-
Články
- Vzdělávání
- Časopisy
Top články
Nové číslo
- Témata
- Kongresy
- Videa
- Podcasty
Nové podcasty
Reklama- Práce v oboru
Doporučené pozice
Reklama- Praxe
APOBEC3A is a prominent cytidine deaminase in breast cancer
Authors: Luis M. Cortez aff001; Amber L. Brown aff001; Madeline A. Dennis aff001; Christopher D. Collins aff001; Alexander J. Brown aff001; Debra Mitchell aff001; Tony M. Mertz aff001; Steven A. Roberts aff001
Authors place of work: School of Molecular Biosciences and Center for Reproductive Biology, Washington State University, Pullman, WA, United States of America aff001; Department of Biochemistry and Molecular Biology, University of Kansas Medical Center, Kansas City, KS, United States of America aff002; School of Molecular Biosciences, Washington State University-Vancouver, Vancouver, WA, United States of America aff003
Published in the journal: APOBEC3A is a prominent cytidine deaminase in breast cancer. PLoS Genet 15(12): e1008545. doi:10.1371/journal.pgen.1008545
Category: Research Article
doi: https://doi.org/10.1371/journal.pgen.1008545Summary
APOBEC cytidine deaminases are the second-most prominent source of mutagenesis in sequenced tumors. Previous studies have proposed that APOBEC3B (A3B) is the major source of mutagenesis in breast cancer (BRCA). We show that APOBEC3A (A3A) is the only APOBEC whose expression correlates with APOBEC-induced mutation load and that A3A expression is responsible for cytidine deamination in multiple BRCA cell lines. Comparative analysis of A3A and A3B expression by qRT-PCR, RSEM-normalized RNA-seq, and unambiguous RNA-seq validated the use of RNA-seq to measure APOBEC expression, which indicates that A3A is the primary correlate with APOBEC-mutation load in primary BRCA tumors. We also demonstrate that A3A has >100-fold more cytidine deamination activity than A3B in the presence of cellular RNA, likely explaining why higher levels of A3B expression contributes less to mutagenesis in BRCA. Our findings identify A3A as a major source of cytidine deaminase activity in breast cancer cells and possibly a prominent contributor to the APOBEC mutation signature.
Keywords:
Gene expression – Haplotypes – Sequence motif analysis – RNA extraction – Mutagenesis – RNA sequencing – Genetic causes of cancer – BT474 cells
Introduction
Apolipoprotein B mRNA-editing enzyme catalytic polypeptide-like (APOBEC) cytidine deaminases are a major cause of mutation in approximately 15% of sequenced human tumors [1–3]. While these enzymes play diverse physiological roles, including contributing to antibody diversification and restricting viral pathogenesis [4], their off-target activity towards genomic DNA frequently causes oncogenic PIK3CA mutations [5], creates genetic diversity within cancer genomes [6], and contributes to chemotherapeutic resistance [7]. In addition, the high frequency of APOBEC-induced genome instability in tumors has led to exploration of APOBEC-activity as a potential target for cancer therapeutics[8–10]. APOBECs induce mutations in a sequence-specific manner, with the majority of APOBEC3 family members preferentially deaminating the central cytidine in TCW trinucleotide motifs (where W = A or T; deaminated based is underlined) within single stranded (ss) DNA [4]. Consequently, APOBEC-mutated tumors are largely identified by a dramatic over-representation of C to T and C to G substitutions within TCW sequences [11, 12], which forms the basis of APOBEC-induced mutation signatures 2 and 13 in cancer genomes [3]. APOBEC-induced mutations in tumors display replication strand bias [13–15], high density clustering around DNA translocation sites (termed kataegis) [11, 12], and frequently occur in hairpin forming sequences [16], all of which have been recapitulated in experimental systems exogenously expressing APOBECs [8, 17–21], which further reinforces the consensus that APOBECs are the underlying cause of this distinctive class of tumor-specific genetic instability.
Identifying the specific cytidine deaminases responsible for cancer mutagenesis and the relative contribution of each APOBEC to genomic instability in different cancer types is an ongoing area of research with many clinical implications. However, significant homology and functional redundancy between the 11 APOBEC enzymes encoded by the human genome has hindered such efforts. Nine APOBECs display catalytic activity towards ssDNA and only APOBEC3G (A3G) and Activation-Induced Cytidine Deaminase (AID) deaminate cytidines in sequences differing from the canonical TCW motif that is deaminated by the remaining seven enzymes [4]. Recent efforts to characterize the potential mutagenic activity of APOBECs have focused primarily on cellular localization and APOBEC mRNA expression levels [22, 23]. Of the APOBECs capable of causing APOBEC-signature mutations, APOBEC3DE (A3DE) and APOBEC3F (A3F) are predominantly cytoplasmic, A3A and APOBEC3C (A3C) display pan-cellular localization, and only APOBEC1, A3B and APOBEC3H (A3H) haplotype I are primarily nuclear [24–26]. A3B is also highly expressed in BRCA and reduction of A3B expression by short hairpin RNA (shRNA) decreased cytidine deaminase activity and levels of deoxyurdine (dU) in genomic DNA in some BRCA cell lines [22]. In addition, a positive correlation between A3B expression and the total mutation load in APOBEC-mutated tumor types indicates A3B may be the predominant source of APOBEC-induced mutations in multiple cancer types including breast, bladder, cervical, lung (adeno - and squamous cell), and head-and-neck cancers [2, 22].
