B et al. Interactions between candidate probiotics and the immune and antioxidative responses of European sea bass (Dicentrarchus labrax) larvae. J Fish Dis.2016; (39):1421–1432.
112. Silva LF, Casella T, Gomes ES, Nogueira MC, De Dea Lindner J, Penna AL. Diversity of lactic acid bacteria isolated from Brazilian water buffalo mozzarella cheese. J Food Sci.2015; 80(2):M411–417. doi: 10.1111/1750-3841.12771 25597646
113. Touret T, Oliveira M, Semedo-Lemssaddek T. Putative probiotic lactic acid bacteria isolated from sauerkraut fermentations. PLoS One.2018; 13(9):e0203501. doi: 10.1371/journal.pone.0203501 30192827
114. Mastromarino P, Capobianco D, Miccheli A, Praticò G, Campagna G, Laforgia N et al. Administration of a multistrain probiotic product (VSL#3) to women in the perinatal period differentially affects breast milk beneficial microbiota in relation to mode of delivery. Pharmacol Res.2015; (95–96):63–70.
115. Virchenko OV, Falalyeyeva TM, Beregova TV, Spivak MY, Lazarenko LM, Demchenko OM. Effects of mono-, poly - and composite probiotics on the ulceration caused by restraint stress. Fiziol Zh. 2015; 61(1):35–41. 26040033
116. Kobyliak N, Falalyeyeva T, Virchenko O, Mykhalchyshyn G, Bodnar P, Spivak M et al. Comparative experimental investigation on the efficacy of mono - and multiprobiotic strains in non-alcoholic fatty liver disease prevention. BMC Gastroenterol.2016; 16 : 34. doi: 10.1186/s12876-016-0451-2 26976285
Článek Drink driving engagement in women: An exploration of context, hazardous alcohol use, and behaviourČlánek Rare earth elements in paddy fields from eroded granite hilly land in a southern China watershedČlánek Effect of calcium glucoheptonate on proliferation and osteogenesis of osteoblast-like cells in vitroČlánek Unexpected sawtooth artifact in beat-to-beat pulse transit time measured from patient monitor dataČlánek Vibrational behavior of psyllids (Hemiptera: Psylloidea): Functional morphology and mechanismsČlánek Free will beliefs are better predicted by dualism than determinism beliefs across different culturesČlánek The anatomy of a crushing bite: The specialised cranial mechanics of a giant extinct kangarooČlánek The genetic alteration spectrum of the SWI/SNF complex: The oncogenic roles of BRD9 and ACTL6AČlánek Myotendinous asymmetries derived from the prolonged practice of badminton in professional playersČlánek Identification of bovine CpG SNPs as potential targets for epigenetic regulation via DNA methylationČlánek Genetic variability and consequence of Mycobacterium tuberculosis lineage 3 in Kampala-UgandaČlánek Residual stenosis after carotid artery stenting: Effect on periprocedural and long-term outcomesČlánek uORF-Tools—Workflow for the determination of translation-regulatory upstream open reading framesČlánek Medicine and the media: Medical experts’ problems and solutions while working with journalistsČlánek Primary hyperhidrosis prevalence and characteristics among medical students in Rio de JaneiroČlánek Antibacterial activity of silver nanoparticles of different particle size against Vibrio NatriegensČlánek Study on Dalfampridine in the treatment of Multiple Sclerosis Mobility Disability: A meta-analysisČlánek Association between the posterior part of the circle of Willis and the vertebral artery hypoplasiaČlánek Lymphocyte proliferation induced by high-affinity peptides for HLA-B*51:01 in Behçet’s uveitisČlánek Inhibition of gap junctional intercellular communication by an anti-migraine agent, flunarizineČlánek The intake pattern and feed preference of layer hens selected for high or low feed conversion ratioČlánek Individualized pattern recognition for detecting mind wandering from EEG during live lecturesČlánek Endothelial dysfunction and low-grade inflammation in the transition to renal replacement therapyČlánek Feeling the heat: Elevated temperature affects male display activity of a lekking grassland birdČlánek A zero-shot learning approach to the development of brain-computer interfaces for image retrievalČlánek Correction: The mean cell volume difference (dMCV) reflects serum hypertonicity in diabetic dogsČlánek Supplementation strategies affect the feed intake and performance of grazing replacement heifersČlánek Prediction of cardiovascular disease risk among people with severe mental illness: A cohort studyČlánek Factors influencing the admission decision for Medical Psychiatry Units: A concept mapping approachČlánek Physiological stress reactivity and recovery related to behavioral traits in dogs (Canis familiaris)Článek Correction: Unraveling the genetic complexity underlying sorghum response to water availabilityČlánek Is this a man’s world? The effect of gender diversity and gender equality on firm innovativenessČlánek Human cord blood (hCB)-CD34+ humanized mice fail to reject human acute myeloid leukemia cellsČlánek Correction: The prognosis of heart failure patients: Does sodium level play a significant role?Článek Correction: Age, sex and storage time influence hair cortisol levels in a wild mammal populationČlánek The impact of admission serum lactate on children with moderate to severe traumatic brain injuryČlánek PTP1B negatively regulates nitric oxide-mediated Pseudomonas aeruginosa killing by neutrophilsČlánek Ecophysiological impacts of Esca, a devastating grapevine trunk disease, on Vitis vinifera L.Článek Correction: Lkb1 Deficiency Alters Goblet and Paneth Cell Differentiation in the Small IntestineČlánek Synteny and phylogenetic analysis of paralogous thyrostimulin beta subunits (GpB5) in vertebratesČlánek The conditional Fama-French model and endogenous illiquidity: A robust instrumental variables testČlánek Structural characterization of EGFR exon 19 deletion mutation using molecular dynamics simulationČlánek Differences in the impedance of cochlear implant devices within 24 hours of their implantationČlánek Changing educational gradient in long-term care-free life expectancy among German men, 1997-2012Článek Organic resolution function and effects of platinum nanoparticles on bacteria and organic matterČlánek Genetically distinct Group B Streptococcus strains induce varying macrophage cytokine responsesČlánek National trends in inpatient endometriosis admissions: Patients, procedures and outcomes, 2006−2015Článek Predictors of SLE relapse in pregnancy and post-partum among multi-ethnic patients in MalaysiaČlánek Dysregulation of microRNAs and target genes networks in human abdominal aortic aneurysm tissuesČlánek Time-related immunomodulation by stressors and corticosterone transdermal application in toadsČlánek Retraction: Adaptive double threshold energy detection based on Markov model for cognitive radioČlánek Out-of-pocket health spending among Medicare beneficiaries: Which chronic diseases are most costly?Článek Lipidome profiles of postnatal day 2 vaginal swabs reflect fat composition of gilt’s postnatal dietČlánek Human papillomavirus infection among head and neck squamous cell carcinomas in southern ChinaČlánek Quartet-based inference of cell differentiation trees from ChIP-Seq histone modification dataČlánek The genome of Alcaligenes aquatilis strain BU33N: Insights into hydrocarbon degradation capacityČlánek LMX1A inhibits C-Myc expression through ANGPTL4 to exert tumor suppressive role in gastric cancerČlánek Global smoking trends in inflammatory bowel disease: A systematic review of inception cohortsČlánek A review of the elusive bicolored iris Snouted Treefrogs (Anura: Hylidae:Scinax uruguayus group)Článek Development of peptide biosensor for the detection of dengue fever biomarker, nonstructural 1Článek Advancing computational biology and bioinformatics research through open innovation competitionsČlánek A mutation in mouse Krüppel-like factor 15 alters the gut microbiome and response to obesogenic dietČlánek The CrowdWater game: A playful way to improve the accuracy of crowdsourced water level class dataČlánek Self-management action and motivation of Pacific adults in New Zealand with end-stage renal diseaseČlánek The erythrocyte membrane stability is associated with sleep time and social jetlag in shift workersČlánek The ‘Saw but Forgot’ error: A role for short-term memory failures in understanding junction crashes?Článek Effects of inorganic nitrogen and litters of Masson Pine on soil organic carbon decompositionČlánek Post-translational S-glutathionylation of cofilin increases actin cycling during cocaine seekingČlánek Dorsal tongue porphyrin autofluorescence and Candida saprophytism: A prospective observational studyČlánek Correction: Reward abundance interferes with error-based learning in a visuomotor adaptation taskČlánek Metabolisable energy content in canine and feline foods is best predicted by the NRC2006 equationČlánek Resource consumption of multi-substance users in the emergency room: A neglected patient groupČlánek Correction: Development of a high-throughput assay to measure measles neutralizing antibodiesČlánek Research on multi-agent genetic algorithm based on tabu search for the job shop scheduling problemČlánek Prognostic nomogram predicts overall survival in pulmonary large cell neuroendocrine carcinomaČlánek A high-density exome capture genotype-by-sequencing panel for forestry breeding in Pinus radiataČlánek In-hospital cardiopulmonary resuscitation of patients with cirrhosis: A population-based analysisČlánek Spatiotemporal clustering of malaria in southern-central Ethiopia: A community-based cohort studyČlánek Sign and goal tracker rats process differently the incentive salience of a conditioned stimulusČlánek Modeling spatial variation in density of golden eagle nest sites in the western United StatesČlánek Cinobufacini ameliorates experimental colitis via modulating the composition of gut microbiota
Článek vyšel v časopisePLOS One
Nejčtenější tento týden
2019 Číslo 9- Zachyťte pacienty s akutními porfyriemi, aby nebloudili zdravotnictvím
- Auris One: Když se dokumentace v ordinaci praktika začne psát „sama“
- „Jednohubky“ z klinického výzkumu – 2026/11
- Prof. Jan Škrha: Metformin je bezpečný, ale je třeba jej bezpečně užívat a léčbu kontrolovat
- Není statin jako statin aneb praktický přehled rozdílů jednotlivých molekul
-
Všechny články tohoto čísla
- "The dead shall be raised": Multidisciplinary analysis of human skeletons reveals complexity in 19th century immigrant socioeconomic history and identity in New Haven, Connecticut
- Characterization of ecto- and endoparasite communities of wild Mediterranean teleosts by a metabarcoding approach
- Drink driving engagement in women: An exploration of context, hazardous alcohol use, and behaviour
- The effect of birth weight on body composition: Evidence from a birth cohort and a Mendelian randomization study
- Dolutegravir based antiretroviral therapy compared to other combined antiretroviral regimens for the treatment of HIV-infected naive patients: A systematic review and meta-analysis
- Expression profile of genes encoding allatoregulatory neuropeptides in females of the spider Parasteatoda tepidariorum (Araneae, Theridiidae)
- “My life after stroke through a camera lens”- A photovoice study on participation in Sweden
- Bacterial community composition of biofilms in milking machines of two dairy farms assessed by a combination of culture-dependent and –independent methods
- Health differences between multiple and single job holders in precarious employment in the Netherlands: A cross-sectional study among Dutch workers
- Clinical evaluation and budget impact analysis of cervical cancer screening using cobas 4800 HPV screening technology in the public sector of South Africa
- Rare earth elements in paddy fields from eroded granite hilly land in a southern China watershed
- High-throughput sequencing analysis of microbial community diversity in response to indica and japonica bar-transgenic rice paddy soils
- Physiological and molecular responses to drought stress in teak (Tectona grandis L.f.)
- Long-term performance of an atrial lead capable of accelerometer based detection of cardiac contractility in patients receiving cardiac resynchronisation therapy
- Ectomycorrhizal fungal communities of secondary tropical forests dominated by Tristaniopsis in Bangka Island, Indonesia
- Downregulation of hippocampal NR2A/2B subunits related to cognitive impairment in a pristane-induced lupus BALB/c mice
- Demonstrating specificity of bioactive peptide nucleic acids (PNAs) targeting microRNAs for practical laboratory classes of applied biochemistry and pharmacology
- Xenopus fraseri: Mr. Fraser, where did your frog come from?
