#PAGE_PARAMS# #ADS_HEAD_SCRIPTS# #MICRODATA#

Gluconeogenesis and PEPCK are critical components of healthy aging and dietary restriction life extension


Authors: Brian Onken aff001;  Natallia Kalinava aff001;  Monica Driscoll aff001
Authors place of work: Department of Molecular Biology and Biochemistry Rutgers University, Piscataway, NJ, United States of America aff001
Published in the journal: Gluconeogenesis and PEPCK are critical components of healthy aging and dietary restriction life extension. PLoS Genet 16(8): e32767. doi:10.1371/journal.pgen.1008982
Category: Research Article
doi: https://doi.org/10.1371/journal.pgen.1008982

Summary

High glucose diets are unhealthy, although the mechanisms by which elevated glucose is harmful to whole animal physiology are not well understood. In Caenorhabditis elegans, high glucose shortens lifespan, while chemically inflicted glucose restriction promotes longevity. We investigated the impact of glucose metabolism on aging quality (maintained locomotory capacity and median lifespan) and found that, in addition to shortening lifespan, excess glucose negatively impacts locomotory healthspan. Conversely, disrupting glucose utilization by knockdown of glycolysis-specific genes results in large mid-age physical improvements via a mechanism that requires the FOXO transcription factor DAF-16. Adult locomotory capacity is extended by glycolysis disruption, but maximum lifespan is not, indicating that limiting glycolysis can increase the proportion of life spent in mobility health. We also considered the largely ignored role of glucose biosynthesis (gluconeogenesis) in adult health. Directed perturbations of gluconeogenic genes that specify single direction enzymatic reactions for glucose synthesis decrease locomotory healthspan, suggesting that gluconeogenesis is needed for healthy aging. Consistent with this idea, overexpression of the central gluconeogenic gene pck-2 (encoding PEPCK) increases health measures via a mechanism that requires DAF-16 to promote pck-2 expression in specific intestinal cells. Dietary restriction also features DAF-16-dependent pck-2 expression in the intestine, and the healthspan benefits conferred by dietary restriction require pck-2. Together, our results describe a new paradigm in which nutritional signals engage gluconeogenesis to influence aging quality via DAF-16. These data underscore the idea that promotion of gluconeogenesis might be an unappreciated goal for healthy aging and could constitute a novel target for pharmacological interventions that counter high glucose consequences, including diabetes.

Keywords:

Caenorhabditis elegans – RNA interference – Glucose metabolism – Gastrointestinal tract – Glycolysis – Glucose – Biological locomotion – Gene disruption

Introduction

How to live at peak health over adult life is a challenge of our time. Successful aging, defined by some as the prolonged maintenance of physical and cognitive function coupled with avoidance of debilitating disease, can most certainly be influenced by activity and diet [1]. At odds with the goal of healthy aging, the “American diet” has been criticized for high sugar and high fat content that promotes muscular, cardiac, immune, and neuronal decline [28]. Diets rich in carbohydrates, which readily break down to glucose, can exacerbate diabetes health risks [9] and lead to sarcopenic muscle mass loss [1012]. Although epidemiological studies support that high sugar diets impair health, tightly controlled studies of metabolic influences on aging quality are difficult to conduct in the human population, which is heterogeneous in genetics, activity, and food consumption patterns.

Animal models have been highly instructive regarding conserved metabolic states that promote or defer age-associated decline. In the facile aging model Caenorhabditis elegans, high glucose in growth medium shortens lifespan independently of associated osmotic change or glucose metabolism by bacterial food, in part via insulin-like signaling [1320]. The insulin/IGF-1 receptor ortholog DAF-2 activates the AGE-1 PI3 kinase to signal downstream to inhibit the activity of longevity-promoting transcription factors including DAF-16/FOXO. Glucose stimulates insulin signaling to decrease lifespan in part by inhibiting DAF-16 [16, 18, 19]. Conversely, low insulin signaling activity activates DAF-16-mediated transcription to promote longevity [2128].

Restricting glucose use can confer health benefits. For example, limiting C. elegans glucose catabolism by administering non-metabolizable 2-deoxyglucose results in longevity [19, 29]. More generally, dietary restriction (DR), a physiological state induced by reduced caloric intake, increases lifespan across species. In mammals, DR reduces blood glucose and insulin levels, and decreases glycolytic gene expression [3032]. In C. elegans, complex pathways can induce DR benefits of longevity and prolonged vigor [3343]. Still, several methods of food limitation extend lifespan via a DAF-16-dependent mechanism, suggesting that DR increases longevity by engaging a mechanism linked to the insulin signaling pathway under at least some conditions [34, 38, 40, 43].

How glucose impacts tissue-specific features of age-associated decline, such as sarcopenic loss of muscle mass and strength, is a central issue in healthy maintenance that remains poorly understood. Likewise, metabolic circuits linking glucose, DR, and insulin signaling remain to be fully elaborated [17]. To begin to address these relationships, we examined the impact of genetically perturbing glycolytic and gluconeogenic flux on maintained C. elegans muscle function and on survival during adult life.

Here we report on how glucose metabolism intersects with longevity pathways to influence aging quality. We show that high glucose levels and high glycolytic activity negatively impact adult locomotory and general health, while conversely, gluconeogenic activity promotes maintenance of healthy muscle function and mid-life survival. Conserved transcription factor DAF-16 is crucial for these effects: glycolysis inhibits DAF-16 to compromise healthspan, while DAF-16 signaling directly promotes gluconeogenic gene expression to extend healthspan. DAF-16-dependent expression of gluconeogenesis-specific enzyme PEPCK PCK-2 in specific intestinal cells is critical for this regulation, suggesting that metabolic regulation in specific cells drives animal-wide health. Multiple DR pathways elevate gluconeogenic gene expression via DAF-16, and we show this gluconeogenic gene expression is required for extended healthspan under DR. Our results demonstrate that interventions that promote gluconeogenic metabolism can improve overall health, possibly by inducing a DR-like physiological state. We suggest that interventions that promote gluconeogenesis constitute a novel strategy for combating age-associated diseases and accelerated aging-related glucose homeostasis dysregulation.

Results

High glucose accelerates sarcopenic decline of muscle-controlled C. elegans behaviors

Elevated glucose systemically impairs human health with consequences particularly potent in middle to older age. The mechanisms by which high glucose compromises individual tissue functions remain poorly understood at the molecular level. In particular, how high glucose diets relate to conserved degenerative processes such as sarcopenia—the progressive loss of muscle mass and muscle strength over time that lowers quality of life and increases frailty—is unclear.

C. elegans locomotion rates decline with age in a manner that is roughly correlated with the degree of sarcopenic muscle deterioration [44, 45] but that also involves neuronal health [46, 47]. Cellular phenotypes associated with human muscle skeletal decline, including disorganization and loss of sarcomeres as well as fat infiltration of muscle, are observed in bodywall muscles of aging nematodes that progressively slow in locomotory capacity. Likewise, C. elegans cardiac-like muscle that makes up the pharynx undergoes significant structural and functional decline with age [45, 48, 49].

To examine the impact of high glucose on locomotory ability, we exposed wild-type C. elegans to increasing levels of glucose and recorded swim vigor in older age. (Swim behavior is directed by worm skeletal muscle-like bodywall muscle [50, 51]; here and throughout the text we use a swim vigor measure (number of head bends/30 sec.) as a measure of locomotion capacity). We found that 4% glucose media impairs swimming ability of young adults (5 days old, Supplemental S1A Fig); middle-aged adults (Fig 1A, left-hand graph, 8 days old), and animals of more advanced age (13 days old, Supplmental Fig 1B); 2% glucose, which has been shown to decrease lifespan [16, 20, 52], did not impact swimming in our hands (Supplemental S1C Fig). In addition, we found that exposure to high glucose reduces older age pharyngeal pumping mediated by cardiac-like pharyngeal muscle (Fig 1A, right-hand graph; 5 day old measure scored because pharyngeal muscle function declines faster than bodywall muscle). Together, these outcomes reveal a progeric influence of high glucose on physical activity and muscle function reminiscent of that suggested for glucose impact on muscle-associated decline in human elderly [11, 12, 53] and consistent with recent studies of glucose toxicity on old-age mobility [13, 20].

Fig. 1. Disrupting Glycolysis-promoting Genes Extends C. elegans Healthspan, Whereas High Glucose and Gluconeogenic Gene Disruptions Shorten Healthspan.
Disrupting Glycolysis-promoting Genes Extends <i>C</i>. <i>elegans</i> Healthspan, Whereas High Glucose and Gluconeogenic Gene Disruptions Shorten Healthspan.

Glucose catabolism is associated with accelerated aging traits

Aging induces glycolytic gene expression in mammals [30, 32], and, in C. elegans under standard feeding conditions, inhibiting glucose catabolism with the glucose analog 2-deoxyglucose or with genetic inhibition of at least one glycolytic enzyme (pyruvate kinase, or PYK) promotes longevity [19, 52]. In addition, treatment with the glycolysis intermediate DHAP has a large detrimental impact on C. elegans lifespan [52]. These observations suggest that the process, or consequences, of glucose utilization could be linked to age-associated decline in locomotion.

To address how glucose catabolism influences functional aging under standard feeding conditions, we disrupted the specific C. elegans enzymes that catalyze unidirectional, irreversible steps in glycolysis. Although most reactions of glycolysis are readily reversible, distinct enzymes execute the forward and reverse reactions for the fructose-6-phosphate/fructose 1,6 bisphosphate interconversion (PFK/FBP) and the P-enolphosphate/pyruvate interconversion (PYK/PCK) (see Fig 1B). We anticipated that RNAi-mediated disruption of the reactions that specifically promote glycolysis (i.e., enzymes PFK and PYK) should have a predominant metabolic effect of limiting glycolytic flux, as appears to be the case for 2-deoxyglucose [19, 29]. Indeed, we found that knockdown of the glycolysis-promoting phosphofructokinase (pfk1.1, hereafter referred to as pfk) and pyruvate kinase (pyk-2) genes results in significant increases in swim ability in mid -⁠ and late life (Fig 1C). We conclude that limiting glycolysis can robustly protect against age-associated mobility decline, consistent with a previous report [20]. Furthermore, we find that disruptions of glycolytic genes pfk and pyk-2 also result in increases in median survival (Fig 1D and S1 Table), supporting that limiting glycolysis promotes overall health in aging adult populations.

It is interesting to note that the gains in swimming ability and median survival we observe with unidirectional glycolysis gene disruptions are not accompanied by comparably large increases in maximal lifespan (Supplemental S1D Fig). This observation is important in light of the study of Bansal et al. [54] that suggests that some long-lived C. elegans mutants spend extended periods of time in a frail state at the end of life, in proportion to their increased maximal lifespan. The glycolysis interventions we highlight appear to maintain youthful physiology in mid-life without extending late-life frailty. The inability of glycolysis interventions to extend maximal lifespan may indicate midlife-specific metabolic consequences, or alternatively might be attributed to confounding failures in older animals not improved by glycolytic inhibition. Blocking glycolysis may result in the build-up of glucose, which could reach toxic levels later in life. In sum, knockdown of enzymes that specifically catalyze one-way steps critical for glucose breakdown can improve multiple measures of healthy aging, supporting that glycolytic flux confers an overall negative impact on physiology that promotes functional aging.

