Translesion synthesis polymerases are dispensable for C. elegans reproduction but suppress genome scarring by polymerase theta-mediated end joining
Authors:
Ivo van Bostelen aff001; Robin van Schendel aff001; Ron Romeijn aff001; Marcel Tijsterman aff001
Authors place of work:
Department of Human Genetics, Leiden University Medical Center, Leiden, The Netherlands
aff001; Institute of Biology Leiden, Leiden University, Leiden, the Netherlands
aff002
Published in the journal:
Translesion synthesis polymerases are dispensable for C. elegans reproduction but suppress genome scarring by polymerase theta-mediated end joining. PLoS Genet 16(4): e32767. doi:10.1371/journal.pgen.1008759
Category:
Research Article
doi:
https://doi.org/10.1371/journal.pgen.1008759
Summary
Bases within DNA are frequently damaged, producing obstacles to efficient and accurate DNA replication by replicative polymerases. Translesion synthesis (TLS) polymerases, via their ability to catalyze nucleotide additions to growing DNA chains across DNA lesions, promote replication of damaged DNA, thus preventing checkpoint activation, genome instability and cell death. In this study, we used C. elegans to determine the contribution of TLS activity on long-term stability of an animal genome. We monitored and compared the types of mutations that accumulate in REV1, REV3, POLH1 and POLK deficient animals that were grown under unchallenged conditions. We also addressed redundancies in TLS activity by combining all deficiencies. Remarkably, animals that are deficient for all Y-family polymerases as well as animals that have lost all TLS activity are viable and produce progeny, demonstrating that TLS is not essential for animal life. Whole genome sequencing analyses, however, reveal that TLS is needed to prevent genomic scars from accumulating. These scars, which are the product of polymerase theta-mediated end joining (TMEJ), are found overrepresented at guanine bases, consistent with TLS suppressing DNA double-strand breaks (DSBs) from occurring at replication-blocking guanine adducts. We found that in C. elegans, TLS across spontaneous damage is predominantly error free and anti-clastogenic, and thus ensures preservation of genetic information.
Keywords:
DNA replication – Mutation – Caenorhabditis elegans – Animal genomics – Mutagenesis – DNA damage – Invertebrate genomics – Polymerases
Introduction
Although mutagenesis is a prerequisite for evolution, mutations are also life threatening as they are at the basis of inborn diseases and age-related pathologies such as cancer. To sustain genetic integrity several mechanisms have evolved that restrict the level of mutation induction. For example, during DNA replication, the combined action of proofreading activity of the replicative polymerases and the mismatch repair pathway provides an estimated 10.000-fold increase in copying accuracy [1,2]. Apart from errors during replication of non-damaged DNA, mutations can also result from incorporation of nucleotides across damaged bases that are caused by exogenous sources or endogenous processes within the cell. For example, oxidative metabolites can react with DNA, which then hampers DNA replication [3]. Efficient and unperturbed DNA synthesis is nevertheless essential for maintaining genetic integrity because persistent replication impairment can lead to under-replicated areas of the genome, and the formation of highly toxic DNA double-strand breaks (DSBs) that may result in genomic rearrangements or cell death. Such detrimental outcomes are profoundly suppressed by the action of the excision repair pathways base excision repair (BER) and nucleotide excision repair (NER), which can replace the damaged bases, thereby preventing these from becoming replication obstacles [3,4]. DNA damage can, however, also be bypassed through so-called DNA damage tolerance pathways, in which lesions are left unrepaired, yet replication of the genome is completed, hence ensuring cell cycle progression [5]. A well-studied mechanism to tolerate DNA damage is translesion synthesis (TLS). Despite the potential of replicative polymerases to bypass certain DNA lesions (e.g. [6]) they are blocked by a plethora of damaged bases, and specialized TLS polymerases are required to synthesize DNA opposite these impediments. Lesions can be bypassed directly when the replicative polymerase is temporarily exchanged for a TLS polymerase at the replication fork during S-phase, or, alternatively, single-strand DNA gaps temporarily remain at the site of base damage and bypass and gap filling occurs after S-phase completion [7, and references therein].
In eukaryotes TLS is mediated by Y-family polymerases Polη, Polκ, Polι and Rev1 and the B-family polymerase Polζ, the latter containing a catalytic subunit, Rev3, a regulatory subunit, Rev7 [8,9], as well as accessory subunits [10–12]. These TLS polymerases lack proofreading activity and have wide catalytic centers to allow for replication across damaged bases and DNA synthesis from misaligned primer termini. These characteristics cause TLS polymerases to have lower fidelity than replicative polymerases, making them inherently error prone. Whereas some types of lesions require only a specific Y-family polymerase, other types require the sequential action of two or more TLS polymerases [13–15].
While the molecular details of TLS have become better understood it remains unclear how TLS action affects genome maintenance or influences spontaneous mutagenesis either positively or negatively, on a genome-wide scale and in time. The model system C. elegans is well suited to address these questions for multicellular organisms, because of a condensed genome and the ability for clonal propagation, which makes whole genome sequencing (WGS) practical. In previous studies we have described how C. elegans Y-family polymerases Polη and Polκ contribute to genomic stability [16–18]. Here, we investigate the contribution of REV1 and REV3 in suppressing genome alterations, and we address the redundancy between the different TLS enzymes by monitoring mutation accumulation in animals that lack either all C. elegans Y-family polymerases or all TLS activity. Our study presents the most comprehensive analysis of how TLS activity affects the stability of a genome under non-challenged circumstances.
Results
Generation and characterization of rev-1 alleles
To study the role of REV-1 in the maintenance of genomic stability we analyzed several mutant alleles: rev-1(gk455794) was generated by the million mutation project [19] and has a point mutation in the acceptor splice site of exon 7, and two early stop alleles were obtained through targeting exon 2 via CRISPR/Cas-9 technology (S1 Fig). We also isolated an allele (named rev-1BRCT) containing a G283>D amino acid substitution in the evolutionarily conserved BRCT domain. G283 of C. elegans REV-1 aligns to G193 of yeast REV1 and G76 of mice Rev1, which in those species are essential for the functionality of the BRCT domain [20–22].
All rev-1 mutant strains had brood sizes and embryonic survival frequencies comparable to wild-type controls (Fig 1A and Fig 1B), demonstrating that REV-1 is not essential for animal development and fertility under unchallenged conditions. However, similar to REV1 deficient yeast and mES cells [23–25], REV-1 deficiency in C. elegans confers hypersensitivity to UV-induced DNA lesions, which manifests as reduced embryonic survival (as compared to wild-type controls) when hermaphrodites are exposed to UV-C (Fig 1C). While a similar degree of hypersensitivity is noticed for the three putative knockout alleles, the rev-1BRCT allele confers an intermediate phenotype consistent with a partial loss of functionality. This evolutionary conserved UV-hypersensitivity of REV1 deficiency is less dramatic than observed for C. elegans mutants defective in Polη, another TLS polymerase implicated in the bypass of UV-induced damage [16,26].