Approximately 22% of humans carry a deletion polymorphism resulting in loss of the APOBEC3B gene [27]. Sequencing of BRCA tumors from individuals with the APOBEC3B deletion polymorphism revealed that these tumors frequently contained APOBEC-induced mutations and often at higher abundance than tumors from non-carriers [28]. Additionally, deletion of exon 5 of APOBEC3B is common in human BRCA [29], which results in ablation of A3B protein. Thus, additional APOBEC enzymes besides A3B almost certainly cause APOBEC-signature mutations during tumor development. Bioinformatics analysis of APOBEC-induced mutations from a limited number of A3B deleted BRCA tumors revealed that the only tumors displaying the APOBEC mutation signature also contained the nuclear A3H haplotype I [23], providing correlative evidence that this protein may be the additional source of mutagenesis. The protein abundance of A3H haplotype I, however, is low due to impaired stability of the protein [30]. Alternatively, endogenous A3A was previously shown to be capable of deaminating genomic DNA in human macrophages and myeloid cells [31, 32]. In addition, A3A and A3B prefer tetranucleotide motifs, YTCA and RTCA (Y = T or C and R = G or A) respectively, when inducing mutations in model systems. However, over-representation of mutations in the YTCA motif predominates in a variety of cancers [33] as well as among mutations actively acquired in BRCA cell lines [34], suggesting A3A may likewise contribute to cancer mutagenesis. Still, this association currently remains correlative. Ultimately, multiple lines of conflicting data have led to an unclear understanding as to the relative contributions of individual APOBECs to mutagenesis in cancer.
Here, we provide evidence that indicates A3A may be a major cause of APOBEC-induced mutation in BRCA. Using analysis of mutations from 28 whole exome sequenced BRCA cell lines and the corresponding expression of APOBEC3 family members determined by qRT-PCR, we show that only A3A expression was elevated in APOBEC-mutated lines compared to non-APOBEC-mutated lines and that the overall abundance of APOBEC-induced mutations linearly correlates with A3A expression. We also found that an A3B-targetting shRNA, which was used throughout the seminal study showing that A3B activity is responsible for cytidine deamination activity, accumulation of dU, and C-to-T mutations in BRCA [22], also decreases endogenous A3A mRNA levels up to 13.8-fold. These finding prompted us to reevaluate the relative contribution of APOBECs to BRCA mutagenesis. By selective depletion of A3A and A3B from cell populations with shRNAs, we demonstrate that A3A is responsible for the majority of cytidine deaminase activity in extracts from multiple BRCA cell lines, despite A3B’s higher expression. We provide evidence this discordance between expression and deaminase activity results from higher intrinsic activity of A3A and severe inhibition of A3B by cellular RNA. Finally, we used a novel analysis of RNA-seq reads limited to the unique 5’ and 3’ portions of the A3A and A3B transcripts (termed unambiguous RNA-seq) to validate that RNA-seq provides an accurate assessment of APOBEC expression, which subsequently reveals a greater positive correlation between A3A expression and APOBEC-signature mutations in primary BRCA tumors sequenced by The Cancer Genome Atlas (TCGA) than exists between A3B expression and mutagenesis. These results indicate that A3A expression is likely a principal determinant of the APOBEC mutation signature in BRCA.
Results
APOBEC3A is a probable source of APOBEC-signature mutations in APOBEC3B null cell lines
To identify APOBECs besides A3B that produce mutagenesis in BRCA, we evaluated the mutation signatures of a panel of BRCA cell lines to identify A3B null lines that are APOBEC mutated. We found that autologous BRCA cell lines SKBR3 and AU565 display a strong APOBEC mutation signature, as indicated by a high proportion of mutations involving C to T and C to G substitutions in TCW trinucleotide sequences (Fig 1A and S1 Table). This signature was present despite the lack of functional A3B due to both cell lines being homozygous for the 29.5kb A3B deletion polymorphism [35]. We therefore assessed the mRNA expression level of all seven APOBEC3 family members in SKBR3 and AU565 by qRT-PCR using previously published primers displaying high specificity for individual APOBEC3 family members [36], to identify candidate APOBECs that may be responsible for the observed mutation signature. As previously reported [22, 37] and consistent with both SKBR3 and AU565 being A3B-null, no A3B mRNA was detected in these cell lines. The remaining six APOBEC3 genes had detectable mRNA expression (Fig 1B and S2 Table) including A3A, which is often reported to have undetectable expression in BRCA lines [22, 23]. Remarkably, A3A displayed expression comparable to the remaining APOBEC3 family members, including A3H, which was previously suggested to act as a BRCA mutator in the absence of A3B [23]. The relatively high expression of A3A suggested that it may generate the APOBEC mutation signature in SKBR3 and AU565.