Inhibiting unidirectional glycolysis-promoting reactions increases mid-life health via DAF-16

DAF-16/FOXO is a critical downstream transcription factor in longevity-promoting pathways [22], and inhibition of DAF-16 activity has been previously implicated in the glucose toxicity mechanism [16, 19]. We therefore tested whether DAF-16/FOXO might act to promote healthy aging when glycolysis is genetically impaired. We first sought evidence of DAF-16 activation under conditions of pfk and pyk-2 RNAi using a well-characterized reporter of DAF-16 activity, SOD-3::GFP, a direct transcriptional target of C. elegans DAF-16 [55, 56]. We found that both pfk(RNAi) and pyk-2(RNAi) result in significant increases in SOD-3::GFP levels (Fig 2A), suggesting that glycolytic gene disruptions may generally increase DAF-16 transcriptional activity. Indeed, daf-16 is critical for the strong healthspan effects of glycolytic gene disruptions we document in Fig 1: the large increases in swimming ability and the median survival extension of wild-type animals treated with RNAi against glycolytic genes pyk-2 and pfk are largely eliminated in daf-16 null mutants (Fig 2B and 2C and S1 Table, overall survival analyses; we note that, although median survival does not increase with pfk(RNAi) in the daf-16 mutant background, the daf-16 lifespan curve is significantly right-shifted late in life with pfk(RNAi) treatment, suggesting that glycolytic interventions may impact longevity independently of DAF-16 in older animals).

Fig. 2. DAF-16/FOXO is Required for Locomotory Healthspan and Lifespan Benefits of Genetic Glycolysis Disruption.
DAF-16/FOXO is Required for Locomotory Healthspan and Lifespan Benefits of Genetic Glycolysis Disruption.

If DAF-16 were activated by knockdown of glycolytic pfk and pyk-2 via an insulin signaling pathway, we might expect that pfk and pyk-2 disruption in an insulin pathway activation background would not further enhance health and lifespan phenotypes. We tested this possibility by performing pfk and pyk-2 RNAi in the age-1 insulin signaling pathway mutant, well characterized for activated DAF-16 and associated longevity [26]. We found that disrupting glycolytic pfk or pyk-2, which extend locomotory healthspan and mid-life survival in wild type (Fig 1C and 1D and S1 Table), does not enhance locomotory ability in the age-1 mutant background (S2A Fig) and pfk(RNAi) does not significantly improve age-1 lifespan curves (S1 Table). The lack of benefits of pfk and pyk-2 knockdown in age-1 is consistent with a model in which pfk and pyk-2 disruption can activate DAF-16, possibly via a common insulin signaling pathway: enhanced DAF-16 activity can bypass deleterious consequences of glycolysis. We note that pyk-2(RNAi) can extend age-1 lifespan (S1 Table), suggesting that the glycolytic pathway may also influence lifespan via pathways other than the insulin pathway and DAF-16 (as supported by our results with pfk(RNAi) in the daf-16 background, described above).

Together these data on daf-16 demonstrate that inhibiting unidirectional glycolytic enzymes increases locomotory healthspan and median lifespan via a DAF-16-dependent mechanism. Data also support that modulation of insulin signaling is associated with glycolytic flux changes, consistent with previous studies on C. elegans glucose toxicity [13, 1620].

Reversing glycolytic flux (i.e., promoting gluconeogenesis) promotes healthy aging

The existence of enzymes that specifically catalyze the reverse reactions of PFK and PYK-2 enabled us to test whether disruption of gluconeogenesis promotes effects opposite to the positive outcomes of RNAi-mediated glycolysis inhibition. We found that animals treated with RNAi against genes that encode the unidirectional gluconeogenic enzymes fructose-1,6-bisphosphatase (FBP-1), which catalyzes the gluconeogenic reaction reverse to PFK, and phosphoenolpyruvate carboxykinase (PCK-2), which catalyzes the gluconeogenic reaction reverse to PYK-2 (Fig 1B), exhibit major impairments in locomotory ability in late life (disrupting pck-2 knockdown has such strong effects that animals were moving too slowly (or too few animals remained alive) to measure on day 15) (Fig 1C). Disrupting gluconeogenic genes fbp-1 and pck-2 also significantly shortens median lifespan (Fig 1D and S1 Table).

To rule out that pck-2(RNAi) might merely confer general sickness, we tested pck-2 inhibition in the age-1 background. We find that pck-2(RNAi) does not reduce locomotory rates or lifespan extension in the age-1 background (S2A and S2B Fig and S1 Table), supporting that impairing gluconeogenic activity does not universally compromise health. We conclude that fbp-1 and pck-2 dependent reactions that promote gluconeogenesis are needed to maintain normal adult healthspan. Our findings indicate that gluconeogenesis pathways are critical for late life health under standard growth conditions, and constitute the first focused demonstration that fbp-1 and pck-2 deficiency can be progeric for C. elegans.

In sum, inhibiting the enzymes that specifically promote glycolysis confers beneficial effects on both locomotory healthspan and median survival, whereas inhibiting enzymes that specifically promote gluconeogenesis negatively impacts these two indicators of adult health. Data suggest that glycolysis is deleterious, and gluconeogenesis is beneficial for healthy aging, especially as judged by locomotory capacity.

Overexpression of gluconeogenic PEPCK-C gene pck-2 extends locomotory healthspan and lifespan

Phosphoenolpyruvate carboxykinase (PEPCK) catalyzes the rate-controlling step of gluconeogenesis, and is thus a central player in glucose homeostasis. In mammals, there are two forms of the enzyme: cytosolic PEPCK-C and mitochondrial PEPCK-M, with PEPCK-C thought to play the larger role in metabolic regulation [57]. Given the striking requirement for gluconeogenic pck-2 in maintained locomotory health and normal lifespan (Fig 1C and 1D and S1 Table) and previous indications that PEPCK can drive metabolic states [58, 59], we focused on mechanisms of pck-2 contributions to adult health (pck-2 does not include a detectable mitochondrial targeting sequence and PCK-2 expressed from a rescuing transgene does not localize to mitochondria (S3A Fig), supporting pck-2 encodes a PEPCK-C; in our hands, sequence-confirmed RNAi knockdown of pck-1, which encodes another C. elegans PEPCK ortholog [59] did not impact aging, S1 Table).

Since disruption of pck-2 is deleterious to health, we first asked whether elevated C. elegans PEPCK expression might suffice to promote healthy metabolism associated with enhanced late adult maintenance. We examined a strain carrying multiple integrated copies of Ppck-2pck-2::gfp for potential benefits of pck-2 over-expression in healthy aging. We found that the Is[Ppck-2pck-2::gfp] over-expression line exhibits increases in midlife locomotory ability and median survival (but not maximal lifespan) as compared to controls that express only GFP from the pck-2 promoter (S3B and S3C Fig and S1 Table; the promoter-only Is[Ppck-2gfp] control construct had no effect on wild-type locomotory ability or lifespan, S3C, S3D and S3E Fig and S1 Table). We conclude that over-expression of pck-2, which encodes the unidirectional, rate-limiting enzyme of gluconeogenesis, can extend locomotory healthspan and median lifespan.

pck-2 overexpression lifespan extension requires gluconeogenesis

In mammals, PEPCK is widely expressed, and, in addition to its role in gluconeogenic tissues, PEPCK plays an anaplerotic role in non-gluconeogenic cells (i.e., in glyceroneogenesis; [57]). To ask whether pck-2 overexpression acts via its gluconeogenesis role, we tested the requirement for the glucose-6-phosphatase complex in the improved mid-life survival seen in our pck-2 overexpressing strain. In mammals, glucose-6-phosphatase is specifically expressed in gluconeogenic tissues where it catalyzes the final step of gluconeogenesis [60]. Here we targeted the ortholog of glucose-6-phosphate translocase, a component of the glucose-6-phosphatase complex in vertebrates ([61]; see Supplemental S4 Fig for homology alignment; note that the C. elegans glucose-6-phosphatase has not been experimentally identified). We found that the lifespan benefits of pck-2 overexpression are absent when glucose-6-phosphate translocase is disrupted (Fig 3A and S1 Table). Thus pck-2 overexpression acts via a gluconeogenesis pathway to improve adult health.

Fig. 3. Increased Locomotory Healthspan and Survival with pck-2 Overexpression, as Well as Expression of pck-2 in the Intestine, Require daf-16.
Increased Locomotory Healthspan and Survival with <i>pck-2</i> Overexpression, as Well as Expression of <i>pck-2</i> in the Intestine, Require <i>daf-16</i>.

pck-2 is expressed in specific intestinal cells via a daf-16-dependent mechanism

To better understand how gluconeogenic PCK-2 improves adult health, we probed the expression pattern of pck-2. We used the Is[Ppck-2 pck-2::gfp] reporter to determine the tissues/cells in which PCK-2 is likely needed for adult health impact. In younger animals under standard growth conditions, the Is[Ppck-2 pck-2::gfp] translational fusion is expressed in the pharynx, in the intestine, in bodywall muscle, and in hypodermis. In adults, Is[Ppck-2 pck-2::gfp] expression becomes strikingly restricted to the very most anterior and posterior intestinal cells (Fig 3B). We also note that, consistent with its assignment as a PEPCK-C ortholog, PCK-2::GFP appears localized to the cytoplasm in the cells in which it is expressed (S3A Fig).

Since we had determined that daf-16 is important for the benefits associated with glycolysis downregulation (Fig 2), we wondered whether daf-16 might be important for the pck-2 over-expression healthspan effects. Indeed, the pck-2 promoter includes a consensus DAF-16 binding site, and has been identified as a direct target of DAF-16 [62, 63]. To test whether DAF-16 is required for pck-2 expression, we performed daf-16(RNAi) in the Is[Ppck-2 pck-2::gfp] strain. We find that daf-16(RNAi) eliminates the GFP signal specifically in adult intestinal cells but not in other tissues in younger animals (Fig 3B), establishing that the intestinal expression of pck-2 is DAF-16-dependent. To confirm direct targeting of pck-2 by DAF-16, we altered the putative DAF-16 binding site in the pck-2 promoter (Fig 3B) and examined Ex[Ppck-2mut pck-2::gfp] expression. We find that disruption of the DAF-16 consensus binding site eliminates intestinal expression, supporting that DAF-16 directly regulates pck-2 expression in specific intestinal cells via consensus DAF-16 target sites (Fig 3B). Furthermore, the locomotory and median lifespan benefits associated with pck-2 over-expression are completely abolished by daf-16(RNAi): the mid-age health phenotypes of pck-2 over-expressing animals under daf-16 RNAi knockdown conditions are similar to that of control animals treated with daf-16(RNAi) (Fig 3C, D).

Although DAF-16 is required for increased lifespan with both reduced insulin signaling [2128] and pck-2 overexpression, pck-2 is not required for the long lifespan of age-1 insulin pathway mutants (S2B Fig), suggesting that gluconeogenic activity may lie upstream of or parallel to the insulin pathway to impact lifespan and healthspan.