REV-1 suppresses the formation of genomic deletions and rearrangements
When TLS is impaired, replication forks can collapse at sites of base damage and form DSBs. In the mitotic compartment of the C. elegans gonad, recombinogenic DNA substrates can be visualized by staining for the recombinase RAD-51, which forms foci. While such foci are not found in wild-type animals, both rev-1(gk455794) as well as rev-1BRCT animals had a very small, yet statistically significant number of nuclei in the mitotic zone containing a RAD-51 focus (Fig 1D and Fig 1E). To address potential mutagenic consequences of elevated levels of replication stress or DNA breaks, as suggested by increased RAD-51 foci formation, we assayed mutation induction in rev-1 mutants. We first used the phenotype-based unc-93 reversion assay [27,28]: animals carrying the toxic unc-93(e1500) allele have a very poor capacity to move and also grow slower. However, any additional mutation in unc-93 leading to complete loss of function will lead to reversion of these phenotypes. Loss of function mutations in the suppressor genes sup-9, sup-10, sup-11 or sup-18 will also revert unc-93(e1500) animals to wild-type-resembling growth and movement. Picking wild-type-moving worms out of populations of unc-93 animals, followed by inspection of their genomes thus results in a mutation profile. To establish such profiles, we isolated 30 revertants for each genotype and subsequently sequenced the unc-93 locus. In WT, rev-1BRCT and rev-1(gk455794) animals we respectively found 7, 14, and 14 causative mutations in unc-93(e1500) (Fig 1F); the remaining revertant animals likely carry mutations in the suppressor loci, which were not further analyzed. In the WT background, 6 out of 7 mutations were single nucleotide variations (SNVs) that disrupt gene function via amino acid substitution, introduction of an early stop or loss of a splice site; one deletion of 4 bp was found. Similar base substitutions and deletions of few bases were also found in the rev-1BRCT mutant, but here, 6 of the 14 mutations were larger deletions (>50 bp). For rev-1(gk455794), all causative mutations (n = 14) were deletions >50 bp in size. From this data we conclude that REV-1 has an important role in suppressing a specific type of spontaneous mutagenesis, i.e. the formation of small genomic deletions.
Mutagenic tradeoff by REV-1 action
While the unc-93 reversion assay is an established method to study mutagenesis in C. elegans it has drawbacks. For instance, the mutational target is limited and fixed, and the only mutations that will be picked up are those that disrupt gene function, thus creating a bias: deletions are more likely to disrupt gene function than SNVs. Also, the assay conditions themselves hinder accurate quantifications of mutation rates. To overcome these shortcomings and study spontaneous mutagenesis in a predominantly unbiased and quantitative way, we performed whole-genome sequencing (WGS) of wild-type and rev-1 mutant animals that were clonally grown for multiple generations (Fig 2A and S1 Table; S2 Table). For wild-type animals we found mutation rates to be ~0.23 SNVs, ~0.04 micro-satellite indels, and ~0.04 small deletions per animal generation. While the rate for micro-satellite indels is identical in rev-1 mutant animals, the SNV rate is lowered; the SNV spectrum, however, was similar, if not identical, to that in wild-type animals (Fig 2B). Interestingly, the reduction in SNVs matched an increase in the rate of deletion formation in the >50 bp size range (Fig 2A and Fig 2C): we identified 15 cases in rev-1(gk455794) genomes and 1 in the wild-type control, constituting a changed distribution (p = 0.0032, Mann-Whitney). This outcome leads to the suggestion that base damage requiring REV-1 action is mutagenic both in the presence and absence of REV-1: when bypassed by REV-1-mediated TLS a SNV results, but in REV-1 compromised cells a deletion is the outcome. In addition to simple deletions a limited number of complex rearrangements was found in rev-1 mutant animals–these were not observed in the analyzed genomes of wild-type animals.
This mutation profile of rev-1 animals strikingly resembles the ones we previously described for strains deficient in TLS polymerases POLH-1 and POLK-1, as well as for strains defective for the helicase FANCJ/DOG-1 [17,29,30]. Deletion mutagenesis in polh-1 and polk-1 strains occur seemingly random throughout the genome, whereas deletions in dog-1 animals map to sequences that are able to fold into replication-blocking G-quadruplex structures. Deletions in rev-1 mutant genomes do not map to particular sequence motifs, despite potential indications from genetic analysis in chicken DT40 cells, which demonstrated a function for REV1 in replicating through G-quadruplex structures [31,32]. We also tested potential synergy between rev-1 and dog-1 with respect to G-quadruplex stability, but did not find any (S2 Fig).
TMEJ repairs DSBs that result from REV-1 loss
The similarity in the profile of spontaneous mutagenesis in rev-1 and polh-1 or dog-1 points to a causal involvement of polymerase theta-mediated end joining (TMEJ). TMEJ was previously shown in C. elegans to repair DSBs that arise at replication-impeding base damages or secondary structures [17,30]. Indeed, deletions accumulating in rev-1 have signature hallmarks of TMEJ: micro-homology at break sites and occasionally inserts that are homologous to sequences in the immediate vicinity of the deletion [17, 30, 33, 34]. To address potential causality with respect to TMEJ involvement we used the unc-93 reversion assay and determined the molecular nature of the mutations that spontaneously arise in animals mutated for both rev-1 and polq-1 (encoding pol theta/Polθ). We indeed found a dramatically changed mutation profile (Fig 2D). Instead of the characteristic 50-500bp size, all deletions isolated from rev-1 polq-1 populations were profoundly larger: none that mapped to the unc-93 locus retained the 2.5 kb spanning unc-93 gene; 2 of 5 being >10 kb and having lost all loci between unc-93 and the most nearby essential genes. To further asses the notion that TMEJ acts to repair failed TLS of damaged bases, we tested Polθ’s involvement in relation to UV-induced DNA lesions. While Polθ deficiency itself does not sensitize otherwise wild-type animals to UV-C, it exacerbates the hypersensitivity of rev-1 animals (Fig 2E).
We conclude that C. elegans REV-1 prevents DSB-induced deletion mutagenesis during unperturbed growth.
REV-1 independent functions of POLH-1 and POLK-1
We previously analyzed knockout alleles of polh-1 and polk-1, the genes encoding the other two Y-family polymerases present in the C. elegans genome: Polη and Polκ [16, 17]. While polh-1 mutants, like rev-1, display some spontaneous mutagenesis under non-perturbed growth, polk-1 mutant animals do not. However, the analysis of animals deficient for both genes revealed profound functional redundancy for these proteins: the marginal deletion mutagenesis observed in polh-1 mutant animals dramatically increased when also POLK-1 was lost. To investigate whether one of these two TLS polymerases, or both, also provide back-up functions in REV-1 deficient animals (or vice versa) we generated polh-1 polk-1 rev-1 triple mutant animals, which thus lack all Y-family TLS activity (the C. elegans genome does not encode Polι). Under unchallenged growth conditions, we found brood size and embryonic survival of these so-called “Y-family polymerase dead” mutants to be lower than wild-type, yet remarkably mildly affected (Fig 3A and Fig 3B). Because of this only mildly disturbed animal fitness we could grow animals for 50 generations to address mutation accumulation, and found that the mutation load in polh-1 polk-1 rev-1 mutants is very similar if not identical to that in polh-1 polk-1 mutants (Fig 3D and S1 Table; S2 Table). For comparison we also included our previously published data for polk-1 and polh-1 mutant animals, which we re-analyzed using updated software.
From the observations that REV-1 deficiency brings about only a marginal level of deletion mutagenesis, and does not further enhance the genomic instability in polh-1 polk-1 animals, we conclude that Polη and Polk redundantly act to bypass spontaneous DNA damage in C. elegans in a grosso modo error-free manner. In such manner, these polymerases do not require the action of REV-1, yet are potentially recruited to sites of DNA damage by PCNA ubiquitylation [35].
