Jednonukleotidová substituce c.645+32C>T v genu APC je nepatogenním polymorfismem s výskytem přibližně u 16 % české populace


Single Nucleotide c.645+32C>T Substitution in the APC Gene is a Non-pathogenic Polymorphism Appearing in about 16% of the Czech Population

Background.
Familial adenomatous polyposis is an autosomal dominant disease characterised by predisposition to colon polyposis and colorectal cancer and caused by germline mutations in the APC gene. The aim of the study was to establish the frequency of c.645+32C>T substitution in intron 5 of the APC gene in patients with multiple colon polyposis and in the general population and to determine if this substitution is a nonpathogenic polymorphism or a pathogenic mutation associated with multiple polyposis coli.

Methods and Results.
The frequency of c.645+32C>T substitution in the APC gene was established in 170 patients with the clinical phenotype of familial adenomatous polyposis or its attenuated form using denaturating gradient gel electrophoresis and direct sequencing. We tested a population of 200 non-cancer persons using allelic specific polymerase chain reaction. The c.645+32C>T substitution was detected in 27 of 170 patients with multiple colon polyposis (i.e. 15.9%). The substitution was found in 32 of 200 control persons, i.e. in 16%. The difference between patients with polyposis and the control group was not statistically significant (p = 0.979; chí-square test).

Conclusions.
Our results suggest that the c.645+32C>T substitution is a non-pathogenic single nucleotide polymorphism appearing in about 16% of the Czech population.

Key words:
familial adenomatous polyposis, APC gene, mutation, polymorphism.


Autoři: P. Plevová 1,2;  L. Drobčinská 3;  J. Štekrová 4;  E. Šilhánová 1
Působiště autorů: Oddělení lékařské genetiky FN, Ostrava 1;  Ústav patologie & Laboratoř molekulární patologie LF UP, Olomouc 2;  Zdravotně sociální fakulta, Ostravská univerzita, Ostrava 3;  Ústav biologie a lékařské genetiky 1. LF UK a VFN, Praha 4
Vyšlo v časopise: Čas. Lék. čes. 2008; 147: 266-268
Kategorie: Původní práce

Souhrn

Východisko.
Familiární adenomatózní polypóza je autozomálně dominantně dědičné onemocnění charakterizované predispozicí ke vzniku polypů v tlustém střevě a v rektu a ke kolorektálnímu karcinomu. Příčinou onemocnění jsou zárodečné mutace v genu APC. Cílem studie bylo stanovit frekvenci jednonukleotidové substituce c.645+32C>T v intronu 5 genu APC u pacientů s mnohočetnou střevní polypózou a v obecné populaci a pokusit se objasnit, zda je tato substituce nepatogenním polymorfismem (tj. populační variantou) nebo onemocnění způsobující mutací.

Metody a výsledky.
Frekvence substituce c.645+32C>T v genu APC byla studována v souboru 170 pacientů s fenotypem familiární adenomatózní polypózy nebo její atenuované formy metodou denaturační gradientové gelové elektroforézy a přímou sekvenací. Dále byla frekvence této substituce vyšetřena u souboru 200 neonkologických pacientů pomocí metody alelické specifické polymerázové řetězové reakce. Substituce c.645+32C>T byla zjištěna u 27 ze 170 pacientů s mnohočetnou střevní polypózou (tj. 15,9 %) a dále u 32 z 200 pacientů v kontrolní skupině (tj. 16 %). Rozdíl ve výskytu substituce mezi pacienty s polypózou a kontrolní skupinou nebyl statisticky významný (p = 0,979; test chí-kvadrát).

Závěry.
Jednonukleotidová substituce c.645+32C>T v intronu 5 genu APC je nepatogenním polymorfismem, tedy populační variantou, která se vyskytuje přibližně u 16 % české populace.

Klíčová slova:
familiární adenomatózní polypóza, gen APC, mutace, polymorfismus.

Familiární adenomatózní polypóza je autozomálně dominantně dědičné onemocnění charakterizované predispozicí ke vzniku stovek až tisíců polypů v tlustém střevě a v rektu s počátkem jejich vývoje již v dětském věku a ke kolorektálnímu karcinomu. Příčinou onemocnění jsou zárodečné mutace v genu APC (z angl. „adenomatous polyposis coli“). Mutace v prvních pěti exonech genu APC, exonu 9 a v oblasti 3’ konce genu vedou k fenotypu atenuované formy familiární adenomatózní polypózy, která je spojena s menším počtem polypů (obvykle do 100) a pozdním počátkem jejich vzniku, riziko rozvoje kolorektálního karcinomu je však rovněž vysoké (1). U několika pacientů s klinickým fenotypem atenuované formy familiární adenomatózní polypózy jsme zachytili jednonukleotidovou substituci c.645+32C>T v intronu 5 genu APC. Cílem studie bylo stanovit frekvenci této jednonukleotidové substituce u pacientů s mnohočetnou střevní polypózou v obecné populaci a pokusit se objasnit, zda je tato substituce nepatogenním polymorfismem (tj. populační variantou) nebo patogenní mutací způsobující střevní polypózu.