- Competing priorities and second chances - A qualitative exploration of prisoners’ journeys through the Hepatitis C continuum of care
- Evaluating coral trophic strategies using fatty acid composition and indices
- Amyloid β oligomers inhibit growth of human cancer cells
- Distraction of olfactory bulb-medial prefrontal cortex circuit may induce anxiety-like behavior in allergic rhinitis
- Hormonal, metabolic and inflammatory circulating biomarker profiles in obese and non-obese Brazilian middle-aged women
- 'He usually has what we call normal fevers’: Cultural perspectives on healthy child growth in rural Southeastern Tanzania: An ethnographic enquiry
- Anatomical connections underlying personally-familiar face processing
- Fe limitation decreases transcriptional regulation over the diel cycle in the model diatom Thalassiosira pseudonana
- Fructose-1,6-bisphosphate prevents pulmonary fibrosis by regulating extracellular matrix deposition and inducing phenotype reversal of lung myofibroblasts
- Correction: Development of interval-valued fuzzy GRA with SERVPERF based on subjective and objective weights for evaluation of airline service quality: A case study of Korea low-cost carriers
- Anatomical analysis of antebrachial cutaneous nerve distribution pattern and its clinical implications for sensory reconstruction
- Characterization of doxycycline-dependent inducible Simian Virus 40 large T antigen immortalized human conjunctival epithelial cell line
- Topographic correlation and asymmetry analysis of ganglion cell layer thinning and the retinal nerve fiber layer with localized visual field defects
- Structuring a conceptual model for cost-effectiveness analysis of frailty interventions
- Characteristics of sarcopenia after distal gastrectomy in elderly patients
- Action spectrum for photoperiodic control of thyroid-stimulating hormone in Japanese quail (Coturnix japonica)
- The determinants of lung cancer after detecting a solitary pulmonary nodule are different in men and women, for both chest radiograph and CT
- Taste perception and oral microbiota are associated with obesity in children and adolescents
- Target women: Equity in access to mHealth technology in a non-communicable disease care intervention in Kenya
- Correction: Attitudes to and experiences with body weight control and changes in body weight in relation to all-cause mortality in the general population
- Homogenous HIV-1 subtype B from the Brazilian Amazon with infrequent diverse BF1 recombinants, subtypes F1 and C among blood donors
- Glucocorticoid stimulation increases cardiac contractility by SGK1-dependent SOCE-activation in rat cardiac myocytes
- Loss of control as a violation of expectations: Testing the predictions of a common inconsistency compensation approach in an inclusionary cyberball game
- Living on the edge - circadian habitat usage in pre-weaning European hares (Lepus europaeus) in an intensively used agricultural area
- NMDA receptor activation induces long-term potentiation of glycine synapses
- Antibody response in snakes with boid inclusion body disease
- Can they imagine the future? A qualitative study exploring the skills employers seek in pharmaceutical sciences doctoral graduates
- Affirmative citation bias in scientific myth debunking: A three-in-one case study
- Streaming chunk incremental learning for class-wise data stream classification with fast learning speed and low structural complexity
- Time trends in healthy lifestyle among adults in Germany: Results from three national health interview and examination surveys between 1990 and 2011
- The impact of door-to-electrocardiogram time on door-to-balloon time after achieving the guideline-recommended target rate
- A systematic review and network meta-analysis of existing pharmacologic therapies in patients with idiopathic sudden sensorineural hearing loss
- Effect of calcium glucoheptonate on proliferation and osteogenesis of osteoblast-like cells in vitro
- CCR2 knockout ameliorates obesity-induced kidney injury through inhibiting oxidative stress and ER stress
- Multi-method assessment of whale shark (Rhincodon typus) residency, distribution, and dispersal behavior at an aggregation site in the Red Sea
- Duration of symptoms in the quantification of upper limb disability and impairment for individuals with mild degenerative cervical myelopathy (DCM)
- Expression of genes in the skeletal muscle of individuals with cachexia/sarcopenia: A systematic review
- Correction: Alopecia areata patients show deficiency of FOXP3+CD39+ T regulatory cells and clonotypic restriction of Treg TCRβ-chain, which highlights the immunopathological aspect of the disease
- Alcohol, tobacco and cannabis use are associated with job loss at follow-up: Findings from the CONSTANCES cohort
- Estimation of the incidence of animal rabies in Punjab, India
- G-protein-coupled receptor 40 agonist GW9508 potentiates glucose-stimulated insulin secretion through activation of protein kinase Cα and ε in INS-1 cells
- Reasons behind stymied public hospital governance reform in China
- Cognitive and social congruence in peer-assisted learning – A scoping review
- The wing of the ToxR winged helix-turn-helix domain is required for DNA binding and activation of toxT and ompU
- Associations between sexual activity and weight status: Findings from the English Longitudinal Study of Ageing
- Knowledge and practices regarding toxoplasmosis in housewives: A cross sectional study in a northern Mexican city
- Citation gaming induced by bibliometric evaluation: A country-level comparative analysis
- Can we predict which species win when new habitat becomes available?
- Wetlands are keystone habitats for jaguars in an intercontinental biodiversity hotspot
- Research applications of primary biodiversity databases in the digital age
- The Edinburgh Postpartum Depression Scale: Stable structure but subscale of limited value to detect anxiety
- EV71 3C protease induces apoptosis by cleavage of hnRNP A1 to promote apaf-1 translation
- Post-exercise high-sensitivity troponin T levels in patients with suspected unstable angina
- Unexpected sawtooth artifact in beat-to-beat pulse transit time measured from patient monitor data
- Development of highly sensitive and low-cost DNA agarose gel electrophoresis detection systems, and evaluation of non-mutagenic and loading dye-type DNA-staining reagents
- Human mesenchymal stromal cells ameliorate complement induced inflammatory cascade and improve renal functions in a rat model of ischemia-reperfusion induced acute kidney injury
- Macrophage phenotype and its relationship with renal function in human diabetic nephropathy
- Phylogeography of the dugong (Dugong dugon) based on historical samples identifies vulnerable Indian Ocean populations
- Vibrational behavior of psyllids (Hemiptera: Psylloidea): Functional morphology and mechanisms
- Evaluation of the effectiveness and equity of the maternity protection reform in Chile from 2000 to 2015
- Baseline human gut microbiota profile in healthy people and standard reporting template
- Are screening methods useful in feature selection? An empirical study
- Free will beliefs are better predicted by dualism than determinism beliefs across different cultures
- How does the content of nutrients in soil affect the health status of trees in city parks?
- Understanding the intricacy of canid social systems: Structure and temporal stability of red fox (Vulpes vulpes) groups
- The anatomy of a crushing bite: The specialised cranial mechanics of a giant extinct kangaroo
- Nurse-led medicines’ monitoring in care homes, implementing the Adverse Drug Reaction (ADRe) Profile improvement initiative for mental health medicines: An observational and interview study
- Projecting burden of hypertension and its management in Turkey, 2015-2030
- Polyamine biosynthesis in Xenopus laevis: the xlAZIN2/xlODC2 gene encodes a lysine/ornithine decarboxylase
- Cytokines in agitated and non-agitated patients admitted to an acute psychiatric department: A cross-sectional study
- Acute pancreatitis risk after kidney transplantation: Propensity score matching analysis of a national cohort
- Understanding the effect of producers’ attitudes, perceived norms, and perceived behavioral control on intentions to use antimicrobials prudently on New York dairy farms
- Safety assessment of a novel C-type natriuretic peptide derivative and the mechanism of bone- and cartilage-specific toxicity
- Theory of mind in remitted bipolar disorder: Interpersonal accuracy in recognition of dynamic nonverbal signals
- Graviola (Annona muricata) attenuates behavioural alterations and testicular oxidative stress induced by streptozotocin in diabetic rats
- Ecological conditions experienced by offspring during pregnancy and early post-natal life determine mandible size in roe deer
- Calculation of the contribution rate of China’s hydraulic science and technology based on a feedforward neural network
- ViraMiner: Deep learning on raw DNA sequences for identifying viral genomes in human samples
- The absence of interleukin 10 affects the morphology, differentiation, granule content and the production of cryptidin-4 in Paneth cells in mice
- Relationship between Helicobacter pylori infection and obesity in Chinese adults: A systematic review with meta-analysis
- Moving model analysis on the transient pressure and slipstream caused by a metro train passing through a tunnel
- The importance of assigning responsibility during evaluation in order to increase student satisfaction from physical education classes: A structural equation model
- Lower dormancy with rapid germination is an important strategy for seeds in an arid zone with unpredictable rainfall
- Gene Cascade Finder: A tool for identification of gene cascades and its application in Caenorhabditis elegans
- Proteomics approach to identify serum biomarkers associated with the progression of diabetes in Korean patients with abdominal obesity
- Malaria vaccine candidates displayed on novel virus-like particles are immunogenic and induce transmission-blocking activity
- Transcriptome analysis of a nematode resistant and susceptible upland cotton line at two critical stages of Meloidogyne incognita infection and development
- Identification of variant HIV envelope proteins with enhanced affinities for precursors to anti-gp41 broadly neutralizing antibodies
- Distinguishing mild cognitive impairment from healthy aging and Alzheimer’s Disease: The contribution of the INECO Frontal Screening (IFS)
- Novel application of amino-acid buffered solution for neuroprotection against ischemia/reperfusion injury
- Are unpopular children more likely to get sick? Longitudinal links between popularity and infectious diseases in early childhood
- Vegetation communities on commercial developments are heterogenous and determined by development and landscaping decisions, not socioeconomics
- Falls among community-dwelling older adults in Ethiopia; A preliminary cross-sectional study
- Retraction: Social success of perfumes
- The effect of ethyl alcohol on the severity of injuries in fatal pedestrian victims of traffic crashes
- Drought stress has transgenerational effects on soybean seed germination and seedling vigor
- Prevalence of benign osseous lesions of the spine and association with spinal pain in the general population in whole body MRI
- Age-related differences of inter-joint coordination in elderly during squat jumping
- Isolation of five Enterobacteriaceae species harbouring blaNDM-1 and mcr-1 plasmids from a single paediatric patient
- Diagnostic performance and image quality of iterative model-based reconstruction of coronary CT angiography using 100 kVp for heavily calcified coronary vessels
- CAC1 knockdown reverses drug resistance through the downregulation of P-gp and MRP-1 expression in colorectal cancer
- Getting your game on: Using virtual reality to improve real table tennis skills
- Microbiological contamination of young children’s hands in rural Bangladesh: Associations with child age and observed hand cleanliness as proxy
- Expansion of the agricultural frontier in the largest South American Dry Forest: Identifying priority conservation areas for snakes before everything is lost
- Utility of lung ultrasound in ANCA-associated vasculitis with lung involvement
- Aerial surveys cause large but ephemeral decreases in bear presence at salmon streams in Kodiak, Alaska
- Exposure to particle debris generated from passenger and truck tires induces different genotoxicity and inflammatory responses in the RAW 264.7 cell line
- Influence of the cultivation medium and pH on the pigmentation of Trichophyton rubrum
- Intra-arterial catheter-directed CT angiography for assessment of endovascular aortic aneurysm repair
- Association of antibiotic exposure with the mortality in metastatic colorectal cancer patients treated with bevacizumab-containing chemotherapy: A hospital-based retrospective cohort study
- The genetic alteration spectrum of the SWI/SNF complex: The oncogenic roles of BRD9 and ACTL6A
- Plasma chemistry in nesting leatherback sea turtles (Dermochelys coriacea) from Florida: Understanding the importance of sample hemolysis effects on blood analytes
- Myotendinous asymmetries derived from the prolonged practice of badminton in professional players
- Computational tools to detect signatures of mutational processes in DNA from tumours: A review and empirical comparison of performance
- Exposure to lipopolysaccharide (LPS) reduces contractile response of small airways from GSTCD-/- mice
- Generation of a protective murine monoclonal antibody against the stem of influenza hemagglutinins from group 1 viruses and identification of resistance mutations against it
- Comparative compositional and functional analyses of Bothrops moojeni specimens reveal several individual variations
- Radiation hardness of cadmium telluride solar cells in proton therapy beam mode
- Bourdieu, networks, and movements: Using the concepts of habitus, field and capital to understand a network analysis of gender differences in undergraduate physics
- A 32-channel parallel transmit system add-on for 7T MRI
- Comparison between Aptima Assays (Hologic) and the Allplex STI Essential Assay (Seegene) for the diagnosis of Sexually transmitted infections
- Knowledge gaps of STIs in Africa; Systematic review
- Correction: Bovine herpesvirus 1 can cross the intact zona pellucida of bovine oocytes after artificial infection
- Distribution of corneal spherical aberration in a Tanzanian population
- Correction: Determinants of physical activity: A path model based on an ecological model of active living
- Wild pollinator activity negatively related to honey bee colony densities in urban context
- Subclinical alterations in left ventricular structure and function according to obesity and metabolic health status
- The epidemiological signature of influenza B virus and its B/Victoria and B/Yamagata lineages in the 21st century
- Identification of bovine CpG SNPs as potential targets for epigenetic regulation via DNA methylation
- Nitric oxide regulates the expression of heme carrier protein-1 via hypoxia inducible factor-1α stabilization
- Development of highly efficient protocols for extraction and amplification of cytomegalovirus DNA from dried blood spots for detection and genotyping of polymorphic immunomodulatory genes
- Construction of pseudomolecule sequences of Brassica rapa ssp. pekinensis inbred line CT001 and analysis of spontaneous mutations derived via sexual propagation
- Effects of flavoring compounds used in electronic cigarette refill liquids on endothelial and vascular function
- Rural pipeline and willingness to work in rural areas: Mixed method study on students in midwifery and obstetric nursing in Mali
- Role of phospholipase A2 receptor 1 antibody level at diagnosis for long-term renal outcome in membranous nephropathy
- Prevalence of anemia in diabetic adult outpatients in Northeast Ethiopia
- Characterization of melanin and optimal conditions for pigment production by an endophytic fungus, Spissiomyces endophytica SDBR-CMU319
- Genetic variability and consequence of Mycobacterium tuberculosis lineage 3 in Kampala-Uganda
- Comparison of in vitro and computational experiments on the relation of inter-beat interval and duration of repolarization in a specific type of human induced pluripotent stem cell-derived cardiomyocytes
- Current and potential contributions of community pharmacy teams to self-harm and suicide prevention: A qualitative interview study
- Prediction of risk scores for colorectal cancer patients from the concentration of proteins involved in mitochondrial apoptotic pathway
- With or without U(K): A pre-Brexit network analysis of the EU ETS
- Graph-theoretical analysis for energy landscape reveals the organization of state transitions in the resting-state human cerebral cortex
- Task-uninformative visual stimuli improve auditory spatial discrimination in humans but not the ideal observer
- Residual stenosis after carotid artery stenting: Effect on periprocedural and long-term outcomes
- gapFinisher: A reliable gap filling pipeline for SSPACE-LongRead scaffolder output
- A plant biostimulant made from the marine brown algae Ascophyllum nodosum and chitosan reduce Fusarium head blight and mycotoxin contamination in wheat
- Monte-Carlo value analysis of High-Throughput Satellites: Value levers, tradeoffs, and implications for operators and investors
- Educational and health outcomes associated with bronchopulmonary dysplasia in 15-year-olds born preterm
- Loss of prostatic acid phosphatase and α-synuclein cause motor circuit degeneration without altering cerebellar patterning