REV-1 suppresses genomic deletions through polymerase ζ
In addition to direct bypass through catalysis [36–39], REV1 also plays a non-catalytic role via interactions with other TLS proteins such as Polη and the REV7 subunit of B-family TLS polymerase Polζ [40–42]. Rev1 and Rev3 mutant cells have similar phenotypes, arguing that Rev1 is especially important for Polζ activity. To address whether the increased deletion mutagenesis in C. elegans rev-1 mutants is a consequence of Polζ disfunction, we analyzed rev-3 mutant animals. A putative null allele, rev-3(gk919715), generated by the million mutation project, contains a nonsense mutation in exon 3 producing an early stop N-terminal of all relevant functional domains. (S1 Fig). Subsequent to extensive backcrosses in order to remove background mutations, we measured a reduced brood size, but no embryonic lethality for rev-3(gk919715) (Fig 3A and Fig 3B). To validate a TLS deficiency in this genetic background, we exposed hermaphrodites to UV-C, and found hypersensitivity of progeny embryos comparable to the hypersensitivity observed for rev-1 mutants (Fig 3C). Animals deficient for both REV-1 and REV-3 are as sensitive as either single mutant indicating no role for REV-1 outside Pol ζ in bypass of UV-induced damage. We next grew multiple rev-3 mutant lines clonally for 50 generations after which their genomes were sequenced (S1 Table; S2 Table). We found that SNVs and indels at microsatellite repeats accumulate at the same rate in REV-3 proficient and deficient animals (Fig 3D), arguing that REV-3-dependent TLS on spontaneous lesions does not cause substantial numbers of point mutations or that backup mechanisms are equally or more mutagenic. However, and similar to the genomes of clonally propagated rev-1 mutant animals, a clear increase can be detected for deletions of size 50-500bp. This category of mutations, the product of TMEJ action on DNA breaks, are thus observed in all animals with compromised TLS, i.e. polh-1, rev-1 and rev-3, except in polk-1 where POLH-1 can completely compensate for loss of POLK-1 (Fig 3D and Fig 3E). This class of deletions, with a narrow size range of 50-500bp, bears the typical signature of polymerase theta action upon DNA break repair: the occasional presence of templated insertions, and an overrepresentation of micro-homology at the deletion junction (Fig 3F and Fig 3G). In all these backgrounds also more complex events were found: a collection of inversions, tandem duplications or events that are more complex and classify into the umbrella term gross chromosomal rearrangements.
Loss of TLS activity is compatible with C. elegans development and fertility
The observation that rev-3 mutant animals have similar levels of deletion mutagenesis as rev-1 mutant animals, together with the outcome that rev-1 loss did not significantly elevate the genomic instability observed in polh-1 polk-1 mutants predicts that polh-1 polk-1 rev-1 rev-3 quadruple mutant animals can be generated, which are hence devoid of any TLS activity. Indeed, we found that the brood size and embryonic survival of these “TLS-dead” mutants, although lower than WT, is only mildly affected; animals also develop normally (Fig 3A and Fig 3B). We next determined the long-term genetic effects by monitoring mutational accumulation upon prolonged culturing (Fig 3D and Fig 3E, S1 Table, S2 Table). We found that polh-1 polk-1 rev-1 rev-3 quadruplex mutant animals, similar to rev-1 single mutant animals, displayed a reduced SNV mutation rate as compared to wild-type animals. However, the overall mutagenesis rate is greatly elevated, because of an approximately 30-fold increase in deletion mutagenesis, similar to the level observed in polh-1 polk-1 animals (Fig 3D). This net increase in the mutational load in TLS-abolished conditions argues that bypass of endogenous lesions in TLS proficient animals is predominantly error-free. Of note, the observation that loss of REV-1 and REV-3 does not further increase the genomic instability observed in the polh-1 polk-1, argues that Polζ does not bypass endogenous replication fork barriers independent of Polη or Polκ (Fig 3D). Our data also suggests that the contribution of REV-1, as a scaffold, or REV-3, as an extender, is limited in the bypass of spontaneous and UV-induced DNA damage.
Genome scarring in TLS deficient C. elegans is preferential at guanine bases
In an effort to deduce the molecular nature of the replication fork impediment from the mutation accumulation data we examined the base composition of deletion junctions. Previous work, analyzing deletions formed at replication-blocking G-quadruplexes, revealed that at least one of the breakpoints maps very close, if not immediately adjacent, to the replication impediment [30]. We reasoned that this may also occur at spontaneous lesions in TLS-compromised animals: one could argue that the nascent strand, which is extended by the replicative polymerases right up to the blocking lesion is a substrate for TMEJ when TLS cannot occur and thus defines one border of a deletion (Fig 4A). According to this logic, the first deleted base at the junction will frequently represent the nucleotide that is complementary to the damaged base. To assess this idea, we have determined the normalized base distribution at the deletion junctions for each genetic background. Because the total numbers of deletions in each single mutant was too low for statistically supported conclusions, we processed the data derived from polh-1 polk-1, polh-1 polk-1 rev-1 and polh-1 polk-1 rev-1 rev-3 mutant animals. In all three genetic backgrounds we detect a non-random distribution, i.e. a significant enrichment for cytosines at the -1 position (Fig 4B and S3B Fig; S3D Fig). This outcome is consistent with the idea that TLS is required predominantly at guanines to suppress replication-associated DSBs. Damaged guanines as the primary source for the deletion junctions also explains the apparent enrichment of cytosines at more downstream positions (-2 until -6) because TMEJ itself frequently results in loss of a few nucleotides at one or both sides of a DSB and micro-homology usage in TMEJ also perturbs correct annotation of the deletion junction (e.g. three different annotations are possible for a deletion with 2 bases of micro-homology) [34], which together dilutes underlying mechanistic parameters. We therefore also analyzed a subset of deletions for which such potential disturbing effects are reduced, i.e. deletions with insertions (see [34] for details). Using this subset, we indeed found the enrichment for cytosines at position -1 more pronounced (Fig 4C and S3C Fig; S3E Fig).
Discussion
When the first eukaryotic factors of TLS (Rev1, Rev3 and Rev7) were characterized in yeast they were found to promote both induced and spontaneous mutagenesis. Here, we show that lack of TLS polymerases leads to an increase in the overall mutational load in C. elegans grown under unperturbed conditions, implying that TLS action suppresses mutagenesis. The major causes for the mutagenicity of TLS are the “hard-to-read” character of bulky lesions, the wider catalytic centers of TLS polymerases (allowing for less stringent base pairing), and the lack of proofreading. In bacteria and yeast, template switching provides an error-free alternative to TLS, which may explain the lower mutation rate in TLS deficient mutants [43,44]. While such a mechanism may be present in higher eukaryotes as well, its importance remains unclear [45]. Here, we have analyzed the contribution of TLS activity on long-term genetic stability in C. elegans. We monitored fitness and spontaneous mutagenesis in animals deficient for REV1, for REV3, for all Y-family TLS enzymes, and for all TLS activity. We found that C. elegans REV-1 and REV-3 both safeguard survival in C. elegans upon exposure to UV light but are not needed for development and reproduction under unchallenged conditions in a laboratory environment. To our surprise, we found that TLS is not essential for animal life as TLS-dead animals proliferate and produce morphologically normal progeny. While we found evidence for alternative processing of blocked replication, by means of TMEJ of DNA breaks, other biology may also contribute to the mild consequences of a complete TLS deficiency. For instance, when occurring in germline nuclei, DNA breaks can be repaired by homologous recombination, or DSB-containing nuclei can be removed through apoptosis. We found that Y-family-dead and TLS-dead animals accumulate mutations over generations at the same rate and with the same characteristics as polh-1 polk-1 mutant animals, while the increase in mutation accumulation in rev-1 or rev-3 animals is only minor, which argues that Polη and Polκ i) act redundantly to bypass the vast majority of spontaneous DNA damage in C. elegans, ii) act in an error-free manner, and iii) do not require the action of REV-1 nor REV-3 for most lesions. The comprehensive mutation profiles we present for different TLS compromised C. elegans strains support the idea that TLS is anti-clastogenic and we infer from our data that the most common endogenous replication blocks reside at guanines, which in the absence of TLS generate replication-associated DSBs that are repaired by polymerase theta-mediated end joining. This DSB repair pathway is intrinsically mutagenic, hence genome scars that are characterized by micro-homology are predicted to occur at sites where replication blocks persist. Of interest, such scars are also observed in tumors deficient for the breast cancer genes BRCA1 and BRCA2 (COSMIC mutational signature ID6). In those genetic contexts potential replication-dependent DSBs cannot be repaired in an error-free manner by homologous recombination and depend on alternative routes for their repair.