Overall, our results support that DAF-16 positively regulates pck-2, which is required to extend C. elegans healthspan, and suggest that specific cells in the anterior and posterior intestine are central to this regulation. DAF-16 thus plays a critical role in promoting gluconeogenesis and healthy aging at least in part by transcriptional regulation of key biosynthetic enzyme cytoplasmic PCK-2.

Expression of transcriptional fusion Ppck-2gfp is induced under food limitation via a daf-16-dependent mechanism

For our studies of pck-2 expression we also constructed a pck-2 transcriptional reporter (Is[Ppck-2gfp]) in which the pck-2 promoter is fused to GFP and all pck-2 coding and intron sequences are missing. We noted a striking difference in GFP expression between the functional PCK-2::GFP translational fusion and the Ppck-2 transcriptional reporter: while the PCK-2::GFP translational fusion is constitutively expressed, the pck-2 promoter-only transcriptional reporter is expressed solely in the intestine and only under food limitation conditions (Fig 4A and 4B). We tested multiple food limitation regimens published to induce dietary restriction-like metabolism (absence of food, food dilution, metformin administration, and the eat-2 feeding-impaired mutant) to document that animals carrying the Ppck-2gfp transcriptional reporter exhibit strong GFP fluorescence in the anterior and posterior intestine cells (Fig 4A and 4B) (similar to the constitutive Is[Ppck-2pck-2::gfp] intestinal cell expression pattern (Fig 3B); expression in other cells that express Ppck-2pck-2::gfp is not evident for Is[Ppck-2gfp]). Strikingly, however, under ad lib conditions little, if any, Ppck-2gfp expression is apparent in anterior or posterior intestinal cells. These data raise the possibility of enhanced pck-2 expression under food limitation conditions. Increased intestinal GFP produced from the Ppck-2gfp transcriptional reporter in the DR-mimetic eat-2 mutant requires daf-16 (Fig 4B). Thus, food limitation is associated with daf-16-dependent transcriptional expression of Is[Ppck-2gfp] in specific intestinal cells.

Fig. 4. Dietary Restriction Induces Gluconeogenic Gene pck-2 Expression via DAF-16, and pck-2 Expression is Needed for DR-associated Healthspan Benefits.
Dietary Restriction Induces Gluconeogenic Gene <i>pck-2</i> Expression via DAF-16, and <i>pck-2</i> Expression is Needed for DR-associated Healthspan Benefits.

We confirmed an increase in native pck-2 transcripts in the eat-2 DR-mimetic mutant relative to WT later in life by qPCR analysis (Fig 4C). While pck-2 expression decreases in wild-type animals as they age (0.44 and 0.39 fold change as compared to the WT day 3 level for days 7 and 10, respectively), pck-2 levels remain remarkably level throughout the eat-2 lifespan (0.72, 0.70 and 0.80 fold change as compared to WT day 3 level for day 3, 7, and 10, respectively) (Fig 4C). Notably, pck-2 transcript levels under DR are elevated in mid-to-late life when compared to ad lib fed animals, just as we see with the Ppck-2gfp reporter (Fig 4B). Levels of the gluconeogenic gene encoding the C. elegans glucose-6-phosphate translocase ortholog are also increased under eat-2 DR (Fig 4C), suggesting that DR metabolism may generally feature elevated transcripts of the enzymes of gluconeogenesis, with consequent increased gluconeogenic capacity.

The difference in expression profiles between full length translational fusion (constitutive gut expression) and the transcriptional fusion (food limitation-induced gut expression) might be attributed to different sequence inclusions in the transcription and translational constructs, although an alternative possibility can be considered, grounded in the fact that the translational fusion constitutes a PEPCK over-expression situation. Because in WT, qPCR shows that pck-2 transcript levels decline with age, but in the eat-2 DR model pck-2 transcript levels remain elevated (Fig 4C), it is tempting to speculate that the elevation of PCK-2 protein associated with the over-expressed functional translational fusion might be the consequence of increased PCK-2 activity that acts in a positive feedback loop to maintain a gluconeogenic metabolic state (see Discussion).

Gluconeogenic PCK-2 is required for the health benefits of DR

Our observations raised the question as to whether PCK-2, induced under DR, is required for the healthspan benefits associated with the DR state. To address this question, we measured locomotion and median survival in DR-constitutive eat-2 mutants treated with RNAi against pck-2. We found significant decreases in swimming rates in eat-2 mutants for pck-2 disruptions in late-life (Fig 4D). Moreover, we found that the increased median survival of both eat-2 DR constitutive mutants and of wild-type animals grown under DR is fully dependent on pck-2 (Fig 4E and 4F and S1 Table). These data show that PCK-2 activity is critical for benefits induced by two distinct DR-inducing conditions. Together, our data support a model in which DAF-16 positively regulates pck-2 expression under DR or glucose limitation conditions, in a metabolic shift critical for maintaining healthspan. We find that RNAi-mediated knockdown of fbp-1, the other unidirectional enzyme that promotes gluconeogenesis, also eliminates longevity phenotypes of eat-2 and of WT reared under food limitation (Supplemental S5A and S5B Fig). Together, our data support that gluconeogenic flux may be a critical element in maintaining healthy aging in older animals (Fig 1C and 1D) and in healthy DR metabolism.

Glycolytic disruptions extend healthspan by promoting gluconeogenic activity and DR-like metabolism

Limiting glycolysis promotes DAF-16 activity (Fig 2A), and DAF-16 is needed for healthspan benefits of glycolysis inhibition (Fig 2B and 2C), gluconeogenic gene pck-2 overexpression (Fig 3C and 3D), and some forms of dietary restriction [34]. Our findings raise an intriguing question on metabolic flux: do glycolytic disruptions trigger gluconeogenic / DR metabolism to promote healthy aging?

To address this possibility, we first asked whether the locomotory healthspan effects of glycolytic gene disruption might act in the same pathway as locomotory healthspan effects of feeding limitation eat-2 DR by addressing whether or not an additional (possibly additive) improvement occurs when both perturbations are operative. We find that glycolytic disruption in the eat-2 background does not increase older age swimming above that recorded for eat-2 (Fig 4D), consistent with a model in which glycolytic gene disruptions and DR increase locomotory healthspan via the same pathway (although we cannot be certain that ceiling effects might exist in this particular situation).

We next asked whether glycolytic disruption induces additional features of dietary restriction. We previously showed that under multiple DR conditions, the excitation wavelength corresponding to the peak fluorescence of age pigments/lipofuscin shifts to a wavelength lower than any other longevity pathway mutants or any animal grown in abundant food [64]. Indeed, we found that for glycolytic gene disruption pfk(RNAi), the peak age pigment fluorescence excitation wavelength shifts downward, similar to that found in dietary-restricted eat-2 mutants (Fig 4G) and in other food limitation conditions, suggesting that pfk(RNAi) induces a switch to DR-like metabolism. Interestingly, DR prevents the upregulation of glycolytic PFK with age in mammals [30] and inhibits pfk expression in C. elegans [65], supporting that decreased glycolysis-promoting phosphofructokinase activity may be a key and conserved feature of DR metabolism.

Finally, we found that glycolysis disruptions via pfk(RNAi) significantly increase gluconeogenic gene pck-2 expression, as measured by increased PCK-2::GFP (expressed from Is[Ppck-2pck-2::gfp]) levels (Fig 4H). Thus, genetically limiting glycolysis flux increases gluoconeogenic enzyme expression, likely via daf-16-mediated loops that direct a yin/yang metabolic balance between glucose utilization and biosynthesis. Our data support a model in which enhanced gluconeogenic metabolism is key to health benefits under dietary restriction and is needed for normal healthy aging, a new concept in healthy metabolism.

Discussion

We examined the relationship between C. elegans glucose metabolism pathways and healthy aging, with an emphasis on the maintenance of physical function and overall mid-life survival health outcomes. A high glucose diet accelerates age-associated decline in mobility and survival robustness. Glycolysis exerts a particularly strong negative influence on healthy aging: limiting glycolysis by disrupting one-way glucose degradation steps can result in large old-age locomotory improvements and increases in median lifespan. A key point in our study is focused on the opposing gluconeogenic pathway: gluconeogenic activity is essential for normal healthy aging, as disrupting dedicated gluconeogenic genes induces progeric decline of locomotory activity and compromises survival. Gluconeogenic pathway integrity is also needed for the beneficial effects of dietary restriction. Importantly, interventions that disrupt glycolysis or increase gluconeogenic activity promote healthy physiology in mid-life without markedly extending maximal lifespan, suggesting that these metabolic interventions improve the quality of aging without extending the period of late-life frailty. Data also indicate that expression of the gluconeogenic PEPCK PCK-2 in just a few intestinal cells can modulate animal-wide metabolic state. Overall, our data highlight a novel paradigm in which glycolysis and gluconeogenesis work opposite to one another to influence the maintenance of adult health. We speculate that this metabolic yin/yang underlies major differences in the quality of aging, which if conserved, validates warnings against high sugar diets.

High glucose accelerates muscle decline across species

Type II diabetes mellitus is associated with accelerated muscle loss during human aging [1012] and loss of mouse glycolytic muscle is associated with metabolic dysfunction, a consequence that can further compromise glucose homeostasis [66]. We emphasize that a high glucose diet also accelerates C. elegans locomotory decline, likely reflective of muscle dysfunction. Previous reports on mobility parameters are consistent with a negative impact of glucose on adult mobility maintenance [14, 20, 67]. Moreover, high glucose, which can compromise mammalian heart health [68], also promotes functional decline of C. elegans cardiac-like pharyngeal muscle. Although the swimming assay we focus on measures functionality rather than muscle integrity per se, our data support C. elegans is a plausible model for development of protective strategies that maintain muscle functionality against the stress of high glucose/high glycolysis metabolism associated with high sugar diets or diabetes [69].

Glucose processing negatively impacts healthy aging

Lee et al. show that excessive glucose promotes fatty acid synthesis to shorten lifespan, and suggest that glycolytic and fatty acid synthesis pathway activity may result in the accumulation of toxic intermediate metabolites [52]. Consistent with this suggestion, treatment with glycolytic intermediate DHAP reduces lifespan in glucose-fed nematodes, and inhibition of glycolytic enzyme pyruvate kinase increases lifespan both in high-glucose and control conditions [52]. We show that inhibiting glycolysis increases median lifespan and promotes locomotory ability in older animals. A paradox is that glycolytic interventions also would be anticipated to elevate glucose levels, which can be toxic. That inhibiting glycolysis can be beneficial raises the possibility that, in early -⁠ and mid-life, the buildup of toxic metabolites from glucose processing (i.e. DHAP) rather than the overall glucose levels has a significant impact on aging quality. Since maximal lifespan does not appear to be changed by glycolytic inhibition, it is possible that glucose build-up could reach toxic levels in older animals. In future studies it will be of interest to measure glucose levels over adult life and to address whether promoting gluconeogenic activity, like inhibiting glycolysis, can mitigate the harmful effects of excess glucose exposure.