- Neuropathy and neural plasticity in the subcutaneous white adipose depot
- Roles of differential expression of miR-543-5p in GH regulation in rat anterior pituitary cells and GH3 cells
- The enemy’s gaze: Immersive virtual environments enhance peace promoting attitudes and emotions in violent intergroup conflicts
- Protective effect of lactobacillus plantarum on alcoholic liver injury and regulating of keap-Nrf2-ARE signaling pathway in zebrafish larvae
- Koopman Mode Analysis of agent-based models of logistics processes
- Empirical mode decomposition based long short-term memory neural network forecasting model for the short-term metro passenger flow
- Male sexual dysfunction in obesity: The role of sex hormones and small fibre neuropathy
- Multi-agent reinforcement learning with approximate model learning for competitive games
- Identification of olfactory genes and functional analysis of BminCSP and BminOBP21 in Bactrocera minax
- The use of urinary fluoride excretion to facilitate monitoring fluoride intake: A systematic scoping review
- Development of a family caregiver needs-assessment scale for end-of-life care for senility at home (FADE)
- Epidemiology of pneumonia in the pre-pneumococcal conjugate vaccine era in children 2-59 months of age, in Ulaanbaatar, Mongolia, 2015-2016
- H-EM: An algorithm for simultaneous cell diameter and intensity quantification in low-resolution imaging cytometry
- Public expenditure on Non-Communicable Diseases & Injuries in India: A budget-based analysis
- Doxorubicin induces trans-differentiation and MMP1 expression in cardiac fibroblasts via cell death-independent pathways
- uORF-Tools—Workflow for the determination of translation-regulatory upstream open reading frames
- Comparative analysis of postural control and vertical jump performance between three different measurement devices
- Hierarchical multi-view aggregation network for sensor-based human activity recognition
- Clavien–Dindo classification for grading complications after total pharyngolaryngectomy and free jejunum transfer
- Significantly different expression levels of microRNAs associated with vascular invasion in hepatocellular carcinoma and their prognostic significance after surgical resection
- Clinical correlates of workplace injury occurrence and recurrence in adults
- Medicine and the media: Medical experts’ problems and solutions while working with journalists
- Phylogenic classification and virulence genes profiles of uropathogenic E. coli and diarrhegenic E. coli strains isolated from community acquired infections
- Genetic relatedness in carbapenem-resistant isolates from clinical specimens in Ghana using ERIC-PCR technique
- Forest resilience under global environmental change: Do we have the information we need? A systematic review
- Improving the production of podophyllotoxin in hairy roots of Hyptis suaveolens induced from regenerated plantlets
- Controls on planktonic foraminifera apparent calcification depths for the northern equatorial Indian Ocean
- Notch and Delta are required for survival of the germline stem cell lineage in testes of Drosophila melanogaster
- Children with HIV: A scoping review of auditory processing skills
- Correction: Two distinct actin waves correlated with turns-and-runs of crawling microglia
- Expression of Concern: Neurotoxicity Induced by Bupivacaine via T-Type Calcium Channels in SH-SY5Y Cells
- Sex-dependent and -independent transcriptional changes during haploid phase gametogenesis in the sugar kelp Saccharina latissima
- Vehicle modeling for the analysis of the response of detectors based on inductive loops
- New Mycobacteroides abscessus subsp. massiliense strains with recombinant hsp65 gene laterally transferred from Mycobacteroides abscessus subsp. abscessus: Potential for misidentification of M. abscessus strains with the hsp65-based method
- A prognostic Bayesian network that makes personalized predictions of poor prognostic outcome post resection of pancreatic ductal adenocarcinoma
- Impact of care provider network characteristics on patient outcomes: Usage of social network analysis and a multi-scale community detection
- Valid group comparisons can be made with the Patient Health Questionnaire (PHQ-9): A measurement invariance study across groups by demographic characteristics
- Comparison of risk models for mortality and cardiovascular events between machine learning and conventional logistic regression analysis
- Upgraded molecular models of the human KCNQ1 potassium channel
- Mental health and quality of life outcomes in family members of patients with chronic critical illness admitted to the intensive care units of two Brazilian hospitals serving the extremes of the socioeconomic spectrum
- Correction: Secretome profiling of PC3/nKR cells, a novel highly migrating prostate cancer subline derived from PC3 cells
- The extraordinary osteology and functional morphology of the limbs in Palorchestidae, a family of strange extinct marsupial giants
- Primary hyperhidrosis prevalence and characteristics among medical students in Rio de Janeiro
- Implementation of home blood pressure monitoring among French GPs: A long and winding road
- In vitro and molecular chemosensitivity in human cholangiocarcinoma tissues
- Saiga horn user characteristics, motivations, and purchasing behaviour in Singapore
- The health and cost burden of antibiotic resistant and susceptible Escherichia coli bacteraemia in the English hospital setting: A national retrospective cohort study
- Retraction: Comprehensive Comparison of Three Different Immunosuppressive Regimens for Liver Transplant Patients with Hepatocellular Carcinoma: Steroid-Free Immunosuppression, Induction Immunosuppression and Standard Immunosuppression
- Can acute suicidality be predicted by Instagram data? Results from qualitative and quantitative language analyses
- Computational and experimental analysis of the glycophosphatidylinositol-anchored proteome of the human parasitic nematode Brugia malayi
- Antibacterial activity of silver nanoparticles of different particle size against Vibrio Natriegens
- Genetic variations associated with response to dutasteride in the treatment of male subjects with androgenetic alopecia
- To eat or not to eat: Reward delay impulsivity in children with loss of control eating, attention deficit / hyperactivity disorder, a double diagnosis, and healthy children
- Factors associated with newborn care knowledge and practices in the upper Himalayas
- Correction: A more physiological approach to lipid metabolism alterations in cancer: CRC-like organoids assessment
- Correlates of concurrent partnerships and patterns of condom use among men who have sex with men and transgender women in Peru
- Ocular and systemic risk factors associated with recurrent disc hemorrhage in primary open-angle glaucoma
- Development of a denoising convolutional neural network-based algorithm for metal artifact reduction in digital tomosynthesis for arthroplasty: A phantom study
- Low-level sensory processes play a more crucial role than high-level cognitive ones in the size-weight illusion
- The prevalence of asthma and allergic rhinitis in Nigeria: A nationwide survey among children, adolescents and adults
- Retraction: Human Cystathionine-β-Synthase Phosphorylation on Serine227 Modulates Hydrogen Sulfide Production in Human Urothelium
- Which clinical and biochemical predictors should be used to screen for diabetes in patients with serious mental illness receiving antipsychotic medication? A large observational study
- Characteristics of diabetic macular edema patients refractory to anti-VEGF treatments and a dexamethasone implant
- Correction: Effects of dietary n-6: n-3 polyunsaturated fatty acid ratios on meat quality, carcass characteristics, tissue fatty acid profiles, and expression of lipogenic genes in growing goats
- Speckle tracking derived reference values of myocardial deformation and impact of cardiovascular risk factors – Results from the population-based STAAB cohort study
- Impact of pterygium on the ocular surface and meibomian glands
- Lack of association between hypothyroxinemia of prematurity and transient thyroid abnormalities with adverse long term neurodevelopmental outcome in very low birth weight infants
- Transcriptome divergence during leaf development in two contrasting switchgrass (Panicum virgatum L.) cultivars
- Study on Dalfampridine in the treatment of Multiple Sclerosis Mobility Disability: A meta-analysis
- Circulating progenitor cells and the expression of Cxcl12, Cxcr4 and angiopoietin-like 4 during wound healing in the murine ear
- EUSKOR: End-to-end coreference resolution system for Basque
- Inactivating pathogenic bacteria in greywater by biosynthesized Cu/Zn nanoparticles from secondary metabolite of Aspergillus iizukae; optimization, mechanism and techno economic analysis
- Exopolysaccharide producing rhizobacteria and their impact on growth and drought tolerance of wheat grown under rainfed conditions
- Structural equation modeling for hypertension and type 2 diabetes based on multiple SNPs and multiple phenotypes
- Correction: Association between ultraviolet radiation exposure dose and cataract in Han people living in China and Taiwan: A cross-sectional study
- Short-term exercise training improves cardiac function associated to a better antioxidant response and lower type 3 iodothyronine deiodinase activity after myocardial infarction
- Unexpected low genetic variation in the South American hystricognath rodent Lagostomus maximus (Rodentia: Chinchillidae)
- PRC2 activates interferon-stimulated genes indirectly by repressing miRNAs in glioblastoma
- Surgical resection is sufficient for incidentally discovered solitary pulmonary nodule caused by nontuberculous mycobacteria in asymptomatic patients
- “I do all I can but I still fail them”: Health system barriers to providing Option B+ to pregnant and lactating women in Malawi
- Impact of major illnesses and geographic regions on do-not-resuscitate rate and its potential cost savings in Taiwan
- Implementation of intermittent theta burst stimulation compared to conventional repetitive transcranial magnetic stimulation in patients with treatment resistant depression: A cost analysis
- Genome-wide analysis of DNA methylation profile identifies differentially methylated loci associated with human intervertebral disc degeneration
- Correction: Artificial neural networks reveal individual differences in metacognitive monitoring of memory
- Combining fish and environmental PCR for diagnostics of diseased laboratory zebrafish in recirculating systems
- Reading skill modulates the effect of parafoveal distractors on foveal lexical decision in deaf students
- Association between the posterior part of the circle of Willis and the vertebral artery hypoplasia
- Exposure to marital conflict: Gender differences in internalizing and externalizing problems among children
- Ethanol locks for the prevention of catheter-related infection in patients with central venous catheter: A systematic review and meta-analysis of randomized controlled trials
- The effect of age and perturbation time on online control during rapid pointing
- Oilseed rape (Brassica napus) resistance to growth of Leptosphaeria maculans in leaves of young plants contributes to quantitative resistance in stems of adult plants
- Lymphocyte proliferation induced by high-affinity peptides for HLA-B*51:01 in Behçet’s uveitis
- Sensitization of avian pathogenic Escherichia coli to amoxicillin in vitro and in vivo in the presence of surfactin
- Genomic characterization of the complete terpene synthase gene family from Cannabis sativa
- Inhibition of gap junctional intercellular communication by an anti-migraine agent, flunarizine
- Levels of serum eosinophil cationic protein are associated with hookworm infection and intensity in endemic communities in Ghana
- Plant growth promoting rhizobacterium Stenotrophomonas maltophilia BJ01 augments endurance against N2 starvation by modulating physiology and biochemical activities of Arachis hypogea
- Hierarchical integrated and segregated processing in the functional brain default mode network within attention-deficit/hyperactivity disorder
- Rising co-payments coincide with unwanted effects on continuity of healthcare for patients with schizophrenia in the Netherlands
- Analysis of Zobellella denitrificans ZD1 draft genome: Genes and gene clusters responsible for high polyhydroxybutyrate (PHB) production from glycerol under saline conditions and its CRISPR-Cas system
- False-negative errors in next-generation sequencing contribute substantially to inconsistency of mutation databases
- Identification of potassium phosphite responsive miRNAs and their targets in potato
- Quantification of bell-shaped size selectivity in shrimp trawl fisheries using square mesh panels and a sorting cone after a Nordmøre grid
- Deactivation of somatosensory and visual cortices during vestibular stimulation is associated with older age and poorer balance
- Combined immunization with attenuated live influenza vaccine and chimeric pneumococcal recombinant protein improves the outcome of virus-bacterial infection in mice
- Flooding performance evaluation of alkyl aryl sulfonate in various alkaline environments
- An artificial intelligent diagnostic system on mobile Android terminals for cholelithiasis by lightweight convolutional neural network
- Enhanced detection of prion infectivity from blood by preanalytical enrichment with peptoid-conjugated beads
- COI metabarcoding primer choice affects richness and recovery of indicator taxa in freshwater systems
- Retraction: APRIL Induces Tumorigenesis and Metastasis of Colorectal Cancer Cells via Activation of the PI3K/Akt Pathway
- The intake pattern and feed preference of layer hens selected for high or low feed conversion ratio
- Individualized pattern recognition for detecting mind wandering from EEG during live lectures
- Ontogenetic expression of thyroid hormone signaling genes: An in vitro and in vivo species comparison
- Post-activation potentiation effect of eccentric overload and traditional weightlifting exercise on jumping and sprinting performance in male athletes
- Effectiveness of different central venous catheter fixation suture techniques: An in vitro crossover study
- Quantitative detection of ALK fusion breakpoints in plasma cell-free DNA from patients with non-small cell lung cancer using PCR-based target sequencing with a tiling primer set and two-step mapping/alignment
- Nuclei deformation reveals pressure distributions in 3D cell clusters
- Strategies for increasing diagnostic yield of community-onset bacteraemia within the emergency department: A retrospective study
- Rapid evolution of Mexican H7N3 highly pathogenic avian influenza viruses in poultry
- Certified service dogs – A cost-effectiveness analysis appraisal
- Endothelial dysfunction and low-grade inflammation in the transition to renal replacement therapy
- Assessing the impact of a research funder’s recommendation to consider core outcome sets
- Validity of six consumer-level activity monitors for measuring steps in patients with chronic heart failure
- Detection of deceptive motions in rugby from visual motion cues
- The impact of antenatal care on neonatal mortality in sub-Saharan Africa: A systematic review and meta-analysis
- Epidemiological investigation and management of bloody diarrhea among children in India
- Irisin promotes C2C12 myoblast proliferation via ERK-dependent CCL7 upregulation
- Bacteria isolated from Bengal cat (Felis catus × Prionailurus bengalensis) anal sac secretions produce volatile compounds potentially associated with animal signaling
- Petri net–based model of the human DNA base excision repair pathway
- Complexation and conformation of lead ion with poly-γ-glutamic acid in soluble state
- The effects of sympathetic activity induced by ice water on blood flow and brachial artery flow-mediated dilatation response in healthy volunteers
- The Youth-Physical Activity Towards Health (Y-PATH) intervention: Results of a 24 month cluster randomised controlled trial
- The COPD multi-dimensional phenotype: A new classification from the STORICO Italian observational study
- Morphological identification of Amphitetranychus species (Acari: Tetranychidae) with crossbreeding, esterase zymograms and DNA barcode data
- Maintaining hope after a disabling stroke: A longitudinal qualitative study of patients’ experiences, views, information needs and approaches towards making treatment decisions
- Cultural differences in the use of acoustic cues for musical emotion experience
- Effects of a rifampicin pre-treatment on linezolid pharmacokinetics
- High prevalence of multidrug resistant Enterobacteriaceae among residents of long term care facilities in Amsterdam, the Netherlands
- Infection/inflammation-associated preterm delivery within 14 days of presentation with symptoms of preterm labour: A multivariate predictive model
- Prognostic value of preoperative hydronephrosis in patients with bladder cancer undergoing radical cystectomy: A meta-analysis
- Correction: Early life predictors of midlife allostatic load: A prospective cohort study
- PCR-free whole exome sequencing: Cost-effective and efficient in detecting rare mutations
- Epstein-Barr virus genome packaging factors accumulate in BMRF1-cores within viral replication compartments
- Symbiotic incompatibility between soybean and Bradyrhizobium arises from one amino acid determinant in soybean Rj2 protein
- Does anticoagulation needed for distally located incidental pulmonary thromboembolism in patients with active cancer?