SOUBOR NEMOCNÝCH A POUŽITÉ METODY

Do studie bylo zařazeno 170 pacientů s fenotypem familiární adenomatózní polypózy nebo její atenuované formy. Od pacientů byl obdržen informovaný souhlas. Substituce c.645+32C>T v genu APC byla detekována metodou denaturační gradientové gelové elektroforézy (DGGE) a/nebo přímou sekvenací v rámci vyšetření 5. exonu a přilehlých intronických sekvencí (2, 3). Sekvence primerů pro detekci pomocí DGGE: „forward primer“ se svorkou: 5’ CCCCGCCCGGCCCGCCCCGCCCCCCGCCCCCCCTCCCGGCCCGCCCCCCTGGCGCCCCGCTACAAGATATTGA TAC TTTTTTA-3’; „revers primer“, 5’ TGTAATTCATTTTAT TCCTAATAGCTC-3’. Sekvence primerů pro detekci pomocí přímé sekvenace: „forward primer“, 5’-TACAAGATATTGATACTTTTT TA-3’; „revers primer“, 5’-TGTAATTCATTTTATTCCTAATAG CTC-3’. Podmínky PCR byly následující: 95 °C 5 min (95 °C 60 s, 52 °C 90 s, 72 °C 90 s)30 72 °C 7 min. Gradient při DGGE byl 20 : 70 % a délka trvání elektroforézy 2 hodiny.

Dále byla tato substituce vyšetřena u anonymního souboru 200 neonkologických pacientů. Byla navržena metoda alelické specifické polymerázové řetězové reakce (PCR, z angl. „polymerase chain reaction“) pro detekci této substituce. Sekvence primerů byly následující: normální „forward primer“, 5‘-GTTTCTAAGTGA TAAAACAAC-3‘; mutovaný „forward primer“, 5‘-GTTTCTAAG TGATAAAACAAT-3‘; společný „revers primer“, 5‘-TTGCTC AGCAGCCATGATAA -3‘ (obr. 1). Jako kontrola správné amplifikace byl použit pár primerů užívaných pro detekci mutace G20210A v genu pro protrombin: „forward primer“, 5’ TCTAGAAACAG TTGCCTGGC-3’; „revers primer“, 5’ ATAGCACTGGGAGCATT GAAGC-3’. Podmínky PCR byly následující: 94 °C 5 min (94 °C 40 s, 55 °C 40 s, 72 °C 40 s)35 72 °C 7 min. Fragmenty byly rozděleny elektroforeticky na 5% nedenaturačním polyakrylamidovém gelu a vizualizovány pomocí barvení stříbrem. U vzorků bez substituce byl přítomen fragment pouze ve zkumavce s normálním „forward primerem“. Byl-li pacient heterozygotní pro sledovanou substituci (tj. jednu alelu genu má normální a druhou se substitucí), byl fragment přítomen ve zkumavce jak s normálním, tak s mutovaným „forward primerem“. Fragment pro protrombin, tj. vnitřní kontrola amplifikace, byl přítomen v každém vzorku (obr. 2).

Substituce c.645+32C>T v intronu 5 genu APC, normální a mutovaná sekvence
NF – normální „forward primer“,
CR – společný „revers primer“,
MF – mutovaný „forward primer“, šipky – směr amplifikace
Obr. 1. Substituce c.645+32C>T v intronu 5 genu APC, normální a mutovaná sekvence NF – normální „forward primer“, CR – společný „revers primer“, MF – mutovaný „forward primer“, šipky – směr amplifikace

Detekce substituce c.645+32C>T pomocí alelické specifické polymerázové řetězové reakce, fragmenty na 5% polyakrylamidovém gelu po elektroforéze
N – normální alela, M – mutovaná alela
vzorek 1: heterozygot pro substituci c.645+32C>T (amplifikována jak normální, tak mutovaná alela)
vzorky 2 a 3: substituce c.645+32C>T nepřítomna (amplifikována jen normální alela)
Obr. 2. Detekce substituce c.645+32C>T pomocí alelické specifické polymerázové řetězové reakce, fragmenty na 5% polyakrylamidovém gelu po elektroforéze N – normální alela, M – mutovaná alela vzorek 1: heterozygot pro substituci c.645+32C>T (amplifikována jak normální, tak mutovaná alela) vzorky 2 a 3: substituce c.645+32C>T nepřítomna (amplifikována jen normální alela)

Výsledky

Substituce c.645+32C>T byla zjištěna u 27 ze 170 pacientů s familiární adenomatózní polypózou nebo její atenuovanou formou (tj. 15,9 %) a dále u 32 z 200 pacientů v kontrolní skupině (tj. 16 %). Rozdíl ve výskytu substituce mezi pacienty s polypózou a kontrolní skupinou nebyl statisticky významný (p = 0,979; test chí-kvadrát).