Fig. 1. APOBEC3A is the predominant cytidine deaminase in BRCA cell lines lacking APOBEC3B. APOBEC3A is the primary source of cytidine deamination activity in APOBEC3B null AU565 and SKBR3 cell lines
To ascertain if A3A could act as a mutator in cultured BRCA cells, we evaluated cytidine deaminase activity from whole-cell extracts generated from the AU565 and SKBR3 cell lines. We conducted deamination assays with either a 5’ Cy5-labeled linear oligonucleotide substrate (containing a single TCA sequence) or a 5’ Cy5-labeled oligonucleotide that self-anneals into an 11 bp stem and 4 nucleotide loop hairpin structure containing a single TCA trinucleotide in the loop. The sequence of this hairpin substrate was previously identified as a hotspot of APOBEC mutagenesis in breast cancers [16], likely due to A3A’s affinity for hairpin structures [38, 39] because the enzyme bind U-shaped ssDNAs [38, 40]. Cytidine deaminase activity at the TCA sequence in these substrates creates a deoxyuridine base, which can subsequently be converted to a heat liable abasic site by uracil-DNA glycosylase activity (Fig 1C). This enables measurement of cytidine deaminase activity by resolving the substrate from the shorter cleavage product on a denaturing polyacrylamide gel. A3B purified from HEK293T cells displayed comparable cytidine deaminase activity at cytidines in this stem loop compared to those in linear ssDNA (S1 Fig), while purified A3A moderately favored the hairpin forming substrate. Our results indicating that A3A is ~2-fold more active on hairpin structures than ssDNA differ from recently published results [39], which may indicate additional sequence context may modulate the efficiency that APOBECs act on structured DNA. We used the linear and hairpin substrates to initially compare deamination activity in extracts from AU565 or a clonal AU565 cell line containing a compound disruption of three alleles of the APOBEC3A gene introduced by CRISPR/Cas9 editing (S2 Fig). Both substrates were deaminated and cleaved in AU565 extracts, whereas no cleavage product was discernable in A3A-deleted AU565 extracts (Fig 1D). To confirm that substrate cleavage was mediated through A3A cytidine deaminase activity, we used lentiviral vectors to generate additional AU565 cell populations expressing an inhibitor of Ung2, Uracil Glycosylase Inhibitor (UGI) [41], or a matched empty-vector control in combination with expression of a scramble-control or A3A transcript-targeting shRNA that specifically reduced A3A mRNA expression as measured by qRT-PCR (Fig 1D). Extracts from cell populations expressing both the scramble shRNA control and the empty-vector control exhibited cleavage of the oligonucleotides that was abolished by UGI expression, which demonstrates cleavage is dependent on cytidine deaminase activity. Moreover, shRNA-mediated reduction of A3A-expression likewise inhibited substrate cleavage, strongly indicating that A3A is the predominant source of cytidine deamination activity in the AU565 BRCA cell line (Fig 1D). Similar requirements of A3A-expression and uninhibited Ung2 activity for both linear and hairpin substrate cleavage were observed in SKBR3 cells combinatorically transduced with empty-vector control, UGI expression vector, scramble shRNA control, and A3A-targeting shRNA (Fig 1E). To determine whether A3A was contributing cytidine deaminase activity solely in the absence of A3B and A3H haplotype I, we genotyped the A3H gene within AU565 and SKBR3. We found that these lines contain at least one A3H haplotype I allele (S3 Table), indicating that A3A is responsible for the majority of cytidine deaminase activity in these A3B-deficient cell lines, even in the presence of A3H haplotype I.
APOBEC3A is the only APOBEC3 family member with expression that correlates with APOBEC-induced mutation levels in BRCA cell lines
Given our results that cytidine deaminase activity in APOBEC-mutated cell lines SKBR3 and AU565 was primarily A3A-dependent, we decided to examine the possibility that A3A may play a greater role in APOBEC-catalyzed mutagenesis than previously thought. We began by classifying a panel of 28 BRCA cell lines as either APOBEC-mutagenized or not-APOBEC-mutagenized based on an over-representation of the APOBEC mutation signature as previously described [1]. Non-APOBEC-mutated cell lines displayed an average mutational signature profile consistent with deamination of methylated CpGs [3] (Fig 2A). In contrast, the average signature in those cell lines classified as APOBEC-mutated (Fig 2B), displayed the characteristic APOBEC mutation pattern: a predominance of mutations in the TC dinucleotide, the majority of which are C to G and C to T substitutions at the TCW trinucleotide [3]. We next measured the expression of all the APOBEC3 family members in these cell lines by qRT-PCR (Fig 2C and S2 Table). Consistent with previous reports [1, 2, 22, 37], we found that A3B was expressed at high levels compared to the other APOBEC3s. However, this high expression level existed in both APOBEC-mutagenized and non-APOBEC-mutagenized cell lines, indicating that elevated A3B mRNA levels may not be directly responsible for APOBEC-induced mutagenesis as previously suggested [1, 2, 22]. However, we are unable to exclude that elevated A3B protein level independent of changes in A3B mRNA levels may impact APOBEC mutagenesis. A median 13.1-fold higher A3A mRNA expression level was observed in the APOBEC-mutated BRCA lines compared to non-APOBEC-mutated lines (p = 0.0067 by Mann-Whitney). No other APOBEC3 family member displayed a significant difference in expression level between groups, suggesting A3A may be a major contributor to APOBEC mutagenesis in many BRCA cell lines. Directly plotting A3A expression against either the minimum estimate number of APOBEC-signature mutations or the number of COSMIC Signature 2 and 13 mutations in the 28 BRCA cell lines (mutation lists obtained from the Cancer Cell Line Encyclopedia) produced strong positive correlations (Pearson r = 0.61, p = 0.0006; Fig 2D and Pearson r = 0.70, p<0.0001 S3 Fig, respectively). However, no statistically significant correlation was detected between the abundance of A3B mRNA with the number of APOBEC-signature mutations in these lines. Similar correlations between A3A expression and either APOBEC-signature mutations or Signature 2 and 13 mutations was observed for mutation data from 27 BRCA cell lines obtained from the COSMIC database (Pearson r = 0.49, p = 0.01; Fig 2E and Pearson r = 0.60, p = 0.0009 S3 Fig, respectively). While these results are correlative and we are therefore unable to exclude the possibility of co-correlates that may underlie the association of A3A expression with the number of APOBEC-induced mutations, the simplest interpretation of these results is that A3A may be a predominant source of APOBEC-signature mutations in BRCA cell lines, even those expressing high levels of A3B.