DAF-16/FOXO promotes gluconeogenic metabolism via a mechanism critical for healthy aging

How exactly does glucose metabolism impact aging quality? When glycolysis is active, daf-16/FOXO expression is suppressed, with deleterious consequences for locomotory and whole-animal aging [16]. We document that when glycolysis is inhibited, DAF-16 activity increases, enabling direct positive regulation of key gluconeogenic gene pck-2. Without pck-2 increase, aging is accelerated. Thus, our data suggest that one mechanism by which DAF-16 promotes healthspan is by engaging gluconeogenic pathways via increasing PCK-2 production. This model is supported by chromatin profiling studies showing that pck-2 is a direct target of DAF-16 [70] and our demonstration that DAF-16 consensus binding sequences are required for in vivo effects of pck-2 expression. Since mammalian DAF-16 ortholog FOXO1 targets PEPCK to regulate hepatic gluconeogenesis [71, 72], our data support that DAF-16/FOXO regulation of pck-2 may be a facet of a conserved mechanism that controls glucose levels.

Different roles of PEPCK isoforms as drivers of healthy maintenance: PCK-2 in intestine as a key metabolic regulatory point for healthy aging

The overall impact of gluconeogenic pathway flux in C. elegans is likely carried out by two distinct PEPCKs, with critical points of action in different tissues. There are three PEPCK genes encoded by the C. elegans genome. pck-1 encodes a cytoplasmic PEPCK-C that contributes 85% of the measurable PEPCK activity in young C. elegans (pck-2 appears to contribute the rest of measurable PEPCK activity at this time) [59]. PCK-1 is expressed in bodywall muscle, pharyngeal muscle and intestine, and has been suggested to be the workhorse energy/metabolic modulator PEPCK in C. elegans [59, 73]. Overexpression of pck-1 from its native promoter [59] or only in bodywall muscle is sufficient to increase overall lifespan (expression of pck-1 in intestine is not effective; [73]). Disruption of pck-1 can shorten lifespan [73], although we (S1 Table) do not find this outcome for RNAi interventions (technical differences likely explain the outcomes).

Interestingly, pck-2, which we show is another PEPCK-C homolog, seems to serve a different role from pck-1 in promoting adult health. The restriction of pck-2 expression to the very anterior and posterior gut in adults suggests a non-autonomous instructive role for PCK-2 in locomotory aging, and aging of the whole animal. More specifically, although a pck-2 translational reporter (native promoter + whole protein GFP tagged) is expressed in multiple tissue types including the muscles and intestine, treatment with daf-16(RNAi) or altering the DAF-16 binding site in the pck-2 promoter abolishes PCK-2 expression only in particular cells of the intestine, yet this deficit is sufficient to disrupt health benefits. Although GFP-based transgene reporters are not always accurate in reflecting native expression, our finding that adult PCK-2::GFP expression in intestine can drive whole-animal metabolic coordination and hence benefits in locomotion (nerve and muscle) and mid-life survival (system-wide health), implies that metabolic changes in certain gut cells can set the animal-wide maintenance tone. Future studies that express pck-2 specifically in the intestine in a pck-2 null background should further test this model.

The specific expression for PCK-2 suggests that metabolic regulation/change in particular sets of cells might constitute a driver mechanism that directs whole-animal changes. PCK-2 might serve as a daf-16-dependent first responder that signals for metabolic shift in other cells and tissues. General metabolic director cells would be of interest to identify as their specific manipulation might be targeted for enhanced health maintenance during aging.

The intestine as a driver for whole animal health

C. elegans intestine is thought to/appears to perform multiple endodermal activities for the worm, functioning as digestive organ, liver and pancreas. Increasing daf-16 in intestine upregulates DAF-16 activity in other tissues [74], with FOXO-to-FOXO signaling downregulating intestinal insulin ins-7 [75]. In flies, overexpressing dFOXO specifically in the fat body reduces insulin-like peptide gene dilp-2 expression in neurons and reduces insulin/IGF-1 signaling in peripheral tissues [76, 77]. Brief FOXO induction in young adult fly intestine is sufficient to extend lifespan [15, 78]. Details of how PEPCK relates to DAF-16 signaling in aging remain to be worked out in worms, flies and possibly mammals, but the possibility of conservation of mechanism has been raised [79].

Indeed, the gut has previously been shown to differentially express food-dependent master regulators of DR [42, 80]. As pck-2 is essential for healthspan promotion under DR, the anterior and posterior intestinal cells may monitor food/energy levels and signal non-autonomously to adjust metabolism across the entire body when food becomes limiting. The nature of this signal is not yet known, although it is appealing to speculate that it might parallel mammalian glucagon signaling.

Regarding the question of how PEPCK acts in healthy aging, it might be worth noting that L1 starvation has been demonstrated to use a daf-16 dependent mechanism to restructure carbohydrate metabolism to drive carbon flux through glyoxylate and gluconeogenesis towards trehalose synthesis [81]. In C. elegans, excess glucose can be stored as glycogen or in the form of the two-carbon sugar trehalose [20, 82]. Although we have not focused on the energy storage outcome of promoting/preventing gluconeogenesis, high glucose has been shown to increase stored glycogen [20, 82] and genetic disruption of glycogen synthesis induces a daf-16-dependent shift toward trehalose elevation associated with longevity and enhanced healthspan [20]. Promotion of gluconeogenesis might be anticipated to enhance trehalose production as has been documented for the daf-16-dependent L1 starvation response [81]. In the future, it will be of interest to define how energy stores are impacted by pck-2.

Dietary restriction-mediated longevity requires pck-2

Our data show that at least two modes of dietary restriction, genetically induced eat-2 and food limitation, require pck-2 expression for healthspan benefits, and that eat-2 mutants exhibit elevated levels of pck-2 expression late into life. Our findings interface well with published findings documenting that DR and longevity in general involve a metabolic shift away from glycolysis and toward fatty acid metabolism [59, 61, 83, 84]. A role for the PCK-1 PEPCK-C in DR has been independently documented [73]. We define gluconeogenic metabolism as a critical requirement for DR-associated extensions of healthspan. We also emphasize that, as pck-2 and fbp-1 are required to maintain health in older wild-type animals under typical feeding conditions, gluconeogenic activity is not only required for the extended healthspan under DR, but for healthy aging in general.

Together, our results support that promoting gluconeogenic metabolism via PEPCK activity engages a conserved metabolic reorganization that results in significant healthspan benefits. How enhanced gluconeogenesis impacts whole-animal/tissue-specific glucose levels remains to be determined, but a switch to gluconeogenic metabolism may result in a shift to health-promoting storage or utilization of energy stores. For example, gluconeogenesis requires amino acid fuel provided by autophagic proteolysis [85]. Increasing gluconeogenic flux may further promote autophagy, which is required for most longevity pathways (including DR; [86]), and may engage healthy metabolism. That gluconeogenesis can promote healthy aging is supported by studies in other models linking enhanced gluconeogenesis to increased lifespan [8789], suggesting a conserved pro-longevity mechanism. Interestingly, pck-2 expression decreases as C. elegans age [90], but gluconeogenic genes, including pck-2, are up-regulated in long-lived dauer and daf-2 insulin signaling mutants [61, 83, 84]. We also show that pck-2 expression remains elevated during adulthood in long-lived eat-2 DR mutants. We suggest that gluconeogenic capacity, possibly in key cells, is a common component of healthy aging, and compromising this capacity later in life undermines successful maintenance.

A positive feedback loop for metabolic conditions that promote adult health?

Disrupting glycolytic gene pfk can both induce a fluorescent biomarker for the DR state and increase PCK-2 expression, supporting a model in which glycolytic disruptions increase DAF-16 signaling to trigger gluconeogenic/DR metabolism and extend healthspan (Fig 4I). This model is supported by our data showing that DAF-16 is required for the healthspan benefits seen with glycolytic gene disruptions.

Interestingly, although a transcriptional reporter for PCK-2 is expressed in a food-dependent manner, the functional PCK-2 translational reporter is not sensitive to food status. Given published datasets that suggest that elevated PCK-2 transcription levels track with increased longevity/healthspan [61, 83, 84], it seems possible that the high constitutive levels we find when intact pck-2 is over-expressed reflect a gain-of-activity consequence of high PCK-2. We speculate that high PCK-2 induces a metabolic state in which DAF-16 activity increases, resulting in a positive regulatory loop that stimulates DAF-16 activity and reinforces a healthy metabolic state. As reduced insulin signaling does not require PCK-2 to promote healthy aging via DAF-16, PCK-2 may signal parallel to the insulin pathway to intersect with DAF-16. Alternatively, PCK-2 may increase DAF-16 activity by downregulating insulin signaling, which may lie downstream of PCK-2 in regulating lifespan and healthspan (Fig 4I).

Overall, our data support a model in which nutritional signals engage glucose metabolism to influence the quality of aging via DAF-16 (Fig 4I). Under DR or glucose limitation, increased DAF-16 activity promotes gluconeogenic gene expression, resulting in lifespan and healthspan benefits. When food is plentiful, glycolytic activity effectively suppresses DAF-16, which compromises both locomotory healthspan and lifespan. As high levels of glucose inhibit DAF-16 [16], buildup of toxic metabolites [52] may result from inhibition of gluconeogenic metabolism consequent to elevated glycolytic activity. Our data mechanistically tie high glucose intake with suppression of an anti-aging, pro-healthspan gluconeogenic pathway, underscoring a rationale for limiting dietary glucose. The importance of the gluconeogenesis flux in adult health suggests gluconeogenesis process as a novel target for anti-aging interventions as well as for anti-glucose toxicity approaches.

Materials and methods

C. elegans cultures

The following strains used in this study were provided by the Caenorhabditis Genetics Center (CGC, University of Minnesota), which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440): wild-type Bristol N2, TJ1052 age-1(hx546), GR1307 daf-16(mgDf50), DA1116 eat-2(ad1116), RB1966 R11A5.4(ok2586), CF1553 N2;muIS84[Psod-3gfp]. The following are transgenic lines generated for these studies: ZB4912 bzIs191[Ppck-2gfp Pmec-4mCherry], ZB4913 bzIs192[Ppck-2pck-2::gfp Pmec-4mCherry], ZB4914 bzEx283[Ppck-2mutpck-2::gfp Pmec-4mCherry]. All strains were grown under standard conditions at 20°C [93] on Escherichia coli strain OP50-1 or HT115 for RNAi. All experiments were performed at 20°C. Metformin (Sigma-Aldrich, Catalog # D15,095–9) was added directly to the NGM agar media to a final concentration 50 mM from a 1 M aqueous stock. For high-glucose plates, D-(+)-Glucose (Sigma-Aldrich, Catalog # D9434) was added to the liquid media to a final concentration of 2% or 4% from a 24% aqueous stock.

Generation of the fbp-1 (K07A3.1) RNAi clone

As the RNAi feeding vector for fbp-1 targeting was not available in the Ahringer library [94, 95], we constructed our own vector using the following primers for cloning into the pL4440 plasmid using NheI cut sites: 5’-CGCGCGCTAGCATACGG AATCGCTG-3’ and 5’-GCGCGGCTAGCATCGATTTTTTTTAA-3’.