We found that deficiencies for REV-1 and REV-3 lead to very similar mutation profiles and UV-hypersensitivity, which supports the hypothesis that these proteins may act in concert. Their requirement during unchallenged C. elegans growth, however, is small: in their absence, ~0.1 deletion per generation is found, which, considering 10–15 cell divisions per generation argues that only 1 lesion per 1010 bases depends on REV-1 and REV-3 to be bypassed. The consequences of REV-1 or REV-3 loss in more complex animals is more detrimental. While REV1 deficient mouse embryonic fibroblasts, yeast and human fibroblast cell lines have no proliferative problems, Rev1-/- mice develop poorly [25, 45–48]. REV3 is essential for mammalian development: missense mutations in the human REV3L gene can cause Mobius syndrome which is associated with developmental abnormalities [49], and Rev3 knockout mice are embryonic lethal [50]. The fact that we do not observe such profound developmental and reproduction defect in worms may be explained by a low damage load and by the relatively small size of the C. elegans genome. Indeed, we found very low levels of spontaneous DSBs in rev-1 deficient worms. Such replication-associated DSBs do not induce noticeable proliferative defects likely because they are, at least in part, repaired by TMEJ.
Another explanation for lack of viability in mammals when REV1 or REV3 function is lost may in part reside in functions outside TLS: in biology that may not be evolutionarily conserved. For instance, we cannot formally rule out a proposed role for Rev1 in homologous recombination but we have not found experimental support: defective HR in C. elegans results in reduced brood size, substantial or complete embryonic lethality and X-chromosomal non-disjunction [51], which we did not observe for rev-1 mutants. Also, we have not found indications supporting a role for C. elegans REV-1 in replicating through G-quadruplex structures, as was observed in DT40 chicken B-lymphocyte cells [31,32]. C. elegans REV1 and REV3 proteins are substantially smaller than their mammalian counterparts and lack amino acids sequences, such as REV1’s C-terminal domain, that manifest positive evolutionary selection pressure in vertebrates.
The frequency of deletion formation in the TLS-dead mutants may also provide an indication of how often a replication fork runs into an insurmountable block for the replicative polymerases in the context of a multicellular organism. In fact, if one assumes that in a TLS-dead mutant context every lesion that cannot be bypassed forms a deletion of >50bp, it becomes clear how rare spontaneous replication blocks are. In an estimated 10–15 rounds of replication per generation only 1 deletion occurs. For a genome of 108 bases, this means that only 1 in ~109 bases requires TLS for its replication.
All our data point to damaged guanines as the predominant spontaneous lesion that requires TLS. Interestingly, OGG1, the glycosylase that in many other biological systems removes the majority of abundantly induced 8-oxo-G lesions via BER (reviewed in [52]), is not encoded by the C. elegans genome. This lack of repair together with this lesion being an efficient and accurate TLS substrate [53] may provide an explanation for this strong base effect. It is, however, not the case that the spontaneous mutations in C. elegans are predominantly G to A (or C to T) transitions, nor have we found a dramatic reduction of these types of mutations in TLS deficient worms. Together, our observations argue that the genome is grosso modo devoid of base damage when it is replicated, explaining the lack of TLS-induced mutations as well as the ability to reproduce when all TLS activity is lost. Despite the low damage load, we find that in absence of TLS the overall mutagenic consequence is strongly increased as small deletions (50 to 500 bp) manifest, which by virtue of being ORF disrupting have a more detrimental outcome than TLS–induced SNVs.
From our studies, we thus conclude that TLS in C. elegans not only protects replication potential, it also protects the genome against the formation of small genomic deletions and larger complex rearrangements and thereby helps to maintain genome stability on an evolutionary scale. These predominantly beneficial outcomes of TLS activity provides selective advantages for the presence of these specialized polymerases in all living organisms [8].
Material & methods
C. elegans genetics
All strains were cultured according to standard methods [54]. The N2 Bristol strain was used as WT control. The alleles polq-1(tm2026), rev-1(gk455794), unc-91(e1500) were obtained from the Caenorhabditis Genetics Center, Minnesota, USA. The rev-1(BRCT) allele was isolated via a random mutagenesis approach described in [55]. The rev-1(lf206) and rev-1(fl207) KO alleles were obtained via CRISPR/Cas9-mediated genome editing as described below in further detail.
CRISPR/Cas9 mediated generation of rev-1 null alleles
For CRISPR/Cas9 mediated targeting we used the following sequence (which includes the PAM site) in exon 2 of rev-1: AGTTTCATCCTCTTCGTCACTGG. Cloning was done as described in [56]. Plasmids were injected using standard C. elegans microinjection procedures. In brief, 1 day before injection, L4 animals were transferred to new plates and cultured at 15 degrees. Gonads of young adults were injected with a solution containing 20 ng/μl pDD162 (Peft-3::Cas9, Addgene 47549), 20 ng/μl pMB70 (u6::sgRNA with rev-1 target, 10 ng/μl pGH8, 2.5 ng/μl pCFJ90 and 5 ng/μl pCFJ104. Progeny (F1) animals that express mCherry were picked to new plates 3–4 days post injection and allowed to produce offspring. Of each F1 plate 10 F2 animals were pooled, lysed and genotyped. Genotyping was done by PCR amplification of a 480 bp product around the CRISPR/Cas9 target site. Subsequent restriction with MaeIII enzyme of the wild-type sequence would result in 2 fragments (91 bp + 389 bp). A mutation at the target site can disrupt the MaeIII recognition site resulting in an uncut PCR product. We isolated 4 alleles, 2 of which were small out-of-frame deletions (S1 Fig).
Brood size and embryonic lethality assay
To determine the brood size, we singled L4 animals on OP50 plates. Every day for four days, we transferred the mother to a fresh plate and one day later quantified the number of embryos and larvae on the plate. We quantified the broods and embryonic lethality of > 20 animals per genotype.
Survival assays
To measure germline sensitivity to UV, staged young adults (one day post L4) were transferred to empty NGM plates and exposed to different doses of UV-C. Per dose and genotype 3 plates with 3 adults were set up using NGM plates with OP50 and allowed to lay eggs for 24 hours. Subsequently adults were discarded and the brood on the plate was allowed to hatch. 24 hours later the number of non-hatched eggs and surviving progeny was determined.
Sample preparation, RAD-51 antibody staining, imaging and quantification
Animals were synchronized by picking L4 stage worms 22h before dissection. Worms were dissected in 1x EBT (25 mM HEPES-Cl pH 7.4, 118 mM NaCl, 48 mM KCl, 2 mM CaCl2, 2 mM MgCl2, 0.1% Tween 20 and 20 mM sodium azide) to expose gonads. Most of the buffer was removed and the sample with cover glass was transferred to a Superfrost Plus slide and flash frozen on a metal block in dry ice. Upon complete crystallization of the sample the cover glass was quickly removed (freeze-cracking) followed by post-fixation in 4% PFA in 1x EBT. After washing, the samples were incubated with RAD-51 antibody (rabbit polyclonal from SDIX/Novus Biologicals, cat# 29480002, used at 1 : 1000 in PBST+0.5%BSA) overnight at room temperature. Alexa anti-rabbit 488, 1 : 500, was used as secondary antibody and incubated for 2h at room temperature. DNA was stained 10 min in 0.5 μg/ml DAPI/PBST. Finally, samples were de-stained in PBST for 1 h and mounted with Vectashield. Imaging and processing was done on a Leica DM6000 microscope. The data obtained (Fig 1D and Fig 1E) are from at least 3 independent experiments. Each data point represents an average value of the mitotic zone of one gonad.