Fig. 2. APOBEC3A mRNA transcript levels correlate with the extent of APOBEC-induced mutations in BRCA cell lines. APOBEC3A contributes to APOBEC-induced deamination activity in BRCA cell lines with high levels of APOBEC3B mRNA
We quantified the contribution of A3A and A3B to cytidine deaminase activity in the APOBEC-mutated cell lines BT474, CAMA-1, and MDA-MB-453, which respectively express 243-, 182-, and 269-fold higher A3B than A3A by qRT-PCR (S2 Table) and contain at least one A3H haplotype I allele each (S3 Table). Among the cell lines we analyzed, BT474 has the highest total number and largest proportion of APOBEC mutations (Fig 3A and 3B and S1 Table) and has detectable mRNA expression of all APOBEC3 enzymes, except APOBEC3DE (Fig 3C and S2 Table). We generated stable BT474 cell populations expressing a scramble-control shRNA, A3A-targeting shRNA, or A3B-targeting shRNA. Initial attempts with multiple A3B-targeting shRNAs, including shRNA TRCN0000140546 (A3B-1 in S4 Fig), used in [22], revealed non-specific 4 - to 13.8-fold knockdown of A3A (depending on cell line assessed) in addition to decreasing A3B expression, as intended. We therefore engineered additional shRNAs that respectively decreased A3A and A3B 58 - and 28-fold, without significant impact on other APOBEC3 family members (Fig 3D, S4 Fig, and S2 Table). As observed in AU565 and SKBR3 extracts, whole-cell extracts from parental BT474 cells and BT474 cells expressing the scrambled shRNA efficiently cleaved the hairpin DNA substrate. The addition of UGI to the reaction inhibited substrate cleavage, confirming that it was mediated through cytidine deaminase activity (Fig 3D). Despite A3B mRNA transcript levels being ~243-fold higher than A3A, knockdown of A3A expression surprisingly eliminated cytidine deaminase activity, while knockdown of A3B expression had no effect, which indicates that A3A is the dominant cytidine deaminase in BT474 cells. To ensure the lack of detectable A3B activity was not due to our hairpin substrate containing the A3A-favored YTCA tetranucleotide target sequence, we repeated this experiment with a substrate containing the A3B-preferred RTCA motif. Even with this optimal substrate for A3B activity, cytidine deaminase activity was nearly eliminated with decreased A3A expression, while 28-fold down-regulation of A3B failed to significantly impact activity (S5 Fig). Similar results were obtained with extracts from CAMA-1 and MDA-MB-453 cells expressing either scrambled shRNA, A3A-targeting shRNA, or A3B-targeting shRNA in which cytidine deaminase activity was almost entirely dependent on A3A expression (S6 Fig). Thus, A3A is a major source of cytidine deaminase activity in all five APOBEC-mutated cell lines we examined, which is a strong indicator that A3A may be largely responsible for APOBEC activity in most BRCA tumors.
Fig. 3. APOBEC3A is the predominant cytidine deaminase in BT474 cells expressing APOBEC3B. Cellular RNA severely inhibits APOBEC3B, but not APOBEC3A
The dominance of A3A in providing cytidine deaminase activity in APOBEC-mutated BRCA cell lines was surprising given the protein’s relatively low expression and prior results indicating A3B played this role [22, 42]. For the majority of cell lines tested, the previous cytidine deaminase assays that support a greater role for A3B in BRCA were conducted in the presence of 156 μg of RNaseA [42], while our experiments were performed without the removal of RNA from the extracts. Hence, we hypothesized that the presence of RNA in our cell extracts could account for the difference in results. Many APOBEC cytidine deaminases, including A3B, bind RNA [43–48], which frequently results in inhibition of cytidine deaminase activity. We therefore repeated our in vitro cytidine deaminase assay using BT474, CAMA-1, and MDA-MB-453 extracts that were treated with RNaseA to remove residual RNA. As expected, addition of RNaseA greatly increased overall cytidine deaminase activity in extracts from all three cell lines. Moreover, this increase was completely abolished by shRNA mediated knockdown of A3B (Fig 4A), indicating that the presence of RNA strongly inhibits A3B activity.
Fig. 4. APOBEC3A and APOBEC3B are differentially inhibited by RNA. Taken together, our cytidine deaminase activity assays in breast cancer cell extracts, suggests that A3A is the dominant cytidine deaminase active on hairpin substrates in the presence of RNA, while in the absence of RNA, A3B dominates. We verified this association by measuring the deamination of our hairpin substrate in cell extracts from 10 breast cancer cell lines that were either untreated or treated with RNAseA and comparing the activity to either A3A or A3B mRNA expression level (S7 Fig). This comparison revealed a strong correlation (Pearson r = 0.72 and p = 0.018) between A3A mRNA expression and cytidine deaminase activity in extracts that were not treated with RNAseA. In contrast, A3B mRNA expression strongly correlated with cytidine deaminase activity in extracts that were RNAseA treated (Pearson r = 0.89 and p = 0.0007). These results support that in BRCA cell lines A3A and A3B mRNA levels are strong surrogate measure of the protein level and cellular activities of the respective enzymes.