- Control of human testis-specific gene expression
- Speaking up culture of medical students within an academic teaching hospital: Need of faculty working in patient safety
- Appraisal on the wound healing potential of Melaleuca alternifolia and Rosmarinus officinalis L. essential oil-loaded chitosan topical preparations
- Understanding parental perspectives on outcomes following paediatric encephalitis: A qualitative study
- Results of scoping review do not support mild traumatic brain injury being associated with a high incidence of chronic cognitive impairment: Commentary on McInnes et al. 2017
- Native seed, soil and atmosphere respond to boreal forest topsoil (LFH) storage
- Development of a quantitative polymerase chain reaction assay and environmental DNA sampling methods for Giant Gartersnake (Thamnophis gigas)
- Genetic diversity and population structure of four Chinese rabbit breeds
- Knowledge, attitude and behaviors towards patients with mental illness: Results from a national Lebanese study
- Correction: An impact evaluation of two rounds of mass drug administration on the prevalence of active trachoma: A clustered cross sectional survey
- Comparative prognostic accuracy of sepsis scores for hospital mortality in adults with suspected infection in non-ICU and ICU at an academic public hospital
- Graph convolutional network approach applied to predict hourly bike-sharing demands considering spatial, temporal, and global effects
- Impact of traffic variability on geographic accessibility to 24/7 emergency healthcare for the urban poor: A GIS study in Dhaka, Bangladesh
- Feeling the heat: Elevated temperature affects male display activity of a lekking grassland bird
- Constructing a comprehensive disaster resilience index: The case of Italy
- Intraocular pressure according to different types of tonometry (non-contact and Goldmann applanation) in patients with different degrees of bilateral tearing
- Prevalent vertebral fracture is dominantly associated with spinal microstructural deterioration rather than bone mineral density in patients with type 2 diabetes mellitus
- Silent volumetric multi-contrast 7 Tesla MRI of ocular tumors using Zero Echo Time imaging
- Nonverbal synchrony in virtual reality
- Do speed cameras reduce road traffic collisions?
- A zero-shot learning approach to the development of brain-computer interfaces for image retrieval
- Use of non-HIV medication among people living with HIV and receiving antiretroviral treatment in Côte d’Ivoire, West Africa: A cross-sectional study
- DNA barcoding of southern African crustaceans reveals a mix of invasive species and potential cryptic diversity
- Development of an international external quality assurance program for HIV-1 incidence using the Limiting Antigen Avidity assay
- Correction: The mean cell volume difference (dMCV) reflects serum hypertonicity in diabetic dogs
- Structural characteristics of lipocalin allergens: Crystal structure of the immunogenic dog allergen Can f 6
- Transport oil product consumption and GHG emission reduction potential in China: An electric vehicle-based scenario analysis
- Ontogenetic shift in the energy allocation strategy and physiological condition of larval plaice (Pleuronectes platessa)
- Increased proliferation and altered cell cycle regulation in pancreatic stem cells derived from patients with congenital hyperinsulinism
- Diagnostic accuracy of Xpert MTB/RIF assay and non-molecular methods for the diagnosis of tuberculosis lymphadenitis
- Assessment of glucose-6-phosphate dehydrogenase activity using CareStart G6PD rapid diagnostic test and associated genetic variants in Plasmodium vivax malaria endemic setting in Mauritania
- Spatial distribution of breast cancer in Sudan 2010-2016
- Human-induced fire regime shifts during 19th century industrialization: A robust fire regime reconstruction using northern Polish lake sediments
- Enhanced effectiveness of oil dispersants in destabilizing water-in-oil emulsions
- Development of UV spectrophotometry methods for concurrent quantification of amlodipine and celecoxib by manipulation of ratio spectra in pure and pharmaceutical formulation
- Iron and manganese co-limit growth of the Southern Ocean diatom Chaetoceros debilis
- Bilateral and unilateral load-velocity profiling in a machine-based, single-joint, lower body exercise
- Veterans Health Administration nurses’ training and beliefs related to care of patients with traumatic brain injury
- Supplementation strategies affect the feed intake and performance of grazing replacement heifers
- Active transcutaneous bone conduction hearing implants: Systematic review and meta-analysis
- Parameterization-induced uncertainties and impacts of crop management harmonization in a global gridded crop model ensemble
- Acidification effects on isolation of extracellular vesicles from bovine milk
- GPR40 full agonism exerts feeding suppression and weight loss through afferent vagal nerve
- Mining version history to predict the class instability
- Humpback whale song occurrence reflects ecosystem variability in feeding and migratory habitat of the northeast Pacific
- A phase 2 study of an oral mTORC1/mTORC2 kinase inhibitor (CC-223) for non-pancreatic neuroendocrine tumors with or without carcinoid symptoms
- Asprosin response in hypoglycemia is not related to hypoglycemia unawareness but rather to insulin resistance in type 1 diabetes
- Muscle oxygenation maintained during repeated-sprints despite inspiratory muscle loading
- Reconstructing systematic persistent impacts of promotional marketing with empirical nonlinear dynamics
- Trans-national conservation and infrastructure development in the Heart of Borneo
- Prediction of cardiovascular disease risk among people with severe mental illness: A cohort study
- Data in question: A survey of European biobank professionals on ethical, legal and societal challenges of biobank research
- Hypertensive APOL1 risk allele carriers demonstrate greater blood pressure reduction with angiotensin receptor blockade compared to low risk carriers
- Reconstructing birth in Australopithecus sediba
- Value of contrast-enhanced ultrasound for preoperative assessment of liver reserve function in patients with liver tumors
- Correction: Identifying obesity/overweight status in children and adolescents; A cross-sectional medical record review of physicians’ weight screening practice in outpatient clinics, Saudi Arabia
- Incidence and risk factors of loss to follow-up among HIV-infected children in an antiretroviral treatment program
- Changes in intracellular folate metabolism during high-dose methotrexate and Leucovorin rescue therapy in children with acute lymphoblastic leukemia
- Functional role and evolutionary contributions of floral gland morphoanatomy in the Paleotropical genus Acridocarpus (Malpighiaceae)
- On the efficiency of HIV transmission: Insights through discrete time HIV models
- Metabolic cost calculations of gait using musculoskeletal energy models, a comparison study
- Comparison of molecular profile in triple-negative inflammatory and non-inflammatory breast cancer not of mesenchymal stem-like subtype
- Evolutionary analysis of six chloroplast genomes from three Persea americana ecological races: Insights into sequence divergences and phylogenetic relationships
- Cultural transmission in a food preparation task: The role of interactivity, innovation and storytelling
- Correction: Effects of affective priming through music on the use of emotion words
- Safety and immunogenicity of investigational seasonal influenza hemagglutinin DNA vaccine followed by trivalent inactivated vaccine administered intradermally or intramuscularly in healthy adults: An open-label randomized phase 1 clinical trial
- Estimation of vaccination coverage from electronic healthcare records; methods performance evaluation – A contribution of the ADVANCE-project
- Dietary phytogenics and galactomannan oligosaccharides in low fish meal and fish oil-based diets for European sea bass (Dicentrarchus labrax) juveniles: Effects on gut health and implications on in vivo gut bacterial translocation
- Suicide by hanging: Results from a national survey in Switzerland and its implications for suicide prevention
- Gene dysregulation in peripheral blood of moyamoya disease and comparison with other vascular disorders
- Genome wide genetic dissection of wheat quality and yield related traits and their relationship with grain shape and size traits in an elite × non-adapted bread wheat cross
- Safety and tolerability of artesunate-amodiaquine, artemether-lumefantrine and quinine plus clindamycin in the treatment of uncomplicated Plasmodium falciparum malaria in Kinshasa, the Democratic Republic of the Congo
- Factors influencing the admission decision for Medical Psychiatry Units: A concept mapping approach
- Comparison of post-traumatic changes in circulating and bone marrow leukocytes between BALB/c and CD-1 mouse strains
- Physiological stress reactivity and recovery related to behavioral traits in dogs (Canis familiaris)
- Associations between birth order with mental wellbeing and psychological distress in midlife: Findings from the 1970 British Cohort Study (BCS70)
- Non-steroidal anti-inflammatory drugs use in older adults decreases risk of Alzheimer’s disease mortality
- The cost-effectiveness of neonatal versus prenatal screening for congenital toxoplasmosis
- Ancient technology and punctuated change: Detecting the emergence of the Edomite Kingdom in the Southern Levant
- Flowers as viral hot spots: Honey bees (Apis mellifera) unevenly deposit viruses across plant species
- Randomized control trial of Tools of the Mind: Marked benefits to kindergarten children and their teachers
- Preserving cultural heritage: Analyzing the antifungal potential of ionic liquids tested in paper restoration
- PNPLA3 rs738409 G allele carriers with genotype 1b HCV cirrhosis have lower viral load but develop liver failure at younger age
- Correction: Unraveling the genetic complexity underlying sorghum response to water availability
- Impact of tear metrics on the reliability of perimetry in patients with dry eye
- Using DNA barcoding to improve invasive pest identification at U.S. ports-of-entry
- Correction: Effects of Lactobacillus plantarum 15-1 and fructooligosaccharides on the response of broilers to pathogenic Escherichia coli O78 challenge
- Physico-chemical characterization and transcriptome analysis of 5-methyltryptophan resistant lines in rice
- Patient factors affecting successful linkage to treatment in a cervical cancer prevention program in Kenya: A prospective cohort study
- Is this a man’s world? The effect of gender diversity and gender equality on firm innovativeness
- Procalcitonin to stop antibiotics after cardiovascular surgery in a pediatric intensive care unit—The PROSACAB study
- Temporal trends, predictors, and outcomes of acute kidney injury and hemodialysis use in acute myocardial infarction-related cardiogenic shock
- Quantitation of free glycation compounds in saliva
- Resolving an 87-year-old taxonomical curiosity with the description of Psylla frodobagginsi sp. nov. (Hemiptera: Sternorrhyncha: Psyllidae), a second distinct Psylla species on the New Zealand endemic plant kōwhai
- The effect of cathodal tDCS on fear extinction: A cross-measures study
- Physiological responses to affiliation during conversation: Comparing neurotypical males and males with Asperger syndrome
- Human cord blood (hCB)-CD34+ humanized mice fail to reject human acute myeloid leukemia cells
- Investigating the dispersal of antibiotic resistance associated genes from manure application to soil and drainage waters in simulated agricultural farmland systems
- Continuous norming of psychometric tests: A simulation study of parametric and semi-parametric approaches
- Phylogenetic microbiota profiling in fecal samples depends on combination of sequencing depth and choice of NGS analysis method
- Cost-effectiveness of apixaban compared to other anticoagulants in patients with atrial fibrillation in the real-world and trial settings
- Biochemical profile and in vitro biological activities of extracts from seven folk medicinal plants growing wild in southern Tunisia
- Low genetic differentiation yet high phenotypic variation in the invasive populations of Spartina alterniflora in Guangxi, China
- A mathematical model for designing networks of C-Reactive Protein point of care testing
- Prevalence of hypochondriac symptoms among health science students in China: A systematic review and meta-analysis
- Femtosecond laser induced step-like structures inside transparent hydrogel due to laser induced threshold reduction
- From In Situ to satellite observations of pelagic Sargassum distribution and aggregation in the Tropical North Atlantic Ocean
- The polyether ionophore salinomycin targets multiple cellular pathways to block proliferative vitreoretinopathy pathology
- BRAF V600E and Pten deletion in mice produces a histiocytic disorder with features of Langerhans cell histiocytosis
- HIV prevalence and risk behavior among male and female adults screened for enrolment into a vaccine preparedness study in Maputo, Mozambique
- Sputum microbiota and inflammation at stable state and during exacerbations in a cohort of chronic obstructive pulmonary disease (COPD) patients
- Direct estimation of the parameters of a delayed, intermittent activation feedback model of postural sway during quiet standing
- Occurrence mechanism and coping paths of accidents of highly aggregated tourist crowds based on system dynamics
- Correction: Low Dose Aerosol Fitness at the Innate Phase of Murine Infection Better Predicts Virulence amongst Clinical Strains of Mycobacterium tuberculosis
- Effects of enalapril and paricalcitol treatment on diabetic nephropathy and renal expressions of TNF-α, p53, caspase-3 and Bcl-2 in STZ-induced diabetic rats
- Correction: Public reaction to Chikungunya outbreaks in Italy—Insights from an extensive novel data streams-based structural equation modeling analysis
- Correction: Comparison of neurodegenerative types using different brain MRI analysis metrics in older adults with normal cognition, mild cognitive impairment, and Alzheimer’s dementia
- Intra-individual variability of sleep and nocturnal cardiac autonomic activity in elite female soccer players during an international tournament
- Therapeutic efficacy of equine botulism heptavalent antitoxin against all seven botulinum neurotoxins in symptomatic guinea pigs
- Interleukin 10 knock-down in bovine monocyte-derived macrophages has distinct effects during infection with two divergent strains of Mycobacterium bovis
- Clinical outcomes of bortezomib-based therapy in Taiwanese patients with multiple myeloma: A nationwide population-based study and a single-institute analysis
- Scope and efficacy of the broad-spectrum topical antiseptic choline geranate
- Hematological and biochemical parameters for Chinese rhesus macaque
- Veterinary peer study groups as a method of continuous education—A new approach to identify and address factors associated with antimicrobial prescribing
- Correction: The prognosis of heart failure patients: Does sodium level play a significant role?