Mutation accumulation lines and whole genome sequencing
Mutation accumulation lines were generated by cloning out F1 animals from one homozygous hermaphrodite, generating subpopulations. Each generation three worms from each subpopulation were transferred to new plates. MA lines were maintained for on average 45 generations. Single animals were then cloned out and propagated to obtain full plates for DNA isolation. Worms were washed off with M9 and incubated for 2 hours while shaking to remove bacteria from the intestines. Genomic DNA was isolated using a Blood and Tissue Culture Kit (Qiagen). DNA was sequenced on an Illumina HiSeq machine according to manufacturer’s protocol. Image analysis, base calling and error calibration were performed using standard Illumina software. Raw reads were mapped to the C. elegans reference genome (Wormbase release 235) by BWA [57]. GATK’s HaplotypeCaller [58] was used for SNV calling. To identify larger indels and microsatellites, GATK [57] and Pindel [59] were used. In cases that only one program identified the structural variation, visual inspection was carried out using IGV [60]. Variations were marked as true if i) it is a de novo variation, thus all other subpopulations did not support the variation. ii) covered by both forward and reverse reads, iii) covered at least five times. Mutation rates for different variations are calculated as the number of mutations per sample divided by the number of generations grown. See S1 Table for mutation rates and S2 Table for all identified de novo variations.
G4 stability on qua1466
Qua1466 is a genomic sequence [GGGAGGGCGGGCGGG] located on chromosome IV (location 11,326,500–11,326,514) that can potentially form a G-quadruplex structure. To assay genomic instability and the formation of deletions at this site we performed a nested PCR reaction on lysed animals using the following primers: external forward CAAATAAGTATTGGGCCGAAACC; external reverse AAGGAACACCTTCAAGACTCC, internal forward CTGCGAACTTCTGACGAATTTG, internal reverse TTGACTCCTCCTCTTCTGGC. As template for the external PCR 1 μl of a 15 μl lysis with 5 worms was used. 0.5 μl of the external PCR was used as template for internal PCR. 10 μl of internal PCR product was run for 1 hour at 120V on a 1% agarose gel.
unc-93 (e1500) mutagenesis assay
To pick up spontaneous mutations in the rev-1(gk455794) and rev-1(gk455794) polq-1(tm2026) backgrounds, we used a mutagenesis assay based on reversion of the so-called ‘‘rubber band” phenotype, caused by a dominant mutation in the muscle gene unc-93. Reversion of the unc-93(e1500) phenotype is caused by homozygous loss of unc-93(e1500) or one of the suppressor genes sup-9, sup-10, sup-11, and sup-18. For both genotypes, rev-1 unc-93(e1500) and rev-1; polq-1(tm2026); unc-93(e1500), 400 animals were singled on 9 cm plates. These plates were grown until starvation and of each plate an equal amount (chunks of 2 x 2 cm) were transferred to fresh 9 cm plates. Before these plates reached starvation they were inspected for wild-type moving animals. From each starting culture, only one revertant animal was isolated to ensure independent events. Of each genetic background we randomly selected 30 revertants and sequenced the unc-93 gene. When large deletions occurred we established the approximate size of the deletion with PCR amplicons of approximately 500 bp located at the borders of the gene and 2.5 kb and 5 kb up and downstream of the unc-93 gene.
Supporting information
S1 Fig [pdf]
Schematic representations of all TLS polymerase genes encoded in . and the mutations used in this study.
S2 Fig [pdf]
does not aggravate G-quadruplex deletions in deficient animals.
S3 Fig [b]
Failure to bypass damaged guanines results in deletions.
S1 Table [xlsx]
Mutagenesis rates in . TLS mutants.
S2 Table [xlsx]
Mutation profiles derived from . whole genome sequencing data.
Zdroje
1. McCulloch SD, Kunkel TA. The fidelity of DNA synthesis by eukaryotic replicative and translesion synthesis polymerases. Cell research. 2008;18(1):148–61. Epub 2008/01/02. doi: 10.1038/cr.2008.4 18166979; PubMed Central PMCID: PMC3639319.
2. Fishel R. Mismatch repair. The Journal of biological chemistry. 2015;290(44):26395–403. Epub 2015/09/12. doi: 10.1074/jbc.R115.660142 26354434; PubMed Central PMCID: PMC4646297.
3. Barnes DE, Lindahl T. Repair and genetic consequences of endogenous DNA base damage in mammalian cells. Annual review of genetics. 2004;38 : 445–76. Epub 2004/12/01. doi: 10.1146/annurev.genet.38.072902.092448 15568983.
4. Marteijn JA, Lans H, Vermeulen W, Hoeijmakers JH. Understanding nucleotide excision repair and its roles in cancer and ageing. Nature reviews Molecular cell biology. 2014;15(7):465–81. Epub 2014/06/24. doi: 10.1038/nrm3822 24954209.
5. Pilzecker B, Buoninfante OA, Jacobs H. DNA damage tolerance in stem cells, ageing, mutagenesis, disease and cancer therapy. Nucleic acids research. 2019;47(14):7163–81. Epub 2019/06/30. doi: 10.1093/nar/gkz531 31251805; PubMed Central PMCID: PMC6698745.
6. Hirota K, Yoshikiyo K, Guilbaud G, Tsurimoto T, Murai J, Tsuda M, et al. The POLD3 subunit of DNA polymerase δ can promote translesion synthesis independently of DNA polymerase ζ. Nucleic acids research. 2015;43(3):1671–83. Epub 2015/01/30. doi: 10.1093/nar/gkv023 25628356; PubMed Central PMCID: PMC4330384.
7. Jansen JG, Fousteri MI, de Wind N. Send in the clamps: control of DNA translesion synthesis in eukaryotes. Molecular cell. 2007;28(4):522–9. Epub 2007/11/29. doi: 10.1016/j.molcel.2007.11.005 18042449.
8. Prakash S, Johnson RE, Prakash L. Eukaryotic translesion synthesis DNA polymerases: specificity of structure and function. Annual review of biochemistry. 2005;74 : 317–53. Epub 2005/06/15. doi: 10.1146/annurev.biochem.74.082803.133250 15952890.
9. Sale JE, Lehmann AR, Woodgate R. Y-family DNA polymerases and their role in tolerance of cellular DNA damage. Nature reviews Molecular cell biology. 2012;13(3):141–52. Epub 2012/02/24. doi: 10.1038/nrm3289 22358330; PubMed Central PMCID: PMC3630503.
10. Baranovskiy AG, Lada AG, Siebler HM, Zhang Y, Pavlov YI, Tahirov TH. DNA polymerase δ and ζ switch by sharing accessory subunits of DNA polymerase δ. The Journal of biological chemistry. 2012;287(21):17281–7. Epub 2012/04/03. doi: 10.1074/jbc.M112.351122 22465957; PubMed Central PMCID: PMC3366816.
11. Johnson RE, Prakash L, Prakash S. Pol31 and Pol32 subunits of yeast DNA polymerase δ are also essential subunits of DNA polymerase ζ. Proceedings of the National Academy of Sciences of the United States of America. 2012;109(31):12455–60. Epub 2012/06/20. doi: 10.1073/pnas.1206052109 22711820; PubMed Central PMCID: PMC3411960.
12. Makarova AV, Stodola JL, Burgers PM. A four-subunit DNA polymerase ζ complex containing Pol δ accessory subunits is essential for PCNA-mediated mutagenesis. Nucleic acids research. 2012;40(22):11618–26. Epub 2012/10/16. doi: 10.1093/nar/gks948 23066099; PubMed Central PMCID: PMC3526297.
13. Johnson RE, Washington MT, Haracska L, Prakash S, Prakash L. Eukaryotic polymerases iota and zeta act sequentially to bypass DNA lesions. Nature. 2000;406(6799):1015–9. Epub 2000/09/13. doi: 10.1038/35023030 10984059.