Previous work postulated that RNA binding to the N-terminal cytidine deaminase domain (CDD) of A3B may function as a negative regulator of A3B activity in human cells [48]. While A3A and the C-terminal CDD of A3B are ~90% identical, A3A lacks the N-terminal domain of A3B [4]. Hence, RNA-binding may differentially regulate the activity of A3A and A3B. To test this hypothesis, we purified full-length, strep-tagged A3A and A3B proteins from human HEK293T cells (Fig 4B) and assessed each protein’s sensitivity to RNA inhibition in vitro. Measurement of cytidine deaminase activity toward our hairpin DNA substrate indicated that A3A was 3-fold more active than A3B when incubated at near stoichiometric concentrations compared to substrate. However, A3A retained most of its activity even at a 1000 : 1 substrate to enzyme ratio, while A3B activity quickly decreased once diluted to sub-stoichiometric concentrations. This result indicates that, as when purified from E. coli [49], A3A from human cells is significantly more active (Fig 4C) than full-length A3B. Additionally, incubation of 500 nM A3A with up to 2000 ng/μL total RNA isolated from BT474 cells failed to significantly inhibit the enzyme, while as little as 1 ng/μL of total RNA began inhibiting A3B activity (Fig 4D and S8 Fig). A3B’s greater inhibition by RNA than A3A was apparent even when the amounts of these enzymes were reduced and scaled to similar activity levels (Fig 4E). A3B, but not A3A, was inhibited regardless of whether RNA was isolated from total cells, nuclei, or the cytoplasm (S9 Fig). In the presence of 100 ng/μl RNA, A3A is >100 fold more active than A3B. Given the typical human cell contains ~10 pg of RNA [50], the diameter of BRCA cells fall in the range of 12.07 to 15.08 μm [51], and the average concentration of RNA is ~3.5 fold higher in the cytoplasm than nucleus of mammalian cells [52], a minimum estimate of the RNA concentration within the nucleus of BRCA cells is ~1616 ng/μL. Considering our results that A3B cytidine deaminase activity is nearly undetectable in the presence of 100 ng/μL RNA, it is likely that A3B activity is severely inhibited by RNA in cells, enabling A3A to be the primary cytidine deaminase despite its lower expression level. A recent study determined that A3H, which has also been suggested to be a BRCA tumor mutator [23], is also inhibited by RNA binding due to a patch of five basic amino acids within the A3H CCD [45]. The homologous region of A3A only contains two basic amino acids in this region (S10 Fig) providing further structural insights into A3A’s unique resistance to RNA. Hence, negative regulation of both A3B and A3H deamination activity by RNA likely reduces their ability to damage genomic DNA as compared to A3A.
APOBEC3A expression correlates with APOBEC-induced mutagenesis in primary BRCA tumors
Because our data implicates A3A as a major source of cytidine deaminase activity and mutagenesis in many BRCA cell lines, we sought to determine whether A3A also contributed to the mutagenesis of primary BRCA tumors. Prior analyses had observed a positive correlation for both A3A and A3B mRNA expression levels with the number of APOBEC-induced mutations in 483 primary breast cancers characterized by TCGA [1]. However, it was postulated that the observed correlation between A3A expression and APOBEC-induced mutation load could stem from mis-mapping of RNA-seq reads from A3B’s C-terminal cytidine deaminase domain (CDD) to the highly homologous CDD of the A3A [23]. We therefore assessed the accuracy of RNA-seq in determining the expression levels of A3A and A3B by comparing transcript measurements from BRCA cell lines using qRT-PCR, RSEM normalized RNA-seq, and RNA-seq only utilizing reads that mapped to the unique regions of A3A and A3B transcripts (Fig 5A). Comparison of qRT-PCR measurements to RSEM normalized RNA-seq (obtained from the Cancer Cell Encyclopedia) for 21 BRCA cell lines revealed a strong positive correlation between the methods for both A3A transcript and A3B transcripts (Fig 5B, S1 Table, and S2 Table), indicating that RNA-seq based analyses are likely accurate in their discrimination between these genes. Further supporting this, re-analysis of A3A and A3B transcript levels only utilizing RNA-seq reads mapping to unique regions of A3A and A3B (referred to as unambiguous RNA-seq) produced similarly strong positive correlations with both qRT-PCR based measurements (Fig 5B) and RSEM normalized RNA-seq values (S11 Fig). Comparison of the A3A and A3B expression levels for 1207 TCGA-characterized BRCA tumors measured by unambiguous RNA-seq and RSEM-normalized RNA-seq, likewise showed a very strong positive correlation (S11 Fig; Pearson r = 0.91 and 0.96, for A3A and A3B respectively), again indicating that RSEM-normalized RNA-seq accurately depicts both A3A and A3B expression. Comparison of A3A and A3B expression to APOBEC-induced mutation load (by either the minimal estimate of APOBEC-signature mutations or the number of COSMIC Signature 2 and 13 mutations) for 973 of these tumors recapitulated previously published results depicting a modest but highly significant positive correlation for both genes. Assuming that the correlations of A3A and A3B mRNA levels with mutagenesis are independent of other unknown correlates and indicative of elevated protein level of these enzymes, these results suggest that both A3A and A3B likely participate in the mutagenesis of some specific samples (Fig 5C and S12 Fig). However, the positive correlation was stronger for A3A expression compared to A3B expression, suggesting that A3A may play a larger role in primary BRCA tumor mutagenesis. Moreover, when restricting the correlation analysis to the 229 APOBEC mutagenized BRCA tumors, we still observed a significant correlation between A3A expression and APOBEC mutation load (Pearson rho = 0.16, p = 0.01) while no correlation was evident for A3B expression (Fig 5D). This result indicates that A3A expression may directly influence the extent of mutagenesis in BRCA, while additional factors in combination with higher A3B expression are needed for A3B-mediated mutagenesis to occur. Similar results were observed with correlation analyses comparing A3A and A3B unambiguous RNA-seq to APOBEC-induced mutation loads (Pearson rho = 0.14, p = 0.03 for A3A expression). A3A and A3B expression have been previously shown to correlate with each other [23] (S13 Fig) and therefore the relationship between elevated A3A expression on the abundance of APOBEC-induced mutation could in theory result from higher A3B expression in the APOBEC-mutated tumors with high A3A expression. We therefore, repeated this analysis with a subset of BRCA tumors where in the lowest quartile for A3B expression. As with the entire BRCA dataset, A3A expression still positively correlated with APOBEC-induced mutation load despite limited A3B expression (S13 Fig; Pearson rho = 0.23, p = 0.0003 and Pearson rho = 0.33, p = 0.03 for all low-A3B BRCA tumors and APOBEC-mutated low-A3B BRCA tumors, respectively). Conversely, no correlation was detected between A3B expression and APOBEC-signature mutations in tumors with low A3A expression. Thus, this comparative analysis of APOBEC expression data supports a major role for A3A in breast cancer mutagenesis independent of A3B.