Generation of N2;Is[Ppck-2gfp], N2;Is[Ppck-2pck-2::gfp], and N2;Ex[Ppck-2mutpck-2::gfp] lines

The Ppck-2gfp and Ppck-2pck-2::gfp vectors were constructed using the In-Fusion HD cloning system (Clontech). For Ppck-2gfp, we amplified 2.9 kb of sequence upstream of the pck-2 start codon using the primers 5’-CGACTCTAGAGGATCCGACTGATTGAATGAATGACTGGAG TGTATTGG-3’ and 5’-CCAATCCCGGGGATCCGATTCTCTACACCGACTGTGCCGAAAC TTT-3’ and inserted the product into the pPD95.77 vector (Addgene) linearized with BamHI. For Ppck-2pck-2::gfp, we amplified the pck-2 coding region and 3’-UTR using the primers 5’-GGAGGACCCTTGAGGGTACCATG TCTGTTGATCCAAACCTTCTTACTCC -3’ and 5’-TCATTTTTTCTACCGGTACCGG CAATGTCTGGACTCTCTTCTCTTGAGC -3’ and inserted the product into the Ppck-2gfp vector linearized with KpnI. The Ppck-2mutpck-2::gfp vector containing the mutated DAF-16 binding site in the pck-2 promoter region was generated using the QuikChange II site-directed mutagenesis kit (Agilent) with the Ppck-2pck-2::gfp vector and the following primers: 5'-GAACTGGAGAAAAAAACAAACTTTCCACTTTTCTATAATATGTTCTGCA TTTTCAAAGTTTTTTTCTTAAAGAACATTAACTTTAAT-3' and 5'-ATTAAAGTTAATGTTCTTTA AGAAAAAAACTTTGAAAATGCAGAACATATTATAGAAAAGTGGAAAGTTTGTTTTTTTCTCCAGTTC-3'. All constructs were injected at 50 ng/ul into wild-type animals along with a Pmec-4mCherry co-injection marker [96] (100 ng/ul). Ppck-2gfp and Ppck-2pck-2::gfp transgenics were γ-irradiated to identify stably transformed lines as described [97].

Lifespan assays

Lifespan analyses were performed in the same manner for all strains. For each experiment, except where otherwise noted, the lifespan of 60 animals was measured in each trial. RNAi assays were performed using a feeding library as described [94, 95], with some modifications. For each RNAi clone tested, we placed 15 L4-stage larvae on 3 RNAi plates containing 4 mM IPTG with 5 animals per plate and allowed these to develop to adulthood and then lay eggs over 24 hours. These parental animals were then removed from the plates. 48 hours later, 60 (day 2) L4 larvae were transferred to fresh plates. These animals were transferred to fresh plates every day during the progeny production period, and then every other day thereafter. Animals that did not move when gently prodded were scored as dead. Animals that crawled off the plate or died from vulva bursting or internal hatching were not included in lifespan counts.

pck-2 overexpression studies

Studies with the pck-2 over-expressor (Ppck-2pck-2::gfp) used GFP expressed from the pck-2 promoter (Ppck-2gfp) as a control. We used Ppck-2gfp (lacking the PCK-2 coding sequence) to guard against the possibility that elevating the promoter alone might have biological consequences (such as titrating out transcription factors like DAF-16). Potential effects of having high copy numbers of the pck-2 promoter would be not be apparent in non-transgenic wild-type animals. In Supplemental S3C Fig, nontransgenic wild-type animals generated during the outcrossing of the transgenic lines were used as controls in lifespan studies with Ppck-2gfp and Ppck-2pck-2::gfp animals.

Locomotion assays

Animals were raised from eggs similar to the lifespan assays. 40 individuals were measured for body bend rate in liquid. Briefly, 4 animals were placed in 20 μl M9 buffer on a glass slide and filmed for 30 seconds using a Qimaging Rotera-XR digital camera attached to a dissecting microscope and Streampix imaging software (ver. 3.17.2, NorPix). Swimming rates were calculated using CeleST [92]. Note that although assays in some different panels were sampled at different timepoints in mid-late adulthood due to convenience, locomotory decline progresses over time and comparison was always done to control on the same day. Absolute scores can vary between days/experiments, but relative decline is reproducible. Because baseline scores can vary, our conclusions are only drawn from data from trials within single experiments, not across different experiments.

Age pigment fluorescence spectroscopy

Age pigment fluorescence intensity was measured as described [64]. Wild-type animals were raised from eggs on plates as in the lifespan assays until day 5 of life. On day 5, 50 animals were transferred to 50 μl 10 mM NaN3 solution in a single well of a 96-well white FluoroNunc plate (Nalge Nunc Int’l). The animals were scanned using an in vivo spectrofluorimeter (Fluorolog-3, Jobin Yvon Inc., Edison NJ). Peak age pigment fluorescence intensity was determined by scanning through a range of excitation wavelengths from 280–410 nm and an emission wavelength of 430 nm. DataMax data acquisition software (v. 2.20, Jobin Yvon Inc.) and Grams/32 data manipulation software (v. 4.14, Galactic Industries Corp.) were used to process the emission data. Scores are the average age pigment fluorescence intensity levels of three independent trials.

Pharyngeal pumping assays

Wild-type animals were raised from eggs on NGM control or 2% or 4% glucose plates similar to the lifespan assays. On day 5 of life, the pharyngeal pumping rates of 35 individuals were measured in real time by scoring pharyngeal pumping by eye under a dissecting microscope for 30 seconds.

DR assays on solid media

For the experiment described in Fig 4A, 4B and 4F and S5 Fig, bleached eggs were placed on plates layered with either undiluted (AL) OP50-1 (for Fig 4A) or HT115 (for Fig 4F) overnight culture or 1 : 10 (DR) diluted OP50-1 (for Fig 4A) or HT115 (for Fig 4F) culture (the HT115 overnight cultures were grown in the presence of 4 mM IPTG to induce RNAi expression). OP50-1/HT115 were killed immediately after drying on AL and DR plates using 2 x 106 uJ at 254 nm using a Stratagene UV Stratalinker 1800 instrument. For the experiment described in Fig 4B, live OP50-1 cultures were placed on plates containing 100 ug/ml ampicillin to arrest growth at 7 x 1010 cfu (AL) and 7 x 109 cfu (DR) concentrations. N2;Is[Ppck-2gfp] animals were placed on these plates at the L4 stage (day 2 of life) and assays were performed on day 4 of life.

Quantitation of Psod-3GFP and Ppck-2pck-2::gfp expression

N2; muIs84[Psod-3gfp] or N2; Is[Ppck-2pck-2::gfp] animals were raised from eggs as in the lifespan assays. On day 5 of life for N2; muIs84[Psod-3gfp] and day 7 for N2; Is[Ppck-2pck-2::gfp] animals, we measured GFP fluorescence in 50 animals per condition using a spectrofluorimeter as in the age pigment quantitation assays described above.

Fluorescence microscopy

N2;Is[Ppck-2gfp], N2;Is[Ppck-2pck-2::gfp], and N2;Ex[Ppck-2mutpck-2::gfp] animals were raised from eggs on RNAi plates similar to the lifespan assays. On day 7 of life, animals were placed in 10 mM NaN3 or M9 liquid media and observed under a 40x objective lens using a Zeiss Axioplan 2 microscope equipped with an X-cite Series 120 (EXPO Photonic Solution, Inc.) fluorescence illuminator. Micrographs were obtained using an Optronics digital microscope camera and Magnafire processing software.

cDNA synthesis and qPCR

C. elegans samples (approximately 10,000 animals per sample) were collected by washing using M9 buffer with 0.01% Tween20. To remove residual OP50 E. coli culture, the worm pellet was applied onto M9 buffer with 10% sucrose solution and spun in a clinical centrifuge at full speed for 1 min. The resulting pellet was transferred into a pre-chilled (with liquid N2) mortar and ground with mortar and pestle. The resulting sample grind was stored at -80°C. Total RNA was extracted from the frozen grind of the worms sample using TRIzol extraction (Life Technology, 15596–026). The resulting sample was treated with DNase I (NEB M0303L) and followed by phenol:chloroform (1,1) purification. The resulting total RNA was re-suspended with dH2O and stored at -80°C. First strand cDNA synthesis was done using SuperScript III RT kit (Life Technology, 18080–044) and using 1ug of the total RNA and oligo(dT)20 for mRNA enrichment. The resulting cDNA samples were used for qPCR. All qPCR reactions were done in triplicate, using KAPA SYBR FAST kit (KAPA Biosystems). Each mRNA level was quantified with reference to the mRNA level of tba-1 [98]. The primers used for pck-2 were: CGATATCACCACATGGCTTG and GCTTTCCCAGTCTGGATGAA; for F47B8.10: GCTTCACAAGCTGGGTTCTC and CGAAGACGTACACGGAATGA.

Mitochondria staining

N2;Is[Ppck-2pck-2::gfp] transgenic animals were raised from eggs on plates similar to the lifespan assays. On day 7 of life, 20 animals were washed and resuspended in 1 μg/ml MitoTracker Red CMXRos (Molecular Probes, M7512) in M9 for 6 hours at 20° C in the dark. Animals were washed four times in M9, then placed on seeded NGM plates for one hour at 20° C in the dark. Mitochondrial staining was imaged as described under Fluorescence Microscopy above.

Statistical analyses

Log-rank (Mantel-Cox) tests, Gehan-Breslow-Wilcoxon tests, ANOVA, and unpaired t tests were performed using GraphPad Prism version 5.00 for Windows (GraphPad Software, San Diego California).

Supporting information

S1 Table [tif]
Lifespan data.

S1 Fig [a]
Excess glucose availability negatively impacts healthspan of young and old animals; conversely, the benefits of disrupting glycolysis do not include extended maximal lifespan.

S2 Fig [a]
The healthspan effects of glycolytic and gluconeogenic disruptions are absent in the insulin signaling mutant background.

S3 Fig [a]
Expression of a translational reporter increases healthspan measures, and expression of a promoter -only transcriptional reporter does not affect healthspan measures.

S4 Fig [tif]
Alignment between . glucose-6-Phosphate translocase ortholog and human, mouse, zebrafish, and fly glucose-6-Phosphate exchanger.

S5 Fig [a]
Gluconeogenic gene expression is required for healthspan extension under dietary restriction.


Zdroje

1. de Cabo R, Carmona-Gutierrez D, Bernier M, Hall MN, Madeo F. The search for antiaging interventions: from elixirs to fasting regimens. Cell. 2014;157(7):1515–26. Epub 2014/06/21. doi: 10.1016/j.cell.2014.05.031 24949965; PubMed Central PMCID: PMC4254402.

2. Adler AI, Boyko EJ, Ahroni JH, Stensel V, Forsberg RC, Smith DG. Risk factors for diabetic peripheral sensory neuropathy. Results of the Seattle Prospective Diabetic Foot Study. Diabetes care. 1997;20(7):1162–7. Epub 1997/07/01. doi: 10.2337/diacare.20.7.1162 9203456.

3. Ford ES, Giles WH, Dietz WH. Prevalence of the metabolic syndrome among US adults: findings from the third National Health and Nutrition Examination Survey. JAMA: the journal of the American Medical Association. 2002;287(3):356–9. Epub 2002/01/16. doi: 10.1001/jama.287.3.356 11790215.