- Maternal malaria but not schistosomiasis is associated with a higher risk of febrile infection in infant during the first 3 months of life: A mother-child cohort in Benin
- Systematic identification of facility-based stillbirths and neonatal deaths through the piloted use of an adapted RAPID tool in Liberia and Nepal
- Effects of salbutamol and phlorizin on acute pulmonary inflammation and disease severity in experimental sepsis
- Correction: Age, sex and storage time influence hair cortisol levels in a wild mammal population
- Reasons to care: Personal motivation as a key factor in the practice of the professional foster carer in Romania
- Determinants of clinical, functional and personal recovery for people with schizophrenia and other severe mental illnesses: A cross-sectional analysis
- Continuity of care for TB patients at a South African hospital: A qualitative participatory study of the experiences of hospital staff
- EGF receptor stimulation shifts breast cancer cell glucose metabolism toward glycolytic flux through PI3 kinase signaling
- The Better Management of Patients with Osteoarthritis Program: Outcomes after evidence-based education and exercise delivered nationwide in Sweden
- The negative effects of short-term extreme thermal events on the seagrass Posidonia oceanica are exacerbated by ammonium additions
- Pathogen invasion history elucidates contemporary host pathogen dynamics
- Chinese herbal formulae for the treatment of menopausal hot flushes: A systematic review and meta-analysis
- Healthcare resource utilization and costs for multiple sclerosis management in the Campania region of Italy: Comparison between centre-based and local service healthcare delivery
- Deconstruction of central line insertion guidelines based on the positive deviance approach—Reducing gaps between guidelines and implementation: A qualitative ethnographic research
- PBMCs transcriptome profiles identified breed-specific transcriptome signatures for PRRSV vaccination in German Landrace and Pietrain pigs
- The impact of admission serum lactate on children with moderate to severe traumatic brain injury
- Hypervirulent Klebsiella pneumoniae serotype K1 clinical isolates form robust biofilms at the air-liquid interface
- Determination of the bruise degree for cherry using Vis-NIR reflection spectroscopy coupled with multivariate analysis
- Genome-wide identification and expression profile analysis of nuclear factor Y family genes in Sorghum bicolor L. (Moench)
- Trends in maternal prepregnancy body mass index (BMI) and its association with birth and maternal outcomes in California, 2007–2016: A retrospective cohort study
- Distribution of the Duffy genotypes in Malaysian Borneo and its relation to Plasmodium knowlesi malaria susceptibility
- Hippocampal connectivity with sensorimotor cortex during volitional finger movements: Laterality and relationship to motor learning
- A self-adaptive deep learning method for automated eye laterality detection based on color fundus photography
- The effect of child marriage on the utilization of maternal health care in Nepal: A cross-sectional analysis of Demographic and Health Survey 2016
- Identification of QTLs for powdery mildew (Podosphaera aphanis; syn. Sphaerotheca macularis f. sp. fragariae) susceptibility in cultivated strawberry (Fragaria ×ananassa)
- Chemical volatiles present in cotton gin trash: A by-product of cotton processing
- PTP1B negatively regulates nitric oxide-mediated Pseudomonas aeruginosa killing by neutrophils
- Differential metabolomics networks analysis of menopausal status
- Experimental study of the temporal profile of breath alcohol concentration in a Chinese population after a light meal
- Association between regional brain volumes and BMI z-score change over one year in children
- Relationships between Potentially Toxic Elements in intertidal sediments and their bioaccumulation by benthic invertebrates
- Long-term outcomes of dialysis in patients with chronic kidney disease and new-onset atrial fibrillation: A population-based cohort study
- Hospital burden of pulmonary arterial hypertension in France
- Understanding the variability of Australian fire weather between 1973 and 2017
- Photon-counting cine-cardiac CT in the mouse
- Ecophysiological impacts of Esca, a devastating grapevine trunk disease, on Vitis vinifera L.
- Black “Reading the Mind in the Eyes” task: The development of a task assessing mentalizing from black faces
- Osmolytes ameliorate the effects of stress in the absence of the heat shock protein Hsp104 in Saccharomyces cerevisiae
- Reliable and robust method for abdominal muscle mass quantification using CT/MRI: An explorative study in healthy subjects
- Validation of the Rainbow Model of Integrated Care Measurement Tools (RMIC-MTs) in renal care for patient and care providers
- Multiple origins and the population genetic structure of Rubus takesimensis (Rosaceae) on Ulleung Island: Implications for the genetic consequences of anagenetic speciation
- Genetic profiling of fatty acid desaturase polymorphisms identifies patients who may benefit from high-dose omega-3 fatty acids in cardiac remodeling after acute myocardial infarction—Post-hoc analysis from the OMEGA-REMODEL randomized controlled trial
- A randomized controlled trial examining the efficacy of an internet-based cognitive behavioral therapy program for adolescents with anxiety disorders
- Optimising outputs from a validated online instrument to measure health-related quality of life (HRQL) in dogs
- Young adults’ perceptions of using wearables, social media and other technologies to detect worsening mental health: A qualitative study
- Characteristics of prescription in 29 Level 3 Neonatal Wards over a 2-year period (2017-2018). An inventory for future research
- Genetic characterization of fall armyworm (Spodoptera frugiperda) in Ecuador and comparisons with regional populations identify likely migratory relationships
- Correction: Lkb1 Deficiency Alters Goblet and Paneth Cell Differentiation in the Small Intestine
- Cardiac resynchronization therapy-heart failure (CRT-HF) clinic: A novel model of care
- Synteny and phylogenetic analysis of paralogous thyrostimulin beta subunits (GpB5) in vertebrates
- Dual-Subpopulation as reciprocal optional external archives for differential evolution
- NGS analysis in Marfan syndrome spectrum: Combination of rare and common genetic variants to improve genotype-phenotype correlation analysis
- Optimization of cataract surgery follow-up: A standard set of questions can predict unexpected management changes at postoperative week one
- Silymarin in non-cirrhotics with non-alcoholic steatohepatitis: A randomized, double-blind, placebo controlled trial
- Clinical evaluation of General Electric new Swiftscan solution in bone scintigraphy on NaI-camera: A head to head comparison with Siemens Symbia
- Pharmacist-led academic detailing improves statin therapy prescribing for Malaysian patients with type 2 diabetes: Quasi-experimental design
- Proton pump inhibitors attenuate myofibroblast formation associated with thyroid eye disease through the aryl hydrocarbon receptor
- Clinical outcomes with neoadjuvant versus adjuvant chemotherapy for triple negative breast cancer: A report from the National Cancer Database
- Identification and characterization of a novel heparan sulfate-binding domain in Activin A longest variants and implications for function
- Wikipedia network analysis of cancer interactions and world influence
- Using path signatures to predict a diagnosis of Alzheimer’s disease
- Development and verification of prediction models for preventing cardiovascular diseases
- Additive and heterozygous (dis)advantage GWAS models reveal candidate genes involved in the genotypic variation of maize hybrids to Azospirillum brasilense
- Fish tank granuloma: An emerging skin disease in Iran mimicking Cutaneous Leishmaniasis
- Transience effect in capture-recapture studies: The importance of its biological meaning
- Detailed global modelling of soil organic carbon in cropland, grassland and forest soils
- Oral dosing for antenatal corticosteroids in the Rhesus macaque
- Retraction: Modulation of the Pentose Phosphate Pathway Induces Endodermal Differentiation in Embryonic Stem Cells
- An analysis on HBsAg, Anti-HCV, Anti-HIV½ and VDRL test results in blood donors according to gender, age range and years
- Clinical factors associated with bacterial translocation in Japanese patients with type 2 diabetes: A retrospective study
- Meaningful work and resilience among teachers: The mediating role of work engagement and job crafting
- The conditional Fama-French model and endogenous illiquidity: A robust instrumental variables test
- Breast cancers utilize hypoxic glycogen stores via PYGB, the brain isoform of glycogen phosphorylase, to promote metastatic phenotypes
- Characterization of sequentially-staged cancer cells using electrorotation
- Vancomycin-laden calcium phosphate-calcium sulfate composite allows bone formation in a rat infection model
- Genetic evidence for plural introduction pathways of the invasive weed Paterson’s curse (Echium plantagineum L.) to southern Australia
- Risk of major autoimmune diseases in female breast cancer patients: A nationwide, population-based cohort study
- Real-time three-dimensional MRI for the assessment of dynamic carpal instability
- Interim report on the effective intraperitoneal therapy of insulin-dependent diabetes mellitus in pet dogs using “Neo-Islets,” aggregates of adipose stem and pancreatic islet cells (INAD 012-776)
- The frequency of bowel and bladder problems in multiple sclerosis and its relation to fatigue: A single centre experience
- Retraction: Analysis of Mycobacterium tuberculosis-Specific CD8 T-Cells in Patients with Active Tuberculosis and in Individuals with Latent Infection
- The association between role model presence and self-regulation in early adolescence: A cross-sectional study
- Correction: A controlled-release oral opioid supports S. aureus survival in injection drug preparation equipment and may increase bacteremia and endocarditis risk
- Methamphetamine regulation of activity and topology of ventral midbrain networks
- Evaluation and treatment of latent tuberculosis infection among healthcare workers in Korea: A multicentre cohort analysis
- Occult periprosthetic femoral fractures occur frequently during a long, trapezoidal, double-tapered cementless femoral stem fixation in primary THA
- TCF4 induces enzalutamide resistance via neuroendocrine differentiation in prostate cancer
- Structural characterization of EGFR exon 19 deletion mutation using molecular dynamics simulation
- Comparing infiltration rates in soils managed with conventional and alternative farming methods: A meta-analysis
- Correction: Permissivity of Primary Human Hepatocytes and Different Hepatoma Cell Lines to Cell Culture Adapted Hepatitis C Virus
- Radiomics features of the primary tumor fail to improve prediction of overall survival in large cohorts of CT- and PET-imaged head and neck cancer patients
- The complete mitochondrial genome of Calyptogena marissinica (Heterodonta: Veneroida: Vesicomyidae): Insight into the deep-sea adaptive evolution of vesicomyids
- Correction: In vitro larval rearing protocol for the stingless bee species Melipona scutellaris for toxicological studies
- Correction: Morphological and molecular identification of the dioecious “African species Volvox rousseletii (Chlorophyceae) in the water column of a Japanese lake based on field-collected and cultured materials
- Upper versus lower airway microbiome and metagenome in children with cystic fibrosis and their correlation with lung inflammation
- “…or else I close my ears” How women with obesity want to be approached and treated regarding gestational weight management: A qualitative interview study
- Does a spinal implant alter dual energy X-ray absorptiometry body composition measurements?
- Economic and livestock health impacts of birds on dairies: Evidence from a survey of Washington dairy operators
- Repair of subtotal tympanic membrane perforations: A temporal bone study of several tympanoplasty materials
- Shifts in temperature influence how Batrachochytrium dendrobatidis infects amphibian larvae
- Sequential two-step chromatographic purification of infectious poliovirus using ceramic fluoroapatite and ceramic hydroxyapatite columns
- Frequency and distribution of corneal astigmatism and keratometry features in adult life: Methodology and findings of the UK Biobank study
- Differences in the impedance of cochlear implant devices within 24 hours of their implantation
- Suppressive impact of metronomic chemotherapy using UFT and/or cyclophosphamide on mediators of breast cancer dissemination and invasion
- Expression of Concern: miRNA 17 Family Regulates Cisplatin-Resistant and Metastasis by Targeting TGFbetaR2 in NSCLC
- Group leaders establish cooperative norms that persist in subsequent interactions
- Addis Ababa population-based pattern of cancer therapy, Ethiopia
- Agreement between the Cochrane risk of bias tool and Physiotherapy Evidence Database (PEDro) scale: A meta-epidemiological study of randomized controlled trials of physical therapy interventions
- Oxidoreductase disulfide bond proteins DsbA and DsbB form an active redox pair in Chlamydia trachomatis, a bacterium with disulfide dependent infection and development
- DNA barcoding of coastal ray-finned fishes in Vietnam
- Comparison of climbing-specific strength and endurance between lead and boulder climbers
- The performance of different case definitions for severe influenza surveillance among HIV-infected and HIV-uninfected children aged <5 years in South Africa, 2011–2015
- Analgesic drug use in elderly persons: A population-based study in Southern Italy
- RCER: Reliable Cluster-based Energy-aware Routing protocol for heterogeneous Wireless Sensor Networks
- Beta-defensins and analogs in Helicobacter pylori infections: mRNA expression levels, DNA methylation, and antibacterial activity
- Changing educational gradient in long-term care-free life expectancy among German men, 1997-2012
- A non-parametric significance test to compare corpora
- Evaluating the impact of policies recommending PrEP to subpopulations of men and transgender women who have sex with men based on demographic and behavioral risk factors
- Different levels of statistical learning - Hidden potentials of sequence learning tasks
- Dry period heat stress induces microstructural changes in the lactating mammary gland
- Organic resolution function and effects of platinum nanoparticles on bacteria and organic matter
- High levels of fasting glucose and glycosylated hemoglobin values are associated with hyperfiltration in a Spanish prediabetes cohort. The PREDAPS Study
- Genetically distinct Group B Streptococcus strains induce varying macrophage cytokine responses
- Dynamic up- and down-regulation of the default (DMN) and extrinsic (EMN) mode networks during alternating task-on and task-off periods
- ERK1/ATF-2 signaling axis contributes to interleukin-1β-induced MMP-3 expression in dermal fibroblasts
- Cytokine profiles of umbilical cord blood mononuclear cells upon in vitro stimulation with lipopolysaccharides of different vaginal gram-negative bacteria
- Everolimus in de novo kidney transplant recipients participating in the Eurotransplant senior program: Results of a prospective randomized multicenter study (SENATOR)
- Lipopolysaccharide induces mouse translocator protein (18 kDa) expression via the AP-1 complex in the microglial cell line, BV-2
- Does effectiveness in performance appraisal improve with rater training?
- National trends in inpatient endometriosis admissions: Patients, procedures and outcomes, 2006−2015
- Affective and enjoyment responses to 12 weeks of high intensity interval training and moderate continuous training in adults with Crohn’s disease
- Thrombophilic risk factors in hemodialysis: Association with early vascular access occlusion and patient survival in long-term follow-up
- Cabbage stem flea beetle’s (Psylliodes chrysocephala L.) susceptibility to pyrethroids and tolerance to thiacloprid in the Czech Republic
- Implicit learning of artificial grammatical structures after inferior frontal cortex lesions
- Potential survival benefits from optimized chemotherapy implementation in advanced ovarian cancer: Projections from a microsimulation model
- Predictors of SLE relapse in pregnancy and post-partum among multi-ethnic patients in Malaysia
- Heat stress responses in a large set of winter wheat cultivars (Triticum aestivum L.) depend on the timing and duration of stress
- Mice deficient in NKLAM have attenuated inflammatory cytokine production in a Sendai virus pneumonia model
- Dysregulation of microRNAs and target genes networks in human abdominal aortic aneurysm tissues
- Quality of life and associated factors among patients with breast cancer under chemotherapy at Tikur Anbessa specialized hospital, Addis Ababa, Ethiopia
- Evaluation of suitable reference genes in Brassica juncea and its wild relative Camelina sativa for qRT-PCR analysis under various stress conditions
- Time-related immunomodulation by stressors and corticosterone transdermal application in toads
- Machine learning discovery of longitudinal patterns of depression and suicidal ideation
- Multi-scale patterns of tick occupancy and abundance across an agricultural landscape in southern Africa
- A matter of taste: Spatial and ontogenetic variations on the trophic ecology of the tiger shark at the Galapagos Marine Reserve
- Retraction: Adaptive double threshold energy detection based on Markov model for cognitive radio
- Adrenal gland size in obstructive sleep apnea: Morphological assessment of hypothalamic pituitary adrenal axis activity
- Out-of-pocket health spending among Medicare beneficiaries: Which chronic diseases are most costly?