Fig. 5. APOBEC3A expression correlates with the abundance of APOBEC-induced mutations in primary BRCA tumors, despite the similarity between APOBEC3A and APOBEC3B transcripts. (A) The pairwise alignment of the A3A (blue) and A3B (red) transcripts shows a central region of high sequence identity with two unique regions in each transcript. Green, yellow, and red indicate 100%, ≥30%, and <30% identity respectively. Arrows indicate the position of qRT-PCR primers. (B) Correlations between qRT-PCR measurements of A3A or A3B mRNA abundance and corresponding RSEM normalized RNA-seq measurements or RNA-seq measurements limited to reads mapping within the defined unique regions of A3A and A3B transcripts (unambiguous RNA-seq) for BRCA cell lines were assessed by Pearson correlation test. A3A and A3B expression measured by RSEM normalized RNA-seq or unambiguous RNA-seq was compared to the minimum estimate of APOBEC-induced mutations in (C) 973 TCGA sequenced primary BRCA tumors or (D) a subset of 229 APOBEC-mutated TCGA sequenced primary BRCA tumors by Pearson correlation test. We note that the strength of the correlation between A3A and APOBEC mutagenesis in primary BRCA tumors is significantly less than observed among BRCA cell lines. Multiple differences in the sample sets may explain this discrepancy, including the existence of modulators of APOBEC-driven mutagenesis and episodic mutation events that are specific to the tumor environment. Furthermore, tumors samples contain subpopulations of tumors cells and contamination with non-tumor cells that increases cellular heterogeneity, which adversely affects correlation analyses for RNA-seq expression data. Alternatively, failure of APOBEC mRNA expression levels to accurately predict the protein level of these enzymes or the presence of additional factors beyond A3A expression level that influence the amount of APOBEC-induce mutation could also weaken the correlation of A3A mRNA level with mutation in primary tumors. Our initial analysis of A3A and A3B activity in BRCA cell lines (S7 Fig) supports that A3A and A3B mRNA levels are strong indicators of their respective enzyme’s activity, however, whether this correlation extends to primary tumors is unknown. We cannot exclude however the possibility of other unknown tumor specific characteristics, such as differences in the level of Ung2 activity, that may also influence the correlation between A3A expression and APOBEC mutation load.
APOBEC3A expression correlates with APOBEC-induced mutagenesis in tumors from multiple cancer types
We next decided to evaluate whether A3A expression also predicts the amount of APOBEC-induced mutation in other cancer types to assess whether A3A may significantly contribute to mutagenesis beyond BRCA. We therefore downloaded RSEM-normalized RNA-seq values for A3A, A3B, and HPRT1 from 410 bladder cancers (BLCA), 197 cervical cancers (CESC), and 549 head and neck cancers (HNSC) from the TCGA. The comparison of A3A and A3B expression to the abundance of APOBEC-induced mutations showed significant correlation of both APOBECs with mutagenesis among all assessed tumors (Fig 6, S1 Table, and S2 Table). The extent of correlation was also similar in BLCA and HNSC (Pearson rho = 0.22 for A3A and 0.28 for A3B in BLCA and 0.25 for A3A and 0.21 for A3B in HNSC), while A3A expression correlated more strongly than A3B in CESC (Pearson rho = 0.36 for A3A and 0.20 for A3B). These correlations support A3A as a significant mutator in cancers beyond BRCA. As with BRCA, however, only A3A expression continued to correlate with the amount of APOBEC-induced mutation among APOBEC-mutagenized tumors in all three cancer types, which indicates that A3A expression itself likely determines the extent of mutagenesis in these tumors. In contrast, A3B expression only correlated with APOBEC-induced mutation in BLCA APOBEC-mutated tumors. Therefore, A3B expression appears to be higher in APOBEC-mutagenized CESC and HNSC tumors, but additional factors are likely required to enable A3B-mediated mutation in these cancers.