4. Hanefeld M, Fischer S, Julius U, Schulze J, Schwanebeck U, Schmechel H, et al. Risk factors for myocardial infarction and death in newly detected NIDDM: the Diabetes Intervention Study, 11-year follow-up. Diabetologia. 1996;39(12):1577–83. Epub 1996/12/01. doi: 10.1007/s001250050617 8960845.

5. Klein R. Hyperglycemia and microvascular and macrovascular disease in diabetes. Diabetes care. 1995;18(2):258–68. Epub 1995/02/01. doi: 10.2337/diacare.18.2.258 7729308.

6. Standl E, Balletshofer B, Dahl B, Weichenhain B, Stiegler H, Hormann A, et al. Predictors of 10-year macrovascular and overall mortality in patients with NIDDM: the Munich General Practitioner Project. Diabetologia. 1996;39(12):1540–5. Epub 1996/12/01. doi: 10.1007/s001250050612 8960840.

7. Uusitupa MI, Niskanen LK, Siitonen O, Voutilainen E, Pyorala K. Ten-year cardiovascular mortality in relation to risk factors and abnormalities in lipoprotein composition in type 2 (non-insulin-dependent) diabetic and non-diabetic subjects. Diabetologia. 1993;36(11):1175–84. Epub 1993/11/01. doi: 10.1007/BF00401063 8270133.

8. Wei M, Gaskill SP, Haffner SM, Stern MP. Effects of diabetes and level of glycemia on all-cause and cardiovascular mortality. The San Antonio Heart Study. Diabetes care. 1998;21(7):1167–72. Epub 1998/07/08. doi: 10.2337/diacare.21.7.1167 9653614.

9. American Diabetes A, Bantle JP, Wylie-Rosett J, Albright AL, Apovian CM, Clark NG, et al. Nutrition recommendations and interventions for diabetes: a position statement of the American Diabetes Association. Diabetes care. 2008;31 Suppl 1:S61–78. Epub 2008/01/10. doi: 10.2337/dc08-S061 18165339.

10. Ostler JE, Maurya SK, Dials J, Roof SR, Devor ST, Ziolo MT, et al. Effects of insulin resistance on skeletal muscle growth and exercise capacity in type 2 diabetic mouse models. Am J Physiol Endocrinol Metab. 2014;306(6):E592–605. Epub 2014/01/16. doi: 10.1152/ajpendo.00277.2013 24425761; PubMed Central PMCID: PMC3948983.

11. Park SW, Goodpaster BH, Lee JS, Kuller LH, Boudreau R, de Rekeneire N, et al. Excessive loss of skeletal muscle mass in older adults with type 2 diabetes. Diabetes care. 2009;32(11):1993–7. Epub 2009/06/25. doi: 10.2337/dc09-0264 19549734; PubMed Central PMCID: PMC2768193.

12. Park SW, Goodpaster BH, Strotmeyer ES, Kuller LH, Broudeau R, Kammerer C, et al. Accelerated loss of skeletal muscle strength in older adults with type 2 diabetes: the health, aging, and body composition study. Diabetes care. 2007;30(6):1507–12. Epub 2007/03/17. doi: 10.2337/dc06-2537 17363749.

13. Alcantar-Fernandez J, Navarro RE, Salazar-Martinez AM, Perez-Andrade ME, Miranda-Rios J. Caenorhabditis elegans respond to high-glucose diets through a network of stress-responsive transcription factors. PLoS One. 2018;13(7):e0199888. Epub 2018/07/11. doi: 10.1371/journal.pone.0199888 29990370; PubMed Central PMCID: PMC6039004.

14. Choi SS. High glucose diets shorten lifespan of Caenorhabditis elegans via ectopic apoptosis induction. Nutr Res Pract. 2011;5(3):214–8. Epub 2011/07/23. doi: 10.4162/nrp.2011.5.3.214 21779524; PubMed Central PMCID: PMC3133753.

15. Dobson AJ, Ezcurra M, Flanagan CE, Summerfield AC, Piper MDW, Gems D, et al. Nutritional Programming of Lifespan by FOXO Inhibition on Sugar-Rich Diets. Cell Rep. 2017;18(2):299–306. Epub 2017/01/12. doi: 10.1016/j.celrep.2016.12.029 28076775; PubMed Central PMCID: PMC5263231.

16. Lee SJ, Murphy CT, Kenyon C. Glucose shortens the life span of C. elegans by downregulating DAF-16/FOXO activity and aquaporin gene expression. Cell Metab. 2009;10(5):379–91. Epub 2009/11/04. doi: 10.1016/j.cmet.2009.10.003 19883616; PubMed Central PMCID: PMC2887095.

17. Marcellino BK, Ekasumara N, Mobbs CV. Dietary Restriction and Glycolytic Inhibition Reduce Proteotoxicity and Extend Lifespan via NHR-49. Curr Neurobiol. 2018;9(1):1–7. Epub 2019/03/02. 30820135; PubMed Central PMCID: PMC6390974.

18. Schlotterer A, Kukudov G, Bozorgmehr F, Hutter H, Du X, Oikonomou D, et al. C. elegans as model for the study of high glucose -⁠ mediated life span reduction. Diabetes. 2009;58(11):2450–6. Epub 2009/08/14. doi: 10.2337/db09-0567 19675139; PubMed Central PMCID: PMC2768179.

19. Schulz TJ, Zarse K, Voigt A, Urban N, Birringer M, Ristow M. Glucose restriction extends Caenorhabditis elegans life span by inducing mitochondrial respiration and increasing oxidative stress. Cell Metab. 2007;6(4):280–93. Epub 2007/10/03. doi: 10.1016/j.cmet.2007.08.011 17908557.

20. Seo Y, Kingsley S, Walker G, Mondoux MA, Tissenbaum HA. Metabolic shift from glycogen to trehalose promotes lifespan and healthspan in Caenorhabditis elegans. Proc Natl Acad Sci U S A. 2018;115(12):E2791–E800. Epub 2018/03/08. doi: 10.1073/pnas.1714178115 29511104; PubMed Central PMCID: PMC5866546.

21. Friedman DB, Johnson TE. A mutation in the age-1 gene in Caenorhabditis elegans lengthens life and reduces hermaphrodite fertility. Genetics. 1988;118(1):75–86. Epub 1988/01/01. 8608934; PubMed Central PMCID: PMC1203268.

22. Hsu AL, Murphy CT, Kenyon C. Regulation of aging and age-related disease by DAF-16 and heat-shock factor. Science. 2003;300(5622):1142–5. Epub 2003/05/17. doi: 10.1126/science.1083701 12750521.

23. Kenyon C, Chang J, Gensch E, Rudner A, Tabtiang R. A C. elegans mutant that lives twice as long as wild type. Nature. 1993;366(6454):461–4. Epub 1993/12/02. doi: 10.1038/366461a0 8247153.

24. Kimura KD, Tissenbaum HA, Liu Y, Ruvkun G. daf-2, an insulin receptor-like gene that regulates longevity and diapause in Caenorhabditis elegans. Science. 1997;277(5328):942–6. Epub 1997/08/15. doi: 10.1126/science.277.5328.942 9252323.

25. Lin K, Dorman JB, Rodan A, Kenyon C. daf-16: An HNF-3/forkhead family member that can function to double the life-span of Caenorhabditis elegans. Science. 1997;278(5341):1319–22. Epub 1997/11/21. doi: 10.1126/science.278.5341.1319 9360933.

26. Morris JZ, Tissenbaum HA, Ruvkun G. A phosphatidylinositol-3-OH kinase family member regulating longevity and diapause in Caenorhabditis elegans. Nature. 1996;382(6591):536–9. Epub 1996/08/08. doi: 10.1038/382536a0 8700226.

27. Tullet JM, Hertweck M, An JH, Baker J, Hwang JY, Liu S, et al. Direct inhibition of the longevity-promoting factor SKN-1 by insulin-like signaling in C. elegans. Cell. 2008;132(6):1025–38. Epub 2008/03/25. doi: 10.1016/j.cell.2008.01.030 18358814; PubMed Central PMCID: PMC2367249.

28. Vowels JJ, Thomas JH. Genetic analysis of chemosensory control of dauer formation in Caenorhabditis elegans. Genetics. 1992;130(1):105–23. Epub 1992/01/01. 1732156; PubMed Central PMCID: PMC1204785.

29. Priebe S, Menzel U, Zarse K, Groth M, Platzer M, Ristow M, et al. Extension of life span by impaired glucose metabolism in Caenorhabditis elegans is accompanied by structural rearrangements of the transcriptomic network. PLoS One. 2013;8(10):e77776. Epub 2013/11/10. doi: 10.1371/journal.pone.0077776 24204961; PubMed Central PMCID: PMC3813781.

30. Lee CK, Allison DB, Brand J, Weindruch R, Prolla TA. Transcriptional profiles associated with aging and middle age-onset caloric restriction in mouse hearts. Proc Natl Acad Sci U S A. 2002;99(23):14988–93. Epub 2002/11/07. doi: 10.1073/pnas.232308999 12419851; PubMed Central PMCID: PMC137532.

31. Masoro EJ, McCarter RJ, Katz MS, McMahan CA. Dietary restriction alters characteristics of glucose fuel use. J Gerontol. 1992;47(6):B202–8. Epub 1992/11/01. doi: 10.1093/geronj/47.6.b202 1430849.

32. Mobbs CV, Mastaitis JW, Zhang M, Isoda F, Cheng H, Yen K. Secrets of the lac operon. Glucose hysteresis as a mechanism in dietary restriction, aging and disease. Interdiscip Top Gerontol. 2007;35 : 39–68. Epub 2006/10/26. doi: 10.1159/000096555 17063032; PubMed Central PMCID: PMC2755292.

33. Bishop NA, Guarente L. Two neurons mediate diet-restriction-induced longevity in C. elegans. Nature. 2007;447(7144):545–9. Epub 2007/06/01. doi: 10.1038/nature05904 17538612.

34. Greer EL, Brunet A. Different dietary restriction regimens extend lifespan by both independent and overlapping genetic pathways in C. elegans. Aging Cell. 2009;8(2):113–27. Epub 2009/02/26. doi: 10.1111/j.1474-9726.2009.00459.x 19239417; PubMed Central PMCID: PMC2680339.

35. Greer EL, Dowlatshahi D, Banko MR, Villen J, Hoang K, Blanchard D, et al. An AMPK-FOXO pathway mediates longevity induced by a novel method of dietary restriction in C. elegans. Curr Biol. 2007;17(19):1646–56. Epub 2007/09/29. doi: 10.1016/j.cub.2007.08.047 17900900; PubMed Central PMCID: PMC2185793.

36. Houthoofd K, Braeckman BP, Johnson TE, Vanfleteren JR. Life extension via dietary restriction is independent of the Ins/IGF-1 signalling pathway in Caenorhabditis elegans. Exp Gerontol. 2003;38(9):947–54. Epub 2003/09/05. doi: 10.1016/s0531-5565(03)00161-x 12954481.

37. Kaeberlein TL, Smith ED, Tsuchiya M, Welton KL, Thomas JH, Fields S, et al. Lifespan extension in Caenorhabditis elegans by complete removal of food. Aging Cell. 2006;5(6):487–94. Epub 2006/11/04. doi: 10.1111/j.1474-9726.2006.00238.x 17081160.