- A large-scale chromosomal inversion is not associated with life history development in rainbow trout from Southeast Alaska
- Deployment, suicide, and overdose among comorbidity phenotypes following mild traumatic brain injury: A retrospective cohort study from the Chronic Effects of Neurotrauma Consortium
- Association between alcohol intake and measures of incident CKD: An analysis of nationwide health screening data
- Exploration of icariin analog structure space reveals key features driving potent inhibition of human phosphodiesterase-5
- A quantitative approach for the analysis of clinician recognition of acute respiratory distress syndrome using electronic health record data
- Morphological, microbiological and ultrastructural aspects of sepsis by Aeromonas hydrophila in Piaractus mesopotamicus
- Recidivism rates in individuals receiving community sentences: A systematic review
- The association of intensive care with utilization and costs of outpatient healthcare services and quality of life
- How well do cancer survivor self-classifications of anxiety, depression and stress agree with a standardised tool? Results of a cross-sectional study
- Comparative nutritional characteristics of the three major Chinese Dendrobium species with different growth years
- Nilotinib, an approved leukemia drug, inhibits smoothened signaling in Hedgehog-dependent medulloblastoma
- Geographic differentiation of agritourism activities in Poland vs. cultural and natural attractiveness of destinations at district level
- Social participation reduces isolation among Japanese older people in urban area: A 3-year longitudinal study
- Explaining age-related decline in theory of mind: Evidence for intact competence but compromised executive function
- Role of GDF15 in methylseleninic acid-mediated inhibition of cell proliferation and induction of apoptosis in prostate cancer cells
- Black people are convicted more for being black than for being poor: The role of social norms and cultural prejudice on biased racial judgments
- Bulked segregant analysis RNA-seq (BSR-Seq) validated a stem resistance locus in Aegilops umbellulata, a wild relative of wheat
- Neurobehavioral dysfunction in non-alcoholic steatohepatitis is associated with hyperammonemia, gut dysbiosis, and metabolic and functional brain regional deficits
- Barriers and enablers to the implementation of a complex quality improvement intervention for acute kidney injury: A qualitative evaluation of stakeholder perceptions of the Tackling AKI study
- Soil and vegetation conditions changes following the different sand dune restoration measures on the Zoige Plateau
- Experimental H1N1pdm09 infection in pigs mimics human seasonal influenza infections
- Emission characteristics of diethylhexyl phthalate (DEHP) from building materials determined using a passive flux sampler and micro-chamber
- Multi-focus microscope with HiLo algorithm for fast 3-D fluorescent imaging
- Pontoscolex corethrurus: A homeless invasive tropical earthworm?
- Modeling reciprocal effects in medical research: Critical discussion on the current practices and potential alternative models
- Does palliative chemotherapy really palliate and are we measuring it correctly? A mixed methods longitudinal study of health related quality of life in advanced soft tissue sarcoma
- Developing cookies formulated with goat cream enriched with conjugated linoleic acid
- The effects of combining focus of attention and autonomy support on shot accuracy in the penalty kick
- Association between hot flashes severity and oxidative stress among Mexican postmenopausal women: A cross-sectional study
- A combined strategy of neuropeptide prediction and tandem mass spectrometry identifies evolutionarily conserved ancient neuropeptides in the sea anemone Nematostella vectensis
- Lipidome profiles of postnatal day 2 vaginal swabs reflect fat composition of gilt’s postnatal diet
- Antitumor activity of a novel dual functional podophyllotoxin derivative involved PI3K/AKT/mTOR pathway
- Genome-wide developed microsatellites reveal a weak population differentiation in the hoverfly Eupeodes corollae (Diptera: Syrphidae) across China
- Prognosis of severe acquired brain injury: Short and long-term outcome determinants and their potential clinical relevance after rehabilitation. A comprehensive approach to analyze cohort studies
- An in silico investigation of menthol metabolism
- Variant analysis pipeline for accurate detection of genomic variants from transcriptome sequencing data
- Identification of candidate flowering and sex genes in white Guinea yam (D. rotundata Poir.) by SuperSAGE transcriptome profiling
- Optimizing the intrinsic parallel diffusivity in NODDI: An extensive empirical evaluation
- The quality of guidelines for diabetic foot ulcers: A critical appraisal using the AGREE II instrument
- Mastitis risk effect on the economic consequences of paratuberculosis control in dairy cattle: A stochastic modeling study
- Confounding by indication of the safety of de-escalation in community-acquired pneumonia: A simulation study embedded in a prospective cohort
- Effects from diet-induced gut microbiota dysbiosis and obesity can be ameliorated by fecal microbiota transplantation: A multiomics approach
- Drivers of HIV-1 transmission: The Portuguese case
- Integration of a FT expression cassette into CRISPR/Cas9 construct enables fast generation and easy identification of transgene-free mutants in Arabidopsis
- A biface production older than 600 ka ago at Notarchirico (Southern Italy) contribution to understanding early Acheulean cognition and skills in Europe
- Mass evacuation and increases in long-term care benefits: Lessons from the Fukushima nuclear disaster
- Circulating levels of free 25(OH)D increase at the onset of rheumatoid arthritis
- The expression of equine keratins K42 and K124 is restricted to the hoof epidermal lamellae of Equus caballus
- Soil respiration from fields under three crop rotation treatments and three straw retention treatments
- Inhibition of polymerase chain reaction: Pathogen-specific controls are better than human gene amplification
- Linkage disequilibrium and haplotype block patterns in popcorn populations
- Downscaling satellite soil moisture using geomorphometry and machine learning
- Choosing efficient actions: Deciding where to walk
- The zooarchaeology and isotopic ecology of the Bahamian hutia (Geocapromys ingrahami): Evidence for pre-Columbian anthropogenic management
- Synergy of the flow behaviour and disperse phase of cellulose nanoparticles in enhancing oil recovery at reservoir condition
- Accuracy of Determine TB-LAM Ag to detect TB in HIV infected patients associated with diagnostic methods used in Brazilian public health units
- Human papillomavirus infection among head and neck squamous cell carcinomas in southern China
- Comparison of feature point detectors for multimodal image registration in plant phenotyping
- Quartet-based inference of cell differentiation trees from ChIP-Seq histone modification data
- Detection and prognostic relevance of circulating tumour cells (CTCs) in Asian breast cancers using a label-free microfluidic platform
- Coralline algal calcification: A morphological and process-based understanding
- Comparing record linkage software programs and algorithms using real-world data
- Antimicrobial resistance and molecular genotyping of Salmonella enterica serovar Enteritidis clinical isolates from Guizhou province of Southwestern China
- Measuring sexual relationship power equity among young women and young men South Africa: Implications for gender-transformative programming
- Effectiveness, safety/tolerability of OBV/PTV/r ± DSV in patients with HCV genotype 1 or 4 with/without HIV-1 co-infection, chronic kidney disease (CKD) stage IIIb-V and dialysis in Spanish clinical practice – Vie-KinD study
- The genome of Alcaligenes aquatilis strain BU33N: Insights into hydrocarbon degradation capacity
- A randomized pilot efficacy and safety trial of diazoxide choline controlled-release in patients with Prader-Willi syndrome
- LMX1A inhibits C-Myc expression through ANGPTL4 to exert tumor suppressive role in gastric cancer
- Lung clearance index to detect the efficacy of Aztreonam lysine inhalation in patients with cystic fibrosis and near normal spirometry – A single-centre feasibility study
- Association of vitamin D nutrition with neuro-developmental outcome of infants of slums in Bangladesh
- Effect of PEPFAR funding policy change on HIV service delivery in a large HIV care and treatment network in Nigeria
- Friends, relatives, sanity, and health: The costs of politics
- European public perceptions of homelessness: A knowledge, attitudes and practices survey
- An overview of the quality assurance programme for HIV rapid testing in South Africa: Outcome of a 2-year phased implementation of quality assurance program
- Transcatheter aortic valve implantation versus surgical aortic valve replacement in patients at low and intermediate risk: A risk specific meta-analysis of randomized controlled trials
- Global smoking trends in inflammatory bowel disease: A systematic review of inception cohorts
- Identification of inflammatory markers suitable for non-invasive, repeated measurement studies in biobehavioral research: A feasibility study
- Genomic analyses reveal an absence of contemporary introgressive admixture between fin whales and blue whales, despite known hybrids
- Tipping the balance towards long-term retention in the HIV care cascade: A mixed methods study in southern Mozambique
- Diagnosis and classification of pediatric acute appendicitis by artificial intelligence methods: An investigator-independent approach
- Stylistic variation on the Donald Trump Twitter account: A linguistic analysis of tweets posted between 2009 and 2018
- Kinematic determinants of scoring success in the fencing flick: Logistic and linear multiple regression analysis
- Preferences for formal and traditional sources of childbirth and postnatal care among women in rural Africa: A systematic review
- Spectral characteristics of urine specimens from healthy human volunteers analyzed using Raman chemometric urinalysis (Rametrix)
- Associations between industry involvement and study characteristics at the time of trial registration in biomedical research
- A review of the elusive bicolored iris Snouted Treefrogs (Anura: Hylidae:Scinax uruguayus group)
- Development of peptide biosensor for the detection of dengue fever biomarker, nonstructural 1
- The predictive performance of SAPS 2 and SAPS 3 in an intermediate care unit for internal medicine at a German university transplant center; A retrospective analysis
- Advancing computational biology and bioinformatics research through open innovation competitions
- Dynamic changes in the physicochemical properties of fresh-cut produce wash water as impacted by commodity type and processing conditions
- Mapping online hate: A scientometric analysis on research trends and hotspots in research on online hate
- Orthogonal projection to latent structures and first derivative for manipulation of PLSR and SVR chemometric models' prediction: A case study
- DNA vaccine based on conserved HA-peptides induces strong immune response and rapidly clears influenza virus infection from vaccinated pigs
- Malaria transmission through the mosquito requires the function of the OMD protein
- Small molecule inhibition of lysine-specific demethylase 1 (LSD1) and histone deacetylase (HDAC) alone and in combination in Ewing sarcoma cell lines
- Governing Tripolye: Integrative architecture in Tripolye settlements
- In vitro selective cytotoxicity of the dietary chalcone cardamonin (CD) on melanoma compared to healthy cells is mediated by apoptosis
- Mortality, perception, and scale: Understanding how predation shapes space use in a wild prey population
- DNA analysis of elasmobranch products originating from Bangladesh reveals unregulated elasmobranch fishery and trade on species of global conservation concern
- Genome-wide analysis of methylation in giant pandas with cataract by methylation-dependent restriction-site associated DNA sequencing (MethylRAD)
- A spherical falling film gas-liquid equilibrator for rapid and continuous measurements of CO2 and other trace gases
- The role of vitamin D in increasing circulating T regulatory cell numbers and modulating T regulatory cell phenotypes in patients with inflammatory disease or in healthy volunteers: A systematic review
- Gastroenteritis and respiratory infection outbreaks in French nursing homes from 2007 to 2018: Morbidity and all-cause lethality according to the individual characteristics of residents
- A pull-down and slot blot-based screening system for inhibitor compounds of the podoplanin-CLEC-2 interaction
- De novo transcriptome analysis of Viola ×wittrockiana exposed to high temperature stress
- Robust methods in Mendelian randomization via penalization of heterogeneous causal estimates
- HMGB1 mediates the development of tendinopathy due to mechanical overloading
- Effects of the Best Possible Self intervention: A systematic review and meta-analysis
- Metabolomic profiling of oxalate-degrading probiotic Lactobacillus acidophilus and Lactobacillus gasseri
- Adjusting cotton planting density under the climatic conditions of Henan Province, China
- Multiple biomarkers of sepsis identified by novel time-lapse proteomics of patient serum
- PTSD in prison settings: A systematic review and meta-analysis of comorbid mental disorders and problematic behaviours
- The female presence in different organisational positions and performance in secondary schools: Does a woman leader function as mediator?