14. Prakash S, Prakash L. Translesion DNA synthesis in eukaryotes: a one - or two-polymerase affair. Genes & development. 2002;16(15):1872–83. Epub 2002/08/03. doi: 10.1101/gad.1009802 12154119.
15. Gan GN, Wittschieben JP, Wittschieben B, Wood RD. DNA polymerase zeta (pol zeta) in higher eukaryotes. Cell research. 2008;18(1):174–83. Epub 2007/12/25. doi: 10.1038/cr.2007.117 18157155.
16. Roerink SF, Koole W, Stapel LC, Romeijn RJ, Tijsterman M. A broad requirement for TLS polymerases η and κ, and interacting sumoylation and nuclear pore proteins, in lesion bypass during C. elegans embryogenesis. PLoS genetics. 2012;8(6):e1002800. Epub 2012/07/05. doi: 10.1371/journal.pgen.1002800 22761594; PubMed Central PMCID: PMC3386174.
17. Roerink SF, van Schendel R, Tijsterman M. Polymerase theta-mediated end joining of replication-associated DNA breaks in C. elegans. Genome research. 2014;24(6):954–62. Epub 2014/03/13. doi: 10.1101/gr.170431.113 24614976; PubMed Central PMCID: PMC4032859.
18. van Bostelen I, Tijsterman M. Combined loss of three DNA damage response pathways renders C. elegans intolerant to light. DNA repair. 2017;54 : 55–62. Epub 2017/05/05. doi: 10.1016/j.dnarep.2017.04.002 28472716.
19. Thompson O, Edgley M, Strasbourger P, Flibotte S, Ewing B, Adair R, et al. The million mutation project: a new approach to genetics in Caenorhabditis elegans. Genome research. 2013;23(10):1749–62. Epub 2013/06/27. doi: 10.1101/gr.157651.113 23800452; PubMed Central PMCID: PMC3787271.
20. Guo C, Fischhaber PL, Luk-Paszyc MJ, Masuda Y, Zhou J, Kamiya K, et al. Mouse Rev1 protein interacts with multiple DNA polymerases involved in translesion DNA synthesis. The EMBO journal. 2003;22(24):6621–30. Epub 2003/12/06. doi: 10.1093/emboj/cdg626 14657033; PubMed Central PMCID: PMC291821.
21. Lawrence CW. Cellular functions of DNA polymerase zeta and Rev1 protein. Advances in protein chemistry. 2004;69 : 167–203. Epub 2004/12/14. doi: 10.1016/S0065-3233(04)69006-1 15588843.
22. Pryor JM, Gakhar L, Washington MT. Structure and functional analysis of the BRCT domain of translesion synthesis DNA polymerase Rev1. Biochemistry. 2013;52(1):254–63. Epub 2012/12/18. doi: 10.1021/bi301572z 23240687; PubMed Central PMCID: PMC3580236.
23. Jansen JG, Tsaalbi-Shtylik A, Langerak P, Calléja F, Meijers CM, Jacobs H, et al. The BRCT domain of mammalian Rev1 is involved in regulating DNA translesion synthesis. Nucleic acids research. 2005;33(1):356–65. Epub 2005/01/18. doi: 10.1093/nar/gki189 15653636; PubMed Central PMCID: PMC546167.
24. Larimer FW, Perry JR, Hardigree AA. The REV1 gene of Saccharomyces cerevisiae: isolation, sequence, and functional analysis. Journal of bacteriology. 1989;171(1):230–7. Epub 1989/01/01. doi: 10.1128/jb.171.1.230-237.1989 2492497; PubMed Central PMCID: PMC209577.
25. Gibbs PE, Wang XD, Li Z, McManus TP, McGregor WG, Lawrence CW, et al. The function of the human homolog of Saccharomyces cerevisiae REV1 is required for mutagenesis induced by UV light. Proceedings of the National Academy of Sciences of the United States of America. 2000;97(8):4186–91. Epub 2000/04/13. doi: 10.1073/pnas.97.8.4186 10760286; PubMed Central PMCID: PMC18191.
26. Johnson RE, Kondratick CM, Prakash S, Prakash L. hRAD30 mutations in the variant form of xeroderma pigmentosum. Science (New York, NY). 1999;285(5425):263–5. Epub 1999/07/10. doi: 10.1126/science.285.5425.263 10398605.
27. De Stasio E, Lephoto C, Azuma L, Holst C, Stanislaus D, Uttam J. Characterization of revertants of unc-93(e1500) in Caenorhabditis elegans induced by N-ethyl-N-nitrosourea. Genetics. 1997;147(2):597–608. Epub 1997/10/23. 9335597; PubMed Central PMCID: PMC1208182.
28. Greenwald IS, Horvitz HR. unc-93(e1500): A behavioral mutant of Caenorhabditis elegans that defines a gene with a wild-type null phenotype. Genetics. 1980;96(1):147–64. Epub 1980/09/01. 6894129; PubMed Central PMCID: PMC1214286.
29. Kruisselbrink E, Guryev V, Brouwer K, Pontier DB, Cuppen E, Tijsterman M. Mutagenic capacity of endogenous G4 DNA underlies genome instability in FANCJ-defective C. elegans. Current biology: CB. 2008;18(12):900–5. Epub 2008/06/10. doi: 10.1016/j.cub.2008.05.013 18538569.
30. Koole W, van Schendel R, Karambelas AE, van Heteren JT, Okihara KL, Tijsterman M. A Polymerase Theta-dependent repair pathway suppresses extensive genomic instability at endogenous G4 DNA sites. Nature communications. 2014;5 : 3216. Epub 2014/02/06. doi: 10.1038/ncomms4216 24496117.
31. Sarkies P, Reams C, Simpson LJ, Sale JE. Epigenetic instability due to defective replication of structured DNA. Molecular cell. 2010;40(5):703–13. Epub 2010/12/15. doi: 10.1016/j.molcel.2010.11.009 21145480; PubMed Central PMCID: PMC3145961.
32. Schiavone D, Guilbaud G, Murat P, Papadopoulou C, Sarkies P, Prioleau MN, et al. Determinants of G quadruplex-induced epigenetic instability in REV1-deficient cells. The EMBO journal. 2014;33(21):2507–20. Epub 2014/09/06. doi: 10.15252/embj.201488398 25190518; PubMed Central PMCID: PMC4282387.
33. van Schendel R, Roerink SF, Portegijs V, van den Heuvel S, Tijsterman M. Polymerase Θ is a key driver of genome evolution and of CRISPR/Cas9-mediated mutagenesis. Nature communications. 2015;6 : 7394. Epub 2015/06/17. doi: 10.1038/ncomms8394 26077599; PubMed Central PMCID: PMC4490562.
34. van Schendel R, van Heteren J, Welten R, Tijsterman M. Genomic Scars Generated by Polymerase Theta Reveal the Versatile Mechanism of Alternative End-Joining. PLoS genetics. 2016;12(10):e1006368. Epub 2016/10/19. doi: 10.1371/journal.pgen.1006368 27755535; PubMed Central PMCID: PMC5068794.
35. Shao Z, Niwa S, Higashitani A, Daigaku Y. Vital roles of PCNA K165 modification during C. elegans gametogenesis and embryogenesis. DNA repair. 2019;82 : 102688. Epub 2019/08/27. doi: 10.1016/j.dnarep.2019.102688 31450086.
36. Nelson JR, Lawrence CW, Hinkle DC. Deoxycytidyl transferase activity of yeast REV1 protein. Nature. 1996;382(6593):729–31. Epub 1996/08/22. doi: 10.1038/382729a0 8751446.