Fig. 6. Correlation of A3A expression with APOBEC-induced mutations in multiple cancer types. RSEM normalized RNA-seq values for A3A (blue) and A3B (red) were obtained for 410 bladder (BLCA), 197 cervical (CESC), and 549 head and neck (HNSC) cancers assessed by the Cancer Genome Atlas. Expression of each APOBEC was normalized to HPRT1 and compared to the minimum estimate of APOBEC-induced mutations in the corresponding samples. A3A expression strongly correlates with mutagenesis in each tumor type by Pearson correlation analysis even when only evaluating APOBEC mutated tumors. Discussion
Previous studies have implicated multiple APOBEC cytidine deaminases in establishing the APOBEC mutation signature within breast cancers [22, 23, 33]. Prior to our study, seminal work by Harris and colleagues had provided the only experimental evidence of an endogenously expressed APOBEC3 protein contributing to cellular cytidine deamination activity and mutagenesis [22]. They utilized shRNA-mediated knockdown of A3B in specific BRCA cell lines and observed lower amounts of cytidine deaminase activity in whole cell extracts, lower levels of genomic dU, and decreased mutation of an HSV-TK mutation reporter. Two additional reports utilized bioinformatics analyses to suggest A3H haplotype I [23] and A3A [33] as plausible APOBECs additionally contributing to cancer mutagenesis. Harris and colleagues found that some A3B deleted BRCA tumors still maintained APOBEC signature mutations. Careful examination of the A3H haplotypes of the assessed tumors revealed that all the APOBEC mutated, A3B-deleted tumors had at least one A3H haplotype I allele, suggesting that A3H haplotype I may be contributing to mutagenesis [23]. However, no experimental evidence of endogenously expressed A3H haplotype I activity was provided. In addition, Gordenin and colleagues determined that A3A may contribute significantly to cancer mutagenesis through the assessment of extended mutation signatures specific to A3A and A3B [33]. By expressing each enzyme in yeast and analyzing the resulting mutation spectra of the CAN1 forward mutation reporter, they determined that A3A and A3B have differential preference at the -2 nucleotide of the target motif, where A3A prefers YTCA while A3B prefers RTCA. Analysis of thousands of whole genome sequenced tumors determined that the majority of APOBEC-mutagenized tumors contained mutations over-represented in YTCA sequences compared to RTCA, suggesting that A3A may be a major cancer mutator, though similar to the Harris study on A3H haplotype I, experimental evidence supporting detectable cytidine deaminase activity of endogenously expressed A3A was lacking. In fact, several groups recently argued that A3A has little to no role in cancer mutagenesis [23] because; (1) A3B and A3A can deaminate each other’s preferred motifs and these extended mutation signatures were generated from a yeast system expressing the human APOBEC proteins, which may not fully recapitulate the substrate preferences of individual APOBECs in human cells, (2) A3A is often lowly expressed and (3) cell imaging experiments have indicated that endogenous A3A is primarily cytosolic in localization [53].Thus, A3A seemed ill-positioned to induce mutations in chromosomal DNA, especially considering the lack of prior evidence of detectable endogenous A3A cytidine deaminase activity. Taken together, previous studies paint an unclear picture as to the importance of individual APOBECs to BRCA mutagenesis and there are several strongly held, prevalent, opposing opinions as to the relative contribution of A3A, A3B, and A3H haplotype I.
Our data is consistent with A3A being responsible for APOBEC deaminase-derived mutations in most BRCA tumors. Here, we show that APOBEC-mutagenized BRCA cell lines have higher A3A expression levels compared to non-APOBEC mutagenized lines and that A3A expression alone correlates with the number of APOBEC-signature mutations. Moreover, we demonstrate in whole-cell extracts from five APOBEC-mutagenized cell lines that A3A provides the majority of cytidine deaminase activity, which indicates A3A is ubiquitously present and active in APOBEC-mutated BRCA cells. In the presence of cellular RNA, A3A contributes significantly to cytidine deaminase activity, even from extracts from BRCA cell lines with elevated A3B expression and containing A3H haplotype I, indicating that in some cellular contexts, A3A is the dominant APOBEC present in the cell. The prevalent contribution of A3A to cellular cytidine deaminase activity, despite A3B mRNA transcripts being ~2-orders of magnitude higher than A3A, is likely due in part to the higher intrinsic activity of A3A compared to A3B, as well as strong inhibition of both purified and cellular A3B by RNA. A3A expression likely contributes to mutagenesis within primary breast cancers as A3A mRNA transcript levels positively correlate with APOBEC-induced mutation load, when expression is measured by RNA-seq or our novel unambiguous RNA-seq. In contrast to A3B expression, A3A transcript levels also correlated with APOBEC-induced mutation load when limiting the analysis to APOBEC-mutated tumors. These results provide experimental and computational evidence supporting our conclusion that elevated A3A expression is likely responsible most APOBEC-induced mutations in breast cancer.
We also found that levels of A3A mRNA transcripts have a stronger linear correlation with APOBEC-induced mutagenesis than does A3B transcript levels among BRCA cell lines and for primary BRCA, CESC, and HNSC tumors indicating that A3A likely contributes significantly to APOBEC-induced mutation across multiple cancer types. While one previous report using immunohistochemistry suggested that endogenous A3A was localized primarily within the cytoplasm (which would make A3A-induced mutagenesis difficult) [53], multiple reports indicate a pan-cellular localization of A3A [25, 53, 54] due to passive diffusion of this small 22 kDa protein through the nuclear membrane [53]. This existence of some A3A within the nucleus is supported by other data showing that exogenous expression of A3A, even at levels less than seen in interferon activated CD14+ cells, causes cytotoxicity and DNA damage [53–55]. This genomic DNA damage has since been determined to be replication-dependent in human cells, consistent with the pattern of APOBEC-induced mutation in tumors, [20, 55]. Upregulation of endogenous A3A also can cause DNA damage in some cell lines [31], indicating that A3A activity can occur in the nucleus. A3A expression has been reported to be elevated in response to the A3B germline deletion polymorphism both in cell line systems [35] and in oral cancers carrying the polymorphism [56], suggesting that elevated endogenous A3A expression likely also contributes to genetic instability in cancer cells.