- Beta power encodes contextual estimates of temporal event probability in the human brain
- Molecular characterization of measles virus strains circulating in Cameroon during the 2013-2016 epidemics
- Using metabolite profiling to construct and validate a metabolite risk score for predicting future weight gain
- Comprehensive analysis of the internal structure and firmness in American cranberry (Vaccinium macrocarpon Ait.) fruit
- Predicting spinal profile using 3D non-contact surface scanning: Changes in surface topography as a predictor of internal spinal alignment
- Assessment modelling approaches for stocks with spawning components, seasonal and spatial dynamics, and limited resources for data collection
- Qualitative analysis of ward staff experiences during research of a novel suicide-prevention psychological therapy for psychiatric inpatients: Understanding the barriers and facilitators
- De-climatizing food security: Lessons from climate change micro-simulations in Peru
- Influence of musculotendon geometry variability in muscle forces and hip bone-on-bone forces during walking
- An international survey of perceptions of the 2014 FIFA World Cup: National levels of corruption as a context for perceptions of institutional corruption
- Dissuasive effect, information provision, and consumer reactions to the term ‘Biotechnology’: The case of reproductive interventions in farmed fish
- "If I have a cancer, it is not my fault I am a refugee”: A qualitative study with expert stakeholders on cancer care management for Syrian refugees in Jordan
- The effect of the use of a decision aid with individual risk estimation on the mode of delivery after a caesarean section: A prospective cohort study
- Geographical location influences the composition of the gut microbiota in wild house mice (Mus musculus domesticus) at a fine spatial scale
- High-throughput RNA-sequencing identifies mesenchymal stem cell-induced immunological signature in a rat model of corneal allograft rejection
- Evaluation of the pain intensity differences among hospitalized cancer patients based on a nursing information system
- Effects of chitin synthesis inhibitor treatment on Lepeophtheirus salmonis (Copepoda, Caligidae) larvae
- Protective mechanism of 1-methylhydantoin against lung injury induced by paraquat poisoning
- Use of high-content analysis and machine learning to characterize complex microbial samples via morphological analysis
- Investigation of a spatial coupling relationship between carbon emission performance and regional urbanization in China
- A mutation in mouse Krüppel-like factor 15 alters the gut microbiome and response to obesogenic diet
- Excellent outcome after desensitization in high immunologic risk kidney transplantation
- Characterization of a new composite membrane for point of need paper-based micro-scale microbial fuel cell analytical devices
- Acute kidney injury during an ultra-distance race
- A mitochondria-targeted fatty acid analogue influences hepatic glucose metabolism and reduces the plasma insulin/glucose ratio in male Wistar rats
- The role of C-reactive protein levels on the association of physical activity with lung function in adults
- The CrowdWater game: A playful way to improve the accuracy of crowdsourced water level class data
- Therapeutic efficacy of neuregulin 1-expressing human adipose-derived mesenchymal stem cells for ischemic stroke
- CRISPR/Cas9-based editing of a sensitive transcriptional regulatory element to achieve cell type-specific knockdown of the NEMO scaffold protein
- Exploring the microbiota of upper respiratory tract during the development of pneumonia in a mouse model
- Improved ICU mortality prediction based on SOFA scores and gastrointestinal parameters
- Social information use and collective foraging in a pursuit diving seabird
- Ozone effects on blood biomarkers of systemic inflammation, oxidative stress, endothelial function, and thrombosis: The Multicenter Ozone Study in oldEr Subjects (MOSES)
- Human osteocyte expression of Nerve Growth Factor: The effect of Pentosan Polysulphate Sodium (PPS) and implications for pain associated with knee osteoarthritis
- Prevalence of Epstein-Barr virus, human papillomavirus, cytomegalovirus and herpes simplex virus type 1 in patients with diabetes mellitus type 2 in south-eastern Poland
- Social and structural factors associated with substance use within the support network of adults living in precarious housing in a socially marginalized neighborhood of Vancouver, Canada
- Characterization of Monkeypox virus dissemination in the black-tailed prairie dog (Cynomys ludovicianus) through in vivo bioluminescent imaging
- LPS induces inflammatory chemokines via TLR-4 signalling and enhances the Warburg Effect in THP-1 cells
- How do seabirds modify their search behaviour when encountering fishing boats?
- The diagnostic value of pleural fluid homocysteine in malignant pleural effusion
- Spatio-temporal variations in wheat aphid populations and their natural enemies in four agro-ecological zones of Pakistan
- Factors associated with burnout amongst healthcare workers providing HIV care in Malawi
- A high-density exome capture genotype-by-sequencing panel for forestry breeding in Pinus radiata
- Self-management action and motivation of Pacific adults in New Zealand with end-stage renal disease
- Drought mediated physiological and molecular changes in muskmelon (Cucumis melo L.)
- A prospective randomized trial on abacavir/lamivudine plus darunavir/ritonavir or raltegravir in HIV-positive drug-naïve patients with CD4<200 cells/uL (the PRADAR study)
- Analyzing data from the digital healthcare exchange platform for surveillance of antibiotic prescriptions in primary care in urban Kenya: A mixed-methods study
- Multi-dimensional evaluation of response to salt stress in wheat
- Tuberculosis in the wild boar: Frequentist and Bayesian estimations of diagnostic test parameters when Mycobacterium bovis is present in wild boars but at low prevalence
- Enhanced mechanical and thermal properties of electrically conductive TPNR/GNP nanocomposites assisted with ultrasonication
- Geospatial modeling of microcephaly and zika virus spread patterns in Brazil
- Maternal cardiovascular-related single nucleotide polymorphisms, genes, and pathways associated with early-onset preeclampsia
- A ten-year review of ESBL and non-ESBL Escherichia coli bloodstream infections among children at a tertiary referral hospital in South Africa
- Reference values for the cervical spinal canal and the vertebral bodies by MRI in a general population
- Dynamic mechanical characteristics and failure mode of serpentine under a three-dimensional high static load and frequent dynamic disturbance
- Incorporating statistical strategy into image analysis to estimate effects of steam and allyl isocyanate on weed control
- Regulation of NF-κB- and STAT1-mediated plasmacytoid dendritic cell functions by A20
- The erythrocyte membrane stability is associated with sleep time and social jetlag in shift workers
- New space-time block codes from spectral norm
- Mexican BRCA1 founder mutation: Shortening the gap in genetic assessment for hereditary breast and ovarian cancer patients
- GIVE me your attention: Differentiating goal identification and goal execution components of the anti-saccade effect
- Maternal serum retinol, 25(OH)D and 1,25(OH)2D concentrations during pregnancy and peak bone mass and trabecular bone score in adult offspring at 26-year follow-up
- Self Multi-Head Attention-based Convolutional Neural Networks for fake news detection
- Why are Chinese workers so unhappy? A comparative cross-national analysis of job satisfaction, job expectations, and job attributes
- Fecal indicator bacteria and virus removal in stormwater biofilters: Effects of biochar, media saturation, and field conditioning
- Personalized microstructural evaluation using a Mahalanobis-distance based outlier detection strategy on epilepsy patients’ DTI data – Theory, simulations and example cases
- Radiographic assessment of pectoral flipper bone maturation in bottlenose dolphins (Tursiops truncatus), as a novel technique to accurately estimate chronological age
- Intraoperative measurement of intraventricular pressure in dogs with communicating internal hydrocephalus
- Relative importance of gene effects for nitrogen-use efficiency in popcorn
- Comparative analysis uncovers the limitations of current molecular detection methods for Fusarium oxysporum f. sp. cubense race 4 strains
- The accuracy of the frontal extent in stereoscopic environments: A comparison of direct selection and virtual cursor techniques
- Confronting pastoralists’ knowledge of cattle breeds raised in the extensive production systems of Benin with multivariate analyses of morphological traits
- CH(II), a cerebroprotein hydrolysate, exhibits potential neuro-protective effect on Alzheimer’s disease
- Decontamination of aerosolised bacteria from a pig farm environment using a pH neutral electrochemically activated solution (Ecas4 anolyte)
- Transcriptomic changes triggered by ouabain in rat cerebellum granule cells: Role of α3- and α1-Na+,K+-ATPase-mediated signaling
- Simultaneous transcriptome analysis of oil palm clones and Phytophthora palmivora reveals oil palm defense strategies
- Antifungal effects of a 1,3,4-thiadiazole derivative determined by cytochemical and vibrational spectroscopic studies
- Risk factors for unsuccessful tuberculosis treatment outcomes in children
- CRISPR-based tools for targeted transcriptional and epigenetic regulation in plants
- Reliability of high-resolution ultrasound and magnetic resonance arthrography of the shoulder in patients with sports-related shoulder injuries
- Spatial-temporal variation characteristics and evolution of the global industrial robot trade: A complex network analysis
- Axial variation of deoxyhemoglobin density as a source of the low-frequency time lag structure in blood oxygenation level-dependent signals
- On the sustainability of a family planning program in Nigeria when funding ends
- The epidemiology of antidepressant use in South Korea: Does short-term antidepressant use affect the relapse and recurrence of depressive episodes?
- Injury severity level and associated factors among road traffic accident victims attending emergency department of Tirunesh Beijing Hospital, Addis Ababa, Ethiopia: A cross sectional hospital-based study
- How chimpanzees (Pan troglodytes) share the spoils with collaborators and bystanders
- Seed treatment using methyl jasmonate induces resistance to rice water weevil but reduces plant growth in rice
- Placebo analgesia induced by verbal suggestion in the context of experimentally induced fear and anxiety
- Reconsidering the associations between self-reported alcohol use disorder and mental health problems in the light of co-occurring addictions in young Swiss men
- Learning to assist smokers through encounters with standardized patients: An innovative training for physicians in an Eastern European country
- Serum E-selectin concentration is associated with risk of metabolic syndrome in females
- Lipid and fatty acid dynamics by maternal Pacific bluefin tuna
- Adherence to evidence-based recommendations for surgical site infection prevention: Results among Italian surgical ward nurses
- Novel synergistic fungicidal mixtures of oxathiapiprolin protect sunflower seeds from downy mildew caused by Plasmopara halstedii
- Adjustment of a numerical model for pore pressure generation during an earthquake
- The risk, perceived and actual, of developing type 2 diabetes mellitus for mothers of preschool children in urban China
- Effects of turning frequency on the nutrients of Camellia oleifera shell co-compost with goat dung and evaluation of co-compost maturity
- Imaging disease activity of rheumatoid arthritis by macrophage targeting using second generation translocator protein positron emission tomography tracers
- Distribution of SET/I2PP2A protein in gastrointestinal tissues
- Spontaneous lymphoblastoid cell lines from patients with Epstein-Barr virus infection show highly variable proliferation characteristics that correlate with the expression levels of viral microRNAs
- Early pre- and postsynaptic decrease in glutamatergic and cholinergic signaling after spinalization is not modified when stimulating proprioceptive input to the ankle extensor α-motoneurons: Anatomical and neurochemical study
- Anatomy of a demand shock: Quantitative analysis of crowding in hospital emergency departments in Victoria, Australia during the 2009 influenza pandemic
- Oregano essential oil vapour prevents Plasmopara viticola infection in grapevine (Vitis Vinifera) and primes plant immunity mechanisms
- Dual inhibitory action of trazodone on dorsal raphe serotonergic neurons through 5-HT1A receptor partial agonism and α1-adrenoceptor antagonism
- Optimising poly(lactic-co-glycolic acid) microparticle fabrication using a Taguchi orthogonal array design-of-experiment approach
- Repetitive finger movement and circle drawing in persons with Parkinson’s disease
- The association between family members’ migration and cognitive function among people left behind in China
- Association between long-term adherence to class-I recommended medications and risk for potentially preventable heart failure hospitalizations among younger adults
- Differential role of r-met-hu G-CSF on male reproductive function and development in prepubertal domestic mammals
- Agreement between the spatiotemporal gait parameters from two different wearable devices and high-speed video analysis
- In-hospital cardiopulmonary resuscitation of patients with cirrhosis: A population-based analysis
- Vitamin D treatment of peripheral blood mononuclear cells modulated immune activation and reduced susceptibility to HIV-1 infection of CD4+ T lymphocytes
- Someone like me: Size-assortative pairing and mating in an Amazonian fish, sailfin tetra Crenuchus spilurus
- Seasonality of antenatal care attendance, maternal dietary intake, and fetal growth in the VHEMBE birth cohort, South Africa
- Are trials of psychological and psychosocial interventions for schizophrenia and psychosis included in the NICE guidelines pragmatic? A systematic review
- Incidence of retinal vein occlusion with long-term exposure to ambient air pollution
- Inclusion of enclosed hydration effects in the binding free energy estimation of dopamine D3 receptor complexes
- Intensity modulated radiation therapy following lumpectomy in early-stage breast cancer: Patterns of use and cost consequences among Medicare beneficiaries
- The ‘Saw but Forgot’ error: A role for short-term memory failures in understanding junction crashes?