37. Haracska L, Unk I, Johnson RE, Johansson E, Burgers PM, Prakash S, et al. Roles of yeast DNA polymerases delta and zeta and of Rev1 in the bypass of abasic sites. Genes & development. 2001;15(8):945–54. Epub 2001/04/24. doi: 10.1101/gad.882301 11316789; PubMed Central PMCID: PMC312678.
38. Zhang Y, Wu X, Rechkoblit O, Geacintov NE, Taylor JS, Wang Z. Response of human REV1 to different DNA damage: preferential dCMP insertion opposite the lesion. Nucleic acids research. 2002;30(7):1630–8. Epub 2002/03/28. doi: 10.1093/nar/30.7.1630 11917024; PubMed Central PMCID: PMC101843.
39. Zhou Y, Wang J, Zhang Y, Wang Z. The catalytic function of the Rev1 dCMP transferase is required in a lesion-specific manner for translesion synthesis and base damage-induced mutagenesis. Nucleic acids research. 2010;38(15):5036–46. Epub 2010/04/15. doi: 10.1093/nar/gkq225 20388628; PubMed Central PMCID: PMC2926598.
40. Kikuchi S, Hara K, Shimizu T, Sato M, Hashimoto H. Structural basis of recruitment of DNA polymerase ζ by interaction between REV1 and REV7 proteins. The Journal of biological chemistry. 2012;287(40):33847–52. Epub 2012/08/04. doi: 10.1074/jbc.M112.396838 22859296; PubMed Central PMCID: PMC3460479.
41. Wojtaszek J, Liu J, D'Souza S, Wang S, Xue Y, Walker GC, et al. Multifaceted recognition of vertebrate Rev1 by translesion polymerases ζ and κ. The Journal of biological chemistry. 2012;287(31):26400–8. Epub 2012/06/16. doi: 10.1074/jbc.M112.380998 22700975; PubMed Central PMCID: PMC3406723.
42. Wojtaszek J, Lee CJ, D'Souza S, Minesinger B, Kim H, D'Andrea AD, et al. Structural basis of Rev1-mediated assembly of a quaternary vertebrate translesion polymerase complex consisting of Rev1, heterodimeric polymerase (Pol) ζ, and Pol κ. The Journal of biological chemistry. 2012;287(40):33836–46. Epub 2012/08/04. doi: 10.1074/jbc.M112.394841 22859295; PubMed Central PMCID: PMC3460478.
43. Waters LS, Minesinger BK, Wiltrout ME, D'Souza S, Woodruff RV, Walker GC. Eukaryotic translesion polymerases and their roles and regulation in DNA damage tolerance. Microbiology and molecular biology reviews: MMBR. 2009;73(1):134–54. Epub 2009/03/05. doi: 10.1128/MMBR.00034-08 19258535; PubMed Central PMCID: PMC2650891.
44. Fuchs RP. Tolerance of lesions in E. coli: Chronological competition between Translesion Synthesis and Damage Avoidance. DNA repair. 2016;44 : 51–8. Epub 2016/06/21. doi: 10.1016/j.dnarep.2016.05.006 27321147.
45. Unk I, Hajdú I, Blastyák A, Haracska L. Role of yeast Rad5 and its human orthologs, HLTF and SHPRH in DNA damage tolerance. DNA repair. 2010;9(3):257–67. Epub 2010/01/26. doi: 10.1016/j.dnarep.2009.12.013 20096653.
46. Jansen JG, Tsaalbi-Shtylik A, Hendriks G, Gali H, Hendel A, Johansson F, et al. Separate domains of Rev1 mediate two modes of DNA damage bypass in mammalian cells. Molecular and cellular biology. 2009;29(11):3113–23. Epub 2009/04/01. doi: 10.1128/MCB.00071-09 19332561; PubMed Central PMCID: PMC2682010.
47. Kosarek JN, Woodruff RV, Rivera-Begeman A, Guo C, D'Souza S, Koonin EV, et al. Comparative analysis of in vivo interactions between Rev1 protein and other Y-family DNA polymerases in animals and yeasts. DNA repair. 2008;7(3):439–51. Epub 2008/02/05. doi: 10.1016/j.dnarep.2007.11.016 18242152; PubMed Central PMCID: PMC2363158.
48. Jansen JG, Langerak P, Tsaalbi-Shtylik A, van den Berk P, Jacobs H, de Wind N. Strand-biased defect in C/G transversions in hypermutating immunoglobulin genes in Rev1-deficient mice. The Journal of experimental medicine. 2006;203(2):319–23. Epub 2006/02/16. doi: 10.1084/jem.20052227 16476771; PubMed Central PMCID: PMC2118202.
49. Tomas-Roca L, Tsaalbi-Shtylik A, Jansen JG, Singh MK, Epstein JA, Altunoglu U, et al. De novo mutations in PLXND1 and REV3L cause Möbius syndrome. Nature communications. 2015;6 : 7199. Epub 2015/06/13. doi: 10.1038/ncomms8199 26068067; PubMed Central PMCID: PMC4648025.
50. Bemark M, Khamlichi AA, Davies SL, Neuberger MS. Disruption of mouse polymerase zeta (Rev3) leads to embryonic lethality and impairs blastocyst development in vitro. Current biology: CB. 2000;10(19):1213–6. Epub 2000/10/26. doi: 10.1016/s0960-9822(00)00724-7 11050391.
51. Lemmens BB, Tijsterman M. DNA double-strand break repair in Caenorhabditis elegans. Chromosoma. 2011;120(1):1–21. Epub 2010/11/06. doi: 10.1007/s00412-010-0296-3 21052706; PubMed Central PMCID: PMC3028100.
52. Boiteux S, Coste F, Castaing B. Repair of 8-oxo-7,8-dihydroguanine in prokaryotic and eukaryotic cells: Properties and biological roles of the Fpg and OGG1 DNA N-glycosylases. Free radical biology & medicine. 2017;107 : 179–201. Epub 2016/12/03. doi: 10.1016/j.freeradbiomed.2016.11.042 27903453.
53. Haracska L, Yu SL, Johnson RE, Prakash L, Prakash S. Efficient and accurate replication in the presence of 7,8-dihydro-8-oxoguanine by DNA polymerase eta. Nature genetics. 2000;25(4):458–61. Epub 2000/08/10. doi: 10.1038/78169 10932195.
54. Brenner S. The genetics of Caenorhabditis elegans. Genetics. 1974;77(1):71–94. Epub 1974/05/01. 4366476; PubMed Central PMCID: PMC1213120.
55. Cuppen E, Gort E, Hazendonk E, Mudde J, van de Belt J, Nijman IJ, et al. Efficient target-selected mutagenesis in Caenorhabditis elegans: toward a knockout for every gene. Genome research. 2007;17(5):649–58. Epub 2007/04/10. doi: 10.1101/gr.6080607 17416746; PubMed Central PMCID: PMC1855173.
56. Waaijers S, Portegijs V, Kerver J, Lemmens BB, Tijsterman M, van den Heuvel S, et al. CRISPR/Cas9-targeted mutagenesis in Caenorhabditis elegans. Genetics. 2013;195(3):1187–91. Epub 2013/08/28. doi: 10.1534/genetics.113.156299 23979586; PubMed Central PMCID: PMC3813849.
57. Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics (Oxford, England). 2009;25(14):1754–60. Epub 2009/05/20. doi: 10.1093/bioinformatics/btp324 19451168; PubMed Central PMCID: PMC2705234.
58. DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, et al. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nature genetics. 2011;43(5):491–8. Epub 2011/04/12. doi: 10.1038/ng.806 21478889; PubMed Central PMCID: PMC3083463.
59. Ye K, Schulz MH, Long Q, Apweiler R, Ning Z. Pindel: a pattern growth approach to detect break points of large deletions and medium sized insertions from paired-end short reads. Bioinformatics (Oxford, England). 2009;25(21):2865–71. Epub 2009/06/30. doi: 10.1093/bioinformatics/btp394 19561018; PubMed Central PMCID: PMC2781750.