38. Lakowski B, Hekimi S. The genetics of caloric restriction in Caenorhabditis elegans. Proc Natl Acad Sci U S A. 1998;95(22):13091–6. Epub 1998/10/28. doi: 10.1073/pnas.95.22.13091 9789046; PubMed Central PMCID: PMC23719.

39. Lee GD, Wilson MA, Zhu M, Wolkow CA, de Cabo R, Ingram DK, et al. Dietary deprivation extends lifespan in Caenorhabditis elegans. Aging Cell. 2006;5(6):515–24. Epub 2006/11/14. doi: 10.1111/j.1474-9726.2006.00241.x 17096674; PubMed Central PMCID: PMC2546582.

40. Masoro EJ. Overview of caloric restriction and ageing. Mech Ageing Dev. 2005;126(9):913–22. Epub 2005/05/12. doi: 10.1016/j.mad.2005.03.012 15885745.

41. Onken B, Driscoll M. Metformin induces a dietary restriction-like state and the oxidative stress response to extend C. elegans Healthspan via AMPK, LKB1, and SKN-1. PLoS One. 2010;5(1):e8758. Epub 2010/01/22. doi: 10.1371/journal.pone.0008758 20090912; PubMed Central PMCID: PMC2807458.

42. Panowski SH, Wolff S, Aguilaniu H, Durieux J, Dillin A. PHA-4/Foxa mediates diet-restriction-induced longevity of C. elegans. Nature. 2007;447(7144):550–5. Epub 2007/05/04. doi: 10.1038/nature05837 17476212.

43. Walker G, Houthoofd K, Vanfleteren JR, Gems D. Dietary restriction in C. elegans: from rate-of-living effects to nutrient sensing pathways. Mech Ageing Dev. 2005;126(9):929–37. Epub 2005/05/18. doi: 10.1016/j.mad.2005.03.014 15896824.

44. Glenn CF, Chow DK, David L, Cooke CA, Gami MS, Iser WB, et al. Behavioral deficits during early stages of aging in Caenorhabditis elegans result from locomotory deficits possibly linked to muscle frailty. The journals of gerontology Series A, Biological sciences and medical sciences. 2004;59(12):1251–60. Epub 2005/02/09. doi: 10.1093/gerona/59.12.1251 15699524; PubMed Central PMCID: PMC1458366.

45. Herndon LA, Schmeissner PJ, Dudaronek JM, Brown PA, Listner KM, Sakano Y, et al. Stochastic and genetic factors influence tissue-specific decline in ageing C. elegans. Nature. 2002;419(6909):808–14. Epub 2002/10/25. doi: 10.1038/nature01135 12397350.

46. Liu J, Zhang B, Lei H, Feng Z, Liu J, Hsu AL, et al. Functional aging in the nervous system contributes to age-dependent motor activity decline in C. elegans. Cell Metab. 2013;18(3):392–402. Epub 2013/09/10. doi: 10.1016/j.cmet.2013.08.007 24011074; PubMed Central PMCID: PMC3811915.

47. Toth ML, Melentijevic I, Shah L, Bhatia A, Lu K, Talwar A, et al. Neurite sprouting and synapse deterioration in the aging Caenorhabditis elegans nervous system. J Neurosci. 2012;32(26):8778–90. Epub 2012/06/30. doi: 10.1523/JNEUROSCI.1494-11.2012 22745480; PubMed Central PMCID: PMC3427745.

48. Chow DK, Glenn CF, Johnston JL, Goldberg IG, Wolkow CA. Sarcopenia in the Caenorhabditis elegans pharynx correlates with muscle contraction rate over lifespan. Exp Gerontol. 2006;41(3):252–60. Epub 2006/02/01. doi: 10.1016/j.exger.2005.12.004 16446070; PubMed Central PMCID: PMC2553216.

49. Evason K, Huang C, Yamben I, Covey DF, Kornfeld K. Anticonvulsant medications extend worm life-span. Science. 2005;307(5707):258–62. Epub 2005/01/18. doi: 10.1126/science.1105299 15653505.

50. Laranjeiro R, Harinath G, Burke D, Braeckman BP, Driscoll M. Single swim sessions in C. elegans induce key features of mammalian exercise. BMC biology. 2017;15(1):30. Epub 2017/04/12. doi: 10.1186/s12915-017-0368-4 28395669; PubMed Central PMCID: PMC5385602.

51. Laranjeiro R, Harinath G, Hewitt JE, Hartman JH, Royal MA, Meyer JN, et al. Swim exercise in Caenorhabditis elegans extends neuromuscular and gut healthspan, enhances learning ability, and protects against neurodegeneration. Proc Natl Acad Sci U S A. 2019;116(47):23829–39. Epub 2019/11/07. doi: 10.1073/pnas.1909210116 31685639; PubMed Central PMCID: PMC6876156.

52. Lee D, Jeong DE, Son HG, Yamaoka Y, Kim H, Seo K, et al. SREBP and MDT-15 protect C. elegans from glucose-induced accelerated aging by preventing accumulation of saturated fat. Genes Dev. 2015;29(23):2490–503. Epub 2015/12/08. doi: 10.1101/gad.266304.115 26637528; PubMed Central PMCID: PMC4691952.

53. Hayward RA, Reaven PD, Emanuele NV, Investigators V. Follow-up of Glycemic Control and Cardiovascular Outcomes in Type 2 Diabetes. The New England journal of medicine. 2015;373(10):978. Epub 2015/09/04. doi: 10.1056/NEJMc1508386 26332555.

54. Bansal A, Zhu LJ, Yen K, Tissenbaum HA. Uncoupling lifespan and healthspan in Caenorhabditis elegans longevity mutants. Proc Natl Acad Sci U S A. 2015;112(3):E277–86. Epub 2015/01/07. doi: 10.1073/pnas.1412192112 25561524; PubMed Central PMCID: PMC4311797.

55. Furuyama T, Nakazawa T, Nakano I, Mori N. Identification of the differential distribution patterns of mRNAs and consensus binding sequences for mouse DAF-16 homologues. Biochem J. 2000;349(Pt 2):629–34. Epub 2000/07/06. doi: 10.1042/0264-6021 : 3490629 10880363; PubMed Central PMCID: PMC1221187.

56. Honda Y, Honda S. The daf-2 gene network for longevity regulates oxidative stress resistance and Mn-superoxide dismutase gene expression in Caenorhabditis elegans. FASEB journal: official publication of the Federation of American Societies for Experimental Biology. 1999;13(11):1385–93. Epub 1999/07/31. 10428762.

57. Yang J, Kalhan SC, Hanson RW. What is the metabolic role of phosphoenolpyruvate carboxykinase? J Biol Chem. 2009;284(40):27025–9. Epub 2009/07/29. doi: 10.1074/jbc.R109.040543 19636077; PubMed Central PMCID: PMC2785631.

58. Hakimi P, Yang J, Casadesus G, Massillon D, Tolentino-Silva F, Nye CK, et al. Overexpression of the cytosolic form of phosphoenolpyruvate carboxykinase (GTP) in skeletal muscle repatterns energy metabolism in the mouse. J Biol Chem. 2007;282(45):32844–55. Epub 2007/08/25. doi: 10.1074/jbc.M706127200 17716967; PubMed Central PMCID: PMC4484620.

59. Yuan Y, Kadiyala CS, Ching TT, Hakimi P, Saha S, Xu H, et al. Enhanced energy metabolism contributes to the extended life span of calorie-restricted Caenorhabditis elegans. J Biol Chem. 2012;287(37):31414–26. Epub 2012/07/20. doi: 10.1074/jbc.M112.377275 22810224; PubMed Central PMCID: PMC3438970.

60. van Schaftingen E, Gerin I. The glucose-6-phosphatase system. Biochem J. 2002;362(Pt 3):513–32. Epub 2002/03/07. doi: 10.1042/0264-6021 : 3620513 11879177; PubMed Central PMCID: PMC1222414.

61. Wang J, Kim SK. Global analysis of dauer gene expression in Caenorhabditis elegans. Development. 2003;130(8):1621–34. Epub 2003/03/07. doi: 10.1242/dev.00363 12620986.

62. Halaschek-Wiener J, Khattra JS, McKay S, Pouzyrev A, Stott JM, Yang GS, et al. Analysis of long-lived C. elegans daf-2 mutants using serial analysis of gene expression. Genome research. 2005;15(5):603–15. Epub 2005/04/20. doi: 10.1101/gr.3274805 15837805; PubMed Central PMCID: PMC1088289.

63. Murphy CT, McCarroll SA, Bargmann CI, Fraser A, Kamath RS, Ahringer J, et al. Genes that act downstream of DAF-16 to influence the lifespan of Caenorhabditis elegans. Nature. 2003;424(6946):277–83. Epub 2003/07/08. doi: 10.1038/nature01789 12845331.

64. Gerstbrein B, Stamatas G, Kollias N, Driscoll M. In vivo spectrofluorimetry reveals endogenous biomarkers that report healthspan and dietary restriction in Caenorhabditis elegans. Aging Cell. 2005;4(3):127–37. Epub 2005/06/01. doi: 10.1111/j.1474-9726.2005.00153.x 15924569.

65. Zhang M, Poplawski M, Yen K, Cheng H, Bloss E, Zhu X, et al. Role of CBP and SATB-1 in aging, dietary restriction, and insulin-like signaling. PLoS Biol. 2009;7(11):e1000245. Epub 2009/11/20. doi: 10.1371/journal.pbio.1000245 19924292; PubMed Central PMCID: PMC2774267.

66. Akasaki Y, Ouchi N, Izumiya Y, Bernardo BL, Lebrasseur NK, Walsh K. Glycolytic fast-twitch muscle fiber restoration counters adverse age-related changes in body composition and metabolism. Aging Cell. 2014;13(1):80–91. Epub 2013/09/17. doi: 10.1111/acel.12153 24033924; PubMed Central PMCID: PMC3947044.

67. Liggett MR, Hoy MJ, Mastroianni M, Mondoux MA. High-glucose diets have sex-specific effects on aging in C. elegans: toxic to hermaphrodites but beneficial to males. Aging (Albany NY). 2015;7(6):383–8. Epub 2015/07/06. doi: 10.18632/aging.100759 26143626; PubMed Central PMCID: PMC4505165.

68. Pappachan JM, Varughese GI, Sriraman R, Arunagirinathan G. Diabetic cardiomyopathy: Pathophysiology, diagnostic evaluation and management. World J Diabetes. 2013;4(5):177–89. Epub 2013/10/23. doi: 10.4239/wjd.v4.i5.177 24147202; PubMed Central PMCID: PMC3797883.

69. Cetrone M, Mele A, Tricarico D. Effects of the antidiabetic drugs on the age-related atrophy and sarcopenia associated with diabetes type II. Curr Diabetes Rev. 2014;10(4):231–7. Epub 2014/09/24. doi: 10.2174/1573399810666140918121022 25245021.

70. Schuster E, McElwee JJ, Tullet JM, Doonan R, Matthijssens F, Reece-Hoyes JS, et al. DamID in C. elegans reveals longevity-associated targets of DAF-16/FoxO. Mol Syst Biol. 2010;6 : 399. Epub 2010/08/14. doi: 10.1038/msb.2010.54 20706209; PubMed Central PMCID: PMC2950082.