Diskuze

Jednonukleotidová substituce c.645+32C>T v intronu 5 genu APC je relativně často zachycována u pacientů s familiární adenomatózní polypózou nebo její atenuovanou formou. Její patogenní význam není jasný. Z výsledků naší studie vyplývá, že se tato substituce vyskytuje přibližně u 16 % české populace, tedy se stejnou frekvencí jako u pacientů se střevní polypózou. Vzhledem k prevalenci výskytu familiární adenomatózní polypózy včetně její atenuované formy u 1 na 5000 až 7500 jedinců (1) se tedy v případě této substituce jedná o nepatogenní polymorfismus, tedy populační variantu, jejíž nosičství pro příslušnou osobu nepředstavuje zvýšené riziko střevní polypózy.

Zkratky

APC – z angl. „adenomatous polyposis coli“

DGGE – denaturační gradientová gelová elektroforéza

PCR – z angl. „polymerase chain reaction“

Děkujeme RNDr. Janě Zapletalové, Ph.D. za provedení statistické analýzy.

Práce byla podpořena projekty IGA Ministerstva zdravotnictví ČR č. NR/9092-3 a Ministerstva školství, mládeže a tělovýchovy ČR č. MŠM 0021620808.

MUDr. Pavlína Plevová

Oddělení lékařské genetiky FN

tř. 17. listopadu 1790, 708 52 Ostrava

fax: +420 596 917 340, e-mail: pavlina.plevova@volny.cz


Zdroje

1. Štekrová, J., Šulová, M., Zídková, K. et al.: Familiární adenomatózní polypóza – novinky v molekulární diagnostice. Klin. Onkol., 2006, 19 (Suppl.), s. 63–67.

2. Olschwang, S., Laurent-Puig, P., Groden, J. et al.: Germ-line mutations in the first 14 exons of the adenomatous polyposis coli (APC) gene. Am. J. Hum. Genet., 1993a, 52, s. 273–279.

3. Olschwang, S., Tiret, A., Laurent-Puig, P. et al.: Restriction of ocular fundus lesions to a specific subgroup of APC mutations in adenomatous polyposis coli patients. Cell, 1993b, 75, s. 959–968.

Štítky
Adiktologie Alergologie a imunologie Angiologie Audiologie a foniatrie Biochemie Dermatologie Dětská gastroenterologie Dětská chirurgie Dětská kardiologie Dětská neurologie Dětská otorinolaryngologie Dětská psychiatrie Dětská revmatologie Diabetologie Farmacie Chirurgie cévní Algeziologie Dentální hygienistka

Článek vyšel v časopise

Časopis lékařů českých


Nejčtenější v tomto čísle

Tomuto tématu se dále věnují…


Kurzy

Zvyšte si kvalifikaci online z pohodlí domova

Jistoty a nástrahy antikoagulační léčby aneb kardiolog - neurolog - farmakolog - nefrolog - právník diskutují
nový kurz
Autoři: doc. MUDr. Štěpán Havránek, Ph.D., prof. MUDr. Roman Herzig, Ph.D., doc. MUDr. Karel Urbánek, Ph.D., prim. MUDr. Jan Vachek, MUDr. et Mgr. Jolana Těšínová, Ph.D.

Léčba akutní pooperační bolesti
Autoři: doc. MUDr. Jiří Málek, CSc.

Nové antipsychotikum kariprazin v léčbě schizofrenie
Autoři: Prof. MUDr. Cyril Höschl, DrSc., FRCPsych.

Familiární transthyretinová periferní polyneuropatie
Autoři: MUDr. Radim Mazanec, Ph.D.

Diabetes mellitus a kardiovaskulární riziko, možnosti jeho ovlivnění
Autoři:

Všechny kurzy
Kurzy Doporučená témata Časopisy
Přihlášení
Zapomenuté heslo

Nemáte účet?  Registrujte se

Zapomenuté heslo

Zadejte e-mailovou adresu se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.

Přihlášení

Nemáte účet?  Registrujte se