60. Robinson JT, Thorvaldsdóttir H, Winckler W, Guttman M, Lander ES, Getz G, et al. Integrative genomics viewer. Nature biotechnology. 2011;29(1):24–6. Epub 2011/01/12. doi: 10.1038/nbt.1754 21221095; PubMed Central PMCID: PMC3346182.
Článek vyšel v časopise
PLOS Genetics
2020 Číslo 4
- Máj pod bílým pláštěm aneb když mezi směnami vykvete láska
- Perorální antivirotika jako vysoce efektivní nástroj prevence hospitalizací kvůli COVID-19 − otázky a odpovědi pro praxi
- Umělá inteligence v detekci karcinomu prsu – výsledky z reálné klinické praxe
- Co by měl vědět nediabetolog o diabetu?
- Bezpečnost dlouhodobé terapie osteoporózy – aktuální data
-
Všechny články tohoto čísla
- Dynamic localization of SPO11-1 and conformational changes of meiotic axial elements during recombination initiation of maize meiosis
- The plant mobile domain proteins MAIN and MAIL1 interact with the phosphatase PP7L to regulate gene expression and silence transposable elements in Arabidopsis thaliana
- Targeting mitochondrial and cytosolic substrates of TRIT1 isopentenyltransferase: Specificity determinants and tRNA-i6A37 profiles
- High expression in maize pollen correlates with genetic contributions to pollen fitness as well as with coordinated transcription from neighboring transposable elements
- XPF-ERCC1 protects liver, kidney and blood homeostasis outside the canonical excision repair pathways
- Technical and social issues influencing the adoption of preprints in the life sciences
- The nanophthalmos protein TMEM98 inhibits MYRF self-cleavage and is required for eye size specification
- DNA methylation-mediated repression of exosomal miR-652-5p expression promotes oesophageal squamous cell carcinoma aggressiveness by targeting PARG and VEGF pathways
- Is imprinting the result of “friendly fire” by the host defense system?
- The coordinate actions of calcineurin and Hog1 mediate the stress response through multiple nodes of the cell cycle network
- XPF–ERCC1: Linchpin of DNA crosslink repair
- A missense variant in Mitochondrial Amidoxime Reducing Component 1 gene and protection against liver disease
- Deconstructing cerebellar development cell by cell
- The genomic landscape of undifferentiated embryonal sarcoma of the liver is typified by C19MC structural rearrangement and overexpression combined with TP53 mutation or loss
- Variants encoding a restricted carboxy-terminal domain of SLC12A2 cause hereditary hearing loss in humans
- Molecular genetics of maternally-controlled cell divisions
- Waking up quiescent neural stem cells: Molecular mechanisms and implications in neurodevelopmental disorders
- Parallelism in eco-morphology and gene expression despite variable evolutionary and genomic backgrounds in a Holarctic fish
- An integrated analysis of cell-type specific gene expression reveals genes regulated by REVOLUTA and KANADI1 in the Arabidopsis shoot apical meristem
- Discovery of novel hepatocyte eQTLs in African Americans
- Loss-of-function tolerance of enhancers in the human genome
- Spastin mutations impair coordination between lipid droplet dispersion and reticulum
- Relaxed constraint and functional divergence of the progesterone receptor (PGR) in the human stem-lineage
- Is adaptation limited by mutation? A timescale-dependent effect of genetic diversity on the adaptive substitution rate in animals
- Tryptamine accumulation caused by deletion of MrMao-1 in Metarhizium genome significantly enhances insecticidal virulence
- Postglacial migration shaped the genomic diversity and global distribution of the wild ancestor of lager-brewing hybrids
- Conserved nuclear hormone receptors controlling a novel plastic trait target fast-evolving genes expressed in a single cell
- Pathological mechanism and antisense oligonucleotide-mediated rescue of a non-coding variant suppressing factor 9 RNA biogenesis leading to hemophilia B
- Loss of FOXM1 in macrophages promotes pulmonary fibrosis by activating p38 MAPK signaling pathway
- Ribosome binding protein GCN1 regulates the cell cycle and cell proliferation and is essential for the embryonic development of mice
- Inference of past demography, dormancy and self-fertilization rates from whole genome sequence data
- Drosophila NUAK functions with Starvin/BAG3 in autophagic protein turnover
- FANCJ helicase promotes DNA end resection by facilitating CtIP recruitment to DNA double-strand breaks
- Getting clear about the F-word in genomics
- The MAPK substrate MASS proteins regulate stomatal development in Arabidopsis
- Placental imprinting: Emerging mechanisms and functions
- Eliciting priors and relaxing the single causal variant assumption in colocalisation analyses
- Mutations in SPATA13/ASEF2 cause primary angle closure glaucoma
- Functional diversification of Paramecium Ku80 paralogs safeguards genome integrity during precise programmed DNA elimination
- Integrative and quantitative view of the CtrA regulatory network in a stalked budding bacterium
- Analysis of genes within the schizophrenia-linked 22q11.2 deletion identifies interaction of night owl/LZTR1 and NF1 in GABAergic sleep control
- Interaction between host genes and Mycobacterium tuberculosis lineage can affect tuberculosis severity: Evidence for coevolution?
- Quantitative live imaging of Venus::BMAL1 in a mouse model reveals complex dynamics of the master circadian clock regulator
- O-linked β-N-acetylglucosamine transferase plays an essential role in heart development through regulating angiopoietin-1
- The Drosophila FUS ortholog cabeza promotes adult founder myoblast selection by Xrp1-dependent regulation of FGF signaling
- The transcription and export complex THO/TREX contributes to transcription termination in plants
- Loss of Cdc13 causes genome instability by a deficiency in replication-dependent telomere capping
- Leveraging gene co-expression patterns to infer trait-relevant tissues in genome-wide association studies
- Fluorescence fluctuation analysis reveals PpV dependent Cdc25 protein dynamics in living embryos
- Correction: Exome sequencing in multiple sclerosis families identifies 12 candidate genes and nominates biological pathways for the genesis of disease
- C9orf72/ALFA-1 controls TFEB/HLH-30-dependent metabolism through dynamic regulation of Rag GTPases
- Inositol 1,4,5-trisphosphate receptors are essential for fetal-maternal connection and embryo viability
- ArdC, a ssDNA-binding protein with a metalloprotease domain, overpasses the recipient hsdRMS restriction system broadening conjugation host range
- The Drosophila actin nucleator DAAM is essential for left-right asymmetry
- Translesion synthesis polymerases are dispensable for C. elegans reproduction but suppress genome scarring by polymerase theta-mediated end joining
- Juvenile hormone suppresses aggregation behavior through influencing antennal gene expression in locusts
- UNBRANCHED3 Expression and Inflorescence Development is Mediated by UNBRANCHED2 and the Distal Enhancer, KRN4, in Maize
- Dynamic miRNA-mRNA interactions coordinate gene expression in adult Anopheles gambiae
- Long noncoding RNA PAHAL modulates locust behavioural plasticity through the feedback regulation of dopamine biosynthesis
- PLOS Genetics
- Archiv čísel
- Aktuální číslo
- Informace o časopisu
Nejčtenější v tomto čísle
- High expression in maize pollen correlates with genetic contributions to pollen fitness as well as with coordinated transcription from neighboring transposable elements
- The MAPK substrate MASS proteins regulate stomatal development in Arabidopsis
- Molecular genetics of maternally-controlled cell divisions
- Spastin mutations impair coordination between lipid droplet dispersion and reticulum
Zvyšte si kvalifikaci online z pohodlí domova
Mazová zátka a její řešení
nový kurzVšechny kurzy