71. Oh KJ, Han HS, Kim MJ, Koo SH. CREB and FoxO1: two transcription factors for the regulation of hepatic gluconeogenesis. BMB Rep. 2013;46(12):567–74. Epub 2013/11/19. doi: 10.5483/bmbrep.2013.46.12.248 24238363; PubMed Central PMCID: PMC4133859.

72. Salih DA, Brunet A. FoxO transcription factors in the maintenance of cellular homeostasis during aging. Curr Opin Cell Biol. 2008;20(2):126–36. Epub 2008/04/09. doi: 10.1016/j.ceb.2008.02.005 18394876; PubMed Central PMCID: PMC2387118.

73. Yuan Y, Hakimi P, Kao C, Kao A, Liu R, Janocha A, et al. Reciprocal Changes in Phosphoenolpyruvate Carboxykinase and Pyruvate Kinase with Age Are a Determinant of Aging in Caenorhabditis elegans. J Biol Chem. 2016;291(3):1307–19. Epub 2015/12/04. doi: 10.1074/jbc.M115.691766 26631730; PubMed Central PMCID: PMC4714217.

74. Libina N, Berman JR, Kenyon C. Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell. 2003;115(4):489–502. Epub 2003/11/19. doi: 10.1016/s0092-8674(03)00889-4 14622602.

75. Murphy CT, Lee SJ, Kenyon C. Tissue entrainment by feedback regulation of insulin gene expression in the endoderm of Caenorhabditis elegans. Proc Natl Acad Sci U S A. 2007;104(48):19046–50. Epub 2007/11/21. doi: 10.1073/pnas.0709613104 18025456; PubMed Central PMCID: PMC2141905.

76. Giannakou ME, Goss M, Junger MA, Hafen E, Leevers SJ, Partridge L. Long-lived Drosophila with overexpressed dFOXO in adult fat body. Science. 2004;305(5682):361. Epub 2004/06/12. doi: 10.1126/science.1098219 15192154.

77. Hwangbo DS, Gershman B, Tu MP, Palmer M, Tatar M. Drosophila dFOXO controls lifespan and regulates insulin signalling in brain and fat body. Nature. 2004;429(6991):562–6. Epub 2004/06/04. doi: 10.1038/nature02549 15175753.

78. Giannakou ME, Goss M, Jacobson J, Vinti G, Leevers SJ, Partridge L. Dynamics of the action of dFOXO on adult mortality in Drosophila. Aging Cell. 2007;6(4):429–38. Epub 2007/05/01. doi: 10.1111/j.1474-9726.2007.00290.x 17465980.

79. Webb AE, Kundaje A, Brunet A. Characterization of the direct targets of FOXO transcription factors throughout evolution. Aging Cell. 2016;15(4):673–85. Epub 2016/04/12. doi: 10.1111/acel.12479 27061590; PubMed Central PMCID: PMC4933671.

80. Vora M, Shah M, Ostafi S, Onken B, Xue J, Ni JZ, et al. Deletion of microRNA-80 activates dietary restriction to extend C. elegans healthspan and lifespan. PLoS Genet. 2013;9(8):e1003737. Epub 2013/09/07. doi: 10.1371/journal.pgen.1003737 24009527; PubMed Central PMCID: PMC3757059.

81. Hibshman JD, Doan AE, Moore BT, Kaplan RE, Hung A, Webster AK, et al. daf-16/FoxO promotes gluconeogenesis and trehalose synthesis during starvation to support survival. Elife. 2017;6. Epub 2017/10/25. doi: 10.7554/eLife.30057 29063832; PubMed Central PMCID: PMC5655125.

82. Gusarov I, Pani B, Gautier L, Smolentseva O, Eremina S, Shamovsky I, et al. Glycogen controls Caenorhabditis elegans lifespan and resistance to oxidative stress. Nature communications. 2017;8 : 15868. Epub 2017/06/20. doi: 10.1038/ncomms15868 28627510; PubMed Central PMCID: PMC5481799.

83. Fuchs S, Bundy JG, Davies SK, Viney JM, Swire JS, Leroi AM. A metabolic signature of long life in Caenorhabditis elegans. BMC biology. 2010;8 : 14. Epub 2010/02/12. doi: 10.1186/1741-7007-8-14 20146810; PubMed Central PMCID: PMC2829508.

84. McElwee JJ, Schuster E, Blanc E, Thornton J, Gems D. Diapause-associated metabolic traits reiterated in long-lived daf-2 mutants in the nematode Caenorhabditis elegans. Mech Ageing Dev. 2006;127(5):458–72. Epub 2006/03/09. doi: 10.1016/j.mad.2006.01.006 16522328.

85. Bujak AL, Crane JD, Lally JS, Ford RJ, Kang SJ, Rebalka IA, et al. AMPK activation of muscle autophagy prevents fasting-induced hypoglycemia and myopathy during aging. Cell Metab. 2015;21(6):883–90. Epub 2015/06/04. doi: 10.1016/j.cmet.2015.05.016 26039451; PubMed Central PMCID: PMC5233441.

86. Hansen M, Chandra A, Mitic LL, Onken B, Driscoll M, Kenyon C. A role for autophagy in the extension of lifespan by dietary restriction in C. elegans. PLoS Genet. 2008;4(2):e24. Epub 2008/02/20. doi: 10.1371/journal.pgen.0040024 18282106; PubMed Central PMCID: PMC2242811.

87. Orlandi I, Stamerra G, Vai M. Altered Expression of Mitochondrial NAD(+) Carriers Influences Yeast Chronological Lifespan by Modulating Cytosolic and Mitochondrial Metabolism. Front Genet. 2018;9 : 676. Epub 2019/01/09. doi: 10.3389/fgene.2018.00676 30619489; PubMed Central PMCID: PMC6305841.

88. Post S, Karashchuk G, Wade JD, Sajid W, De Meyts P, Tatar M. Drosophila Insulin-Like Peptides DILP2 and DILP5 Differentially Stimulate Cell Signaling and Glycogen Phosphorylase to Regulate Longevity. Front Endocrinol (Lausanne). 2018;9 : 245. Epub 2018/06/13. doi: 10.3389/fendo.2018.00245 29892262; PubMed Central PMCID: PMC5985746.

89. Vall-Llaura N, Mir N, Garrido L, Vived C, Cabiscol E. Redox control of yeast Sir2 activity is involved in acetic acid resistance and longevity. Redox Biol. 2019;24 : 101229. Epub 2019/06/04. doi: 10.1016/j.redox.2019.101229 31153040; PubMed Central PMCID: PMC6543126.

90. Budovskaya YV, Wu K, Southworth LK, Jiang M, Tedesco P, Johnson TE, et al. An elt-3/elt-5/elt-6 GATA transcription circuit guides aging in C. elegans. Cell. 2008;134(2):291–303. Epub 2008/07/30. doi: 10.1016/j.cell.2008.05.044 18662544; PubMed Central PMCID: PMC4719053.

91. Kashyap L, Perera S, Fisher AL. Identification of novel genes involved in sarcopenia through RNAi screening in Caenorhabditis elegans. The journals of gerontology Series A, Biological sciences and medical sciences. 2012;67(1):56–65. Epub 2011/05/20. doi: 10.1093/gerona/glr072 21593014; PubMed Central PMCID: PMC3260486.

92. Restif C, Ibanez-Ventoso C, Vora MM, Guo S, Metaxas D, Driscoll M. CeleST: computer vision software for quantitative analysis of C. elegans swim behavior reveals novel features of locomotion. PLoS Comput Biol. 2014;10(7):e1003702. Epub 2014/07/18. doi: 10.1371/journal.pcbi.1003702 25033081; PubMed Central PMCID: PMC4102393.

93. Brenner S. The genetics of Caenorhabditis elegans. Genetics. 1974;77(1):71–94. Epub 1974/05/01. 4366476; PubMed Central PMCID: PMC1213120.

94. Kamath RS, Ahringer J. Genome-wide RNAi screening in Caenorhabditis elegans. Methods. 2003;30(4):313–21. Epub 2003/06/28. doi: 10.1016/s1046-2023(03)00050-1 12828945.

95. Kamath RS, Fraser AG, Dong Y, Poulin G, Durbin R, Gotta M, et al. Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature. 2003;421(6920):231–7. Epub 2003/01/17. doi: 10.1038/nature01278 12529635.

96. Pinan-Lucarre B, Gabel CV, Reina CP, Hulme SE, Shevkoplyas SS, Slone RD, et al. The core apoptotic executioner proteins CED-3 and CED-4 promote initiation of neuronal regeneration in Caenorhabditis elegans. PLoS Biol. 2012;10(5):e1001331. Epub 2012/05/26. doi: 10.1371/journal.pbio.1001331 22629231; PubMed Central PMCID: PMC3358320.

97. Rosenbluth RE, Cuddeford C, Baillie DL. Mutagenesis in Caenorhabditis elegans. II. A spectrum of mutational events induced with 1500 r of gamma-radiation. Genetics. 1985;109(3):493–511. Epub 1985/03/01. 3979812; PubMed Central PMCID: PMC1216284.

98. Zhang Y, Chen D, Smith MA, Zhang B, Pan X. Selection of reliable reference genes in Caenorhabditis elegans for analysis of nanotoxicity. PLoS One. 2012;7(3):e31849. Epub 2012/03/23. doi: 10.1371/journal.pone.0031849 22438870; PubMed Central PMCID: PMC3305280.

99. Friedman DB, Johnson TE. Three mutants that extend both mean and maximum life span of the nematode, Caenorhabditis elegans, define the age-1 gene. J Gerontol. 1988;43(4):B102–9. Epub 1988/07/01. doi: 10.1093/geronj/43.4.b102 3385139.

100. Sutphin GL, Kaeberlein M. Dietary restriction by bacterial deprivation increases life span in wild-derived nematodes. Exp Gerontol. 2008;43(3):130–5. Epub 2007/12/18. doi: 10.1016/j.exger.2007.10.019 18083317.


Článek vyšel v časopise

PLOS Genetics


2020 Číslo 8
Nejčtenější tento týden
Nejčtenější v tomto čísle
Kurzy

Zvyšte si kvalifikaci online z pohodlí domova

Mazová zátka a její řešení
nový kurz

Svět praktické medicíny 2/2026 (znalostní test z časopisu)

Citikolin v neuroprotekci a neuroregeneraci – nové poznatky
Autoři: MUDr. Petr Výborný, CSc., FEBO

Revma Focus: Spondyloartritidy

Denzitometrie v praxi: od kvalitního snímku po správnou interpretaci
Autoři: prof. MUDr. Vladimír Palička, CSc., Dr.h.c., doc. MUDr. Václav Vyskočil, Ph.D., MUDr. Petr Kasalický, CSc., MUDr. Jan Rosa, Ing. Pavel Havlík, Ing. Jan Adam, Hana Hejnová, DiS., Jana Křenková

Všechny kurzy
Přihlášení
Zapomenuté heslo

Zadejte e-mailovou adresu, se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.

Přihlášení

Nemáte účet?  Registrujte se

#ADS_BOTTOM_SCRIPTS#