- Multiscale Modelling Tool: Mathematical modelling of collective behaviour without the maths
- A comparison of machine learning algorithms for the surveillance of autism spectrum disorder
- Drivers of deforestation in the basin of the Usumacinta River: Inference on process from pattern analysis using generalised additive models
- Structure of Dictyostelium discoideum telomeres. Analysis of possible replication mechanisms
- Multidrug-resistant profile and prevalence of extended spectrum β-lactamase and carbapenemase production in fermentative Gram-negative bacilli recovered from patients and specimens referred to National Reference Laboratory, Addis Ababa, Ethiopia
- Primary myelofibrosis marrow-derived CD14+/CD34- monocytes induce myelofibrosis-like phenotype in immunodeficient mice and give rise to megakaryocytes
- Intersubject MVPD: Empirical comparison of fMRI denoising methods for connectivity analysis
- Why Cohen’s Kappa should be avoided as performance measure in classification
- A novel strategy for interpreting the T-SPOT.TB test results read by an ELISPOT plate imager
- Computational identification of key genes that may regulate gene expression reprogramming in Alzheimer’s patients
- NPHP proteins are binding partners of nucleoporins at the base of the primary cilium
- Intensive measures of luminescence in GaN/InGaN heterostructures
- The effect of a web-based training for improving primary health care providers’ knowledge about diabetes mellitus management in rural China: A pre-post intervention study
- Isolation, identification and characterization of Streptomyces metabolites as a potential bioherbicide
- Quantitative magnetic resonance imaging indicates brain tissue alterations in patients after liver transplantation
- DNA analysis of Castanea sativa (sweet chestnut) in Britain and Ireland: Elucidating European origins and genepool diversity
- Forecasting the impact of population ageing on tuberculosis incidence
- Conformation and mechanical property of rpoS mRNA inhibitory stem studied by optical tweezers and X-ray scattering
- Voxelwise statistical methods to localize practice variation in brain tumor surgery
- Identification and evolutionary characterization of salt-responsive transcription factors in the succulent halophyte Suaeda fruticosa
- Integrating temperature-dependent life table data into Insect Life Cycle Model for predicting the potential distribution of Scapsipedus icipe Hugel & Tanga
- Rollout of ShangRing circumcision with active surveillance for adverse events and monitoring for uptake in Kenya
- Comparative phenotypic profiling of the JAK2 inhibitors ruxolitinib, fedratinib, momelotinib, and pacritinib reveals distinct mechanistic signatures
- Analyzing a networked social algorithm for collective selection of representative committees
- Gene expression profiling of skeletal myogenesis in human embryonic stem cells reveals a potential cascade of transcription factors regulating stages of myogenesis, including quiescent/activated satellite cell-like gene expression
- Ex vivo physiological compression of human osteoarthritis cartilage modulates cellular and matrix components
- EFForTS-LGraf: A landscape generator for creating smallholder-driven land-use mosaics
- Impact of the severity of negative energy balance on gene expression in the subcutaneous adipose tissue of periparturient primiparous Holstein dairy cows: Identification of potential novel metabolic signals for the reproductive system
- Precision and consistency of the passive leg raising maneuver for determining fluid responsiveness with bioreactance non-invasive cardiac output monitoring in critically ill patients and healthy volunteers
- Optimizing bacterial DNA extraction in urine
- Adherences to oral nutritional supplementation among hospital outpatients: An online cross-sectional survey in Japan
- Effects of inorganic nitrogen and litters of Masson Pine on soil organic carbon decomposition
- Antioxidant properties of potato tubers (Solanum tuberosum L.) as a consequence of genetic potential and growing conditions
- Transcatheter aortic valve implantation versus conservative management for severe aortic stenosis in real clinical practice
- “I put it in my head that the supplement would help me”: Open-placebo improves exercise performance in female cyclists
- Automated diagnosis of heart valve degradation using novelty detection algorithms and machine learning
- Spatiotemporal clustering of malaria in southern-central Ethiopia: A community-based cohort study
- Studying the link between physiological performance of Crotalaria ochroleuca and the distribution of Ca, P, K and S in seeds with X-ray fluorescence
- Characterization of bony changes localized to the cervical articular processes in a mixed population of horses
- Heat shock-induced chaperoning by Hsp70 is enabled in-cell
- Disability and its association with sociodemographic factors among elderly persons residing in an urban resettlement colony, New Delhi, India
- Correlates of prenatal and postnatal mother-to-infant bonding quality: A systematic review
- IGFBP2 promotes immunosuppression associated with its mesenchymal induction and FcγRIIB phosphorylation in glioblastoma
- Dietary supplementation with the extract from Eucommia ulmoides leaves changed epithelial restitution and gut microbial community and composition of weanling piglets
- How did that interaction make you feel? The relationship between quality of everyday social experiences and emotion in people with and without schizophrenia
- Effects of Lyse-It on endonuclease fragmentation, function and activity
- Overexpression of rice gene OsATG8b confers tolerance to nitrogen starvation and increases yield and nitrogen use efficiency (NUE) in Arabidopsis
- Gait can reveal sleep quality with machine learning models
- Blast vacuolization in AML patients indicates adverse-risk AML and is associated with impaired survival after intensive induction chemotherapy
- Mitochondrial fragmentation and network architecture in degenerative diseases
- Quadriceps muscle strength is a discriminant predictor of dependence in daily activities in nursing home residents
- Discovery of novel West Nile Virus protease inhibitor based on isobenzonafuranone and triazolic derivatives of eugenol and indan-1,3-dione scaffolds
- Skin-associated lactic acid bacteria from North American bullfrogs as potential control agents of Batrachochytrium dendrobatidis
- Microbiota of MR1 deficient mice confer resistance against Clostridium difficile infection
- The responses of extracellular enzyme activities and microbial community composition under nitrogen addition in an upland soil
- Post-translational S-glutathionylation of cofilin increases actin cycling during cocaine seeking
- Absolute pitch can be learned by some adults
- Anger while driving in Mexico City
- Glomerular hyperfiltration may be a novel risk factor of restrictive spirometry pattern: Analysis of the Korea National Health and Nutrition Examination Survey (KNHANES) 2009-2015
- Survival of infants ≤24 months of age with brain tumors: A population-based study using the SEER database
- Multiple evoked and induced alpha modulations in a visual attention task: Latency, amplitude and topographical profiles
- Heart rate variability reduction is related to a high amount of visceral adiposity in healthy young women
- Serum and urinary metabolomics and outcomes in cirrhosis
- Optimal threshold of adherence to lipid lowering drugs in predicting acute coronary syndrome, stroke, or mortality: A cohort study
- Systemic antibiotic prophylaxis does not affect infectious complications in pediatric burn injury: A meta-analysis
- How Knowledge Stock Exchanges can increase student success in Massive Open Online Courses
- CT-perfusion in peripheral arterial disease – Correlation with angiographic and hemodynamic parameters
- Pattern of health care utilization and traditional and complementary medicine use among Ebola survivors in Sierra Leone
- Respiratory variations in pulse pressure and photoplethysmographic waveform amplitude during positive expiratory pressure and continuous positive airway pressure in a model of progressive hypovolemia
- Dorsal tongue porphyrin autofluorescence and Candida saprophytism: A prospective observational study
- A usability study to improve a clinical decision support system for the prescription of antibiotic drugs
- Occurrence of and risk factors for extended-spectrum cephalosporin-resistant Enterobacteriaceae determined by sampling of all Norwegian broiler flocks during a six month period
- Healthcare facility-based strategies to improve tuberculosis testing and linkage to care in non-U.S.-born population in the United States: A systematic review
- Correction: Reward abundance interferes with error-based learning in a visuomotor adaptation task
- Correction: Potential user interest in new long-acting contraceptives: Results from a mixed methods study in Burkina Faso and Uganda
- Correction: Recombinant rabbit beta nerve growth factor production and its biological effects on sperm and ovulation in rabbits
- Critically ill patients with community-onset intraabdominal infections: Influence of healthcare exposure on resistance rates and mortality
- Validating a popular outpatient antibiotic database to reliably identify high prescribing physicians for patients 65 years of age and older
- Metabolisable energy content in canine and feline foods is best predicted by the NRC2006 equation
- Group conquers efficacy: Preschoolers’ imitation under conflict between minimal group membership and behavior efficacy
- Warmth and competence stereotypes about immigrant groups in Germany
- Social resistance drives persistent transmission of Ebola virus disease in Eastern Democratic Republic of Congo: A mixed-methods study
- ER stress activation in the intestinal mucosa but not in mesenteric adipose tissue is associated with inflammation in Crohn’s disease patients
- Enhancing percutaneous pedicle screw fixation with hydroxyapatite granules: A biomechanical study using an osteoporotic bone model
- Optimum plant density for crowding stress tolerant processing sweet corn
- Sign and goal tracker rats process differently the incentive salience of a conditioned stimulus
- Interocular symmetry, intraobserver repeatability, and interobserver reliability of cone density measurements in the 13-lined ground squirrel
- Plasma metabolite biomarkers for multiple system atrophy and progressive supranuclear palsy
- Knowledge, attitudes and practices of livestock and aquaculture producers regarding antimicrobial use and resistance in Vietnam
- Scientific sinkhole: The pernicious price of formatting
- Resource consumption of multi-substance users in the emergency room: A neglected patient group
- Association between distress and knowledge among parents of autistic children
- Surgical approach for complete cochlear coverage in EAS-patients after residual hearing loss
- The impact of a rapid molecular identification test on positive blood cultures from critically ill with bacteremia: A pre-post intervention study
- Shortening duration of ertapenem in outpatient parenteral antimicrobial therapy for complicated urinary tract infections: A retrospective study
- Measurement and analysis of partial lightning currents in a head phantom
- Within species expressed genetic variability and gene expression response to different temperatures in the rotifer Brachionus calyciflorus sensu stricto
- Repeated transspinal stimulation decreases soleus H-reflex excitability and restores spinal inhibition in human spinal cord injury
- Expression of Concern: Resveratrol Enhances Antitumor Activity of TRAIL in Prostate Cancer Xenografts through Activation of FOXO Transcription Factor
- Correlation of CT texture changes with treatment response during radiation therapy for esophageal cancer: An exploratory study
- Modeling spatial variation in density of golden eagle nest sites in the western United States
- Retraction: Autophagy in Muscle of Glucose-Infusion Hyperglycemia Rats and Streptozotocin-Induced Hyperglycemia Rats via Selective Activation of m-TOR or FoxO3
- Correction: In Porphyromonas gingivalis VimF Is Involved in Gingipain Maturation through the Transfer of Galactose
- Gibberellic acid in Citrus spp. flowering and fruiting: A systematic review
- Discharge care quality in hospitalised elderly patients: Extended validation of the Discharge Care Experiences Survey
- A novel therapeutic strategy for esophageal varices using endoscopic treatment combined with splenic artery embolization according to the Child-Pugh classification
- Correction: Development of a high-throughput assay to measure measles neutralizing antibodies
- Correction: Provider preference for payment method under a national health insurance scheme: A survey of health insurance-credentialed health care providers in Ghana
- Correction: Second-line HIV treatment failure in sub-Saharan Africa: A systematic review and meta-analysis
- Potential impact of efflux pump genes in mediating rifampicin resistance in clinical isolates of Mycobacterium tuberculosis from India
- Feed-forward visual processing suffices for coarse localization but fine-grained localization in an attention-demanding context needs feedback processing
- Level Set method-based two-dimensional numerical model for simulation of nonuniform open-channel flow
- Compared to non-drinkers, individuals who drink alcohol have a more favorable multisystem physiologic risk score as measured by allostatic load
- Effect of poor glycaemic control on plasma levels and activity of protein C, protein S, and antithrombin III in type 2 diabetes mellitus
- Retraction: IL-21 Regulates the Differentiation of a Human γδ T Cell Subset Equipped with B Cell Helper Activity
- Sugar transporters in Fabaceae, featuring SUT MST and SWEET families of the model plant Medicago truncatula and the agricultural crop Pisum sativum
- Prediction of lymphovascular space invasion in endometrial cancer using the 55-gene signature selected by DNA microarray analysis
- Research on multi-agent genetic algorithm based on tabu search for the job shop scheduling problem
- Diagnosing the current state of out-of-field teaching in high school science and mathematics
- Sensitivity of the fasciae to sex hormone levels: Modulation of collagen-I, collagen-III and fibrillin production
- Comorbidity of age-related macular degeneration with Alzheimer’s disease: A histopathologic case-control study
- Acute ex vivo changes in brain white matter diffusion tensor metrics
- Regulatory interaction between the ZPBP2-ORMDL3/Zpbp2-Ormdl3 region and the circadian clock
- The effect of bacteria on planula-larvae settlement and metamorphosis in the octocoral Rhytisma fulvum fulvum
- Sodium alginate potentiates antioxidant defense and PR proteins against early blight disease caused by Alternaria solani in Solanum lycopersicum Linn.
- Ground reaction forces and muscle activity while walking on sand versus stable ground in individuals with pronated feet compared with healthy controls
- Correction: Roadway traffic crash prediction using a state-space model based support vector regression approach
- MET as resistance factor for afatinib therapy and motility driver in gastric cancer cells
- Genetic analysis and fine mapping of a qualitative trait locus wpb1 for albino panicle branches in rice
- Clinical features of pulmonary embolism in patients with lung cancer: A meta-analysis
- Cinobufacini ameliorates experimental colitis via modulating the composition of gut microbiota
- Factors restraining the population growth of Varroa destructor in Ethiopian honey bees (Apis mellifera simensis)
- Coastal proximity of populations in 22 Pacific Island Countries and Territories
- DKK1 promotes hepatocellular carcinoma inflammation, migration and invasion: Implication of TGF-β1
- Genetic characterization of Angiostrongylus larvae and their intermediate host, Achatina fulica, in Thailand
- Targeted in-vitro-stimulation reveals highly proliferative multi-virus-specific human central memory T cells as candidates for prophylactic T cell therapy
- Influence of ocean circulation and the Kuroshio large meander on the 2018 Japanese eel recruitment season
- Growth response of the ichthyotoxic haptophyte, Prymnesium parvum Carter, to changes in sulfate and fluoride concentrations
- Letrozole treatment of pubertal female mice results in activational effects on reproduction, metabolism and the gut microbiome
- Prognostic nomogram predicts overall survival in pulmonary large cell neuroendocrine carcinoma
- Microbiome profiling of the onion thrips, Thrips tabaci Lindeman (Thysanoptera: Thripidae)
- Characteristics of proximal early gastric cancer differentiating distal early gastric cancer
- Retraction: Impacts of rock properties on Danxia landform formation based on lithological experiments at Kongtongshan National Geopark, northwest China
- Correction: SVR12 rates higher than 99% after sofosbuvir/velpatasvir combination in HCV infected patients with F0-F1 fibrosis stage: A real world experience
- Retraction: Plexin-B1 Activates NF-κB and IL-8 to Promote a Pro-Angiogenic Response in Endothelial Cells
- Relationship between cognitive behavioral variables and mental health status among university students: A meta-analysis
- Association between temperature, sunlight hours and alcohol consumption
- Using graph learning to understand adverse pregnancy outcomes and stress pathways
- Correction: The step-to-step transition mode: A potential indicator of first-fall risk in elderly adults?
- Surgical referral systems in low- and middle-income countries: A review of the evidence
- In vivo clearance of nanoparticles by transcytosis across alveolar epithelial cells
- Correction: The Economic Impact of Malignant Catarrhal Fever on Pastoralist Livelihoods
- Correction: Identification of miRNAs involved in fruit ripening by deep sequencing of Olea europaea L. transcriptome
- Correction: Characterization of ecto- and endoparasite communities of wild Mediterranean teleosts by a metabarcoding approach
- Correction: Vascular Endothelial Growth Factor Receptor-2 Couples Cyclo-Oxygenase-2 with Pro-Angiogenic Actions of Leptin on Human Endothelial Cells
- Correction: Plant traits linked to field-scale flammability metrics in prescribed burns in Eucalyptus forest
- Correction: Maturation of three-dimensional, hiPSC-derived cardiomyocyte spheroids utilizing cyclic, uniaxial stretch and electrical stimulation
- Correction: To keep or not to keep? Decision making in adolescent pregnancies in Jamestown, Ghana
- PLOS One
- Archiv čísel
- Aktuální číslo
- Informace o časopisu
Nejčtenější v tomto čísle- Graviola (Annona muricata) attenuates behavioural alterations and testicular oxidative stress induced by streptozotocin in diabetic rats
- CH(II), a cerebroprotein hydrolysate, exhibits potential neuro-protective effect on Alzheimer’s disease
- Comparison between Aptima Assays (Hologic) and the Allplex STI Essential Assay (Seegene) for the diagnosis of Sexually transmitted infections
- Assessment of glucose-6-phosphate dehydrogenase activity using CareStart G6PD rapid diagnostic test and associated genetic variants in Plasmodium vivax malaria endemic setting in Mauritania
Kurzy
Zvyšte si kvalifikaci online z pohodlí domova
Revma Focus: Spondyloartritidy
nový kurz
Autoři: doc. MUDr. Norbert Pauk, Ph.D.
Autoři: prof. MUDr. Vladimír Palička, CSc., Dr.h.c., doc. MUDr. Václav Vyskočil, Ph.D., MUDr. Petr Kasalický, CSc., MUDr. Jan Rosa, Ing. Pavel Havlík, Ing. Jan Adam, Hana Hejnová, DiS., Jana Křenková
Autoři: MUDr. Irena Krčmová, CSc.
Všechny kurzyPřihlášení#ADS_BOTTOM_SCRIPTS#Zapomenuté hesloZadejte e-mailovou adresu, se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.
- Vzdělávání