Modest correlation of A3B expression with the amount of APOBEC-induced mutations in BRCA, BLCA, CESC, and HSNC cancers indicates that along with A3A, A3B likely contributes to the mutagenesis of some human tumors. This is supported by the analysis of the -2 nucleotide preference in whole genome sequenced tumors, which identified a subset of BRCA tumors that were enriched for mutations within the A3B preferred RTCA motif [33]. However, these tumors were fewer in number and contained fewer mutations, which is consistent with our results showing A3B has much lower activity compared to A3A at near cellular RNA levels. Germline polymorphisms in the A3B gene have been linked to higher levels of the protein and elevated amounts of mutagenesis in bladder cancers [57]. Correspondingly, other common polymorphisms in the APOBEC3 locus associate with reduced A3B expression and RTCA mutagenesis in pan-cancer analyses [58]. These specific associations between germline sequence in the APOBEC3B region and modulation of the APOBEC mutation signature in cancers provide evidence for its potential as a cancer mutator and are validated by experimental evidence indicating that reduction of A3B can be anti-mutagenic [22] and recent determination that endogenous A3B is responsible for induced kataegis events in RPE-1 cells [59]. The discovery that several APOBEC-targeting shRNAs (including one used in the seminal Burns et al. manuscript [22] to decrease A3B expression) also significantly decrease A3A expression makes it difficult to ascertain from some reports whether the observed phenotypes are the result of A3A or A3B down-regulation. Moreover, A3A expression correlates more strongly with APOBEC-induced mutagenesis in each of these cancer types and, unlike A3B expression, continues to correlate when solely assessing APOBEC-mutagenized tumors, indicating that the level of A3A expression is one of the primary factors dictating the extent of mutation in these cells.
Our work suggests that A3A may be a better candidate than A3H haplotype I in causing the APOBEC mutation signature in A3B deleted breast cancers. In contrast to A3A, both A3B and A3H haplotype I [44, 45] are strongly inhibited by RNA indicating that both enzymes likely require activation for activity in cells, similar to what has been reported for the related APOBECs, AID [60, 61] and APOBEC3G [62]. However, any mechanism for relieving RNA inhibition of A3B or A3H is currently unknown. While inhibition of A3B by RNA is likely relieved by some mechanism, we were unable to detect any A3H haplotype I activity in AU565 or SKBR3 cells (that have at least one A3H haplotype I allele) even when assessing deaminase activity a linear oligonucleotide substrate, which A3H prefers [39]. This observation suggests that A3H haplotype I may maintain insufficient activity in cells to act as a tumor mutator. A3H haplotype I is the most common haplotype in humans, occurring at an allele frequency of ~50% based on prior estimates [30, 63, 64]. Therefore, >98% of tumors are likely to have at least one A3B or A3H haplotype I allele. Consistent with this, the initial implication of A3H haplotype I in cancer mutagenesis is based on the absence of APOBEC signature mutations in three A3B deleted non-A3H haplotype I breast cancers [23]. Since only ~25% of BRCA tumors are APOBEC mutagenized [1], approximately 42% of the time randomly sampling would produce three non-APOBEC-mutated BRCA tumors, making it impossible to conclude lack of A3H-haplotype I is responsible for the absence of the APOBEC mutation signature.
A3A expression significantly correlates with APOBEC-signature mutations in BRCA cell lines and primary tumors, but tumors often significantly deviate from this trend. One possible explanation for variation in the observed frequency of APOBEC signature mutations is the existence of modifiers of APOBEC activity that differ among tumor samples. Identification and characterization of the mechanisms that control APOBEC-activity in tumors and determining the relative contributions of A3A, A3B, and A3H in tumors of different cancer types will be key to facilitating researchers’ and clinicians’ efforts to develop treatments for APOBEC-mutagenized tumors. Our results that RNA binding dramatically inhibits A3B, but not A3A, activity highlights a potential role for RNA binding as key APOBEC regulator. Future studies are needed to determine if A3B is similarly inhibited by RNA in all cellular contexts, or if cellular factors like post-translational modification, alternative splicing, or cell type-specific protein interactions allow A3B to be more active against genomic DNA in the presence of RNA. Other mechanisms that regulate the mutagenic capacity of APOBECs and protect the genome of human cells also likely exist. In addition to its inhibition by RNA, PKA phosphorylation of A3B at residue T214 limits A3B’s ability to bind ssDNA and deaminate the substrate [65], likely providing and additional negative regulator of A3B-induced mutagenesis. Similarly, Tribbles3 has been reported to inhibit A3A in human cells through its mediation of proteasome independent A3A degradation [66], providing one plausible control on aberrant A3A activity. Beyond direct modification of APOBEC proteins, repair of APOBEC-induced lesions or control of ssDNA substrate availability likely also influence the extent of APOBEC-induced mutation. We previously found in yeast that recombination-mediated error-free bypass reduces APOBEC-induced mutagenesis [67] and speculate a similar repair mechanism may exist in human cells and that specific repair capacities in human cells might influence the accumulation of APOBEC-signature mutations in cancer. Furthermore, APOBECs’ ability to access genomic ssDNA may be modulated by the amount of replication stress tumor cells experience due to specific combinations of oncogenes and tumor-suppressor mutations. Variation in the activity of these control mechanisms may affect the accumulation of APOBEC-signature mutations in tumors. Some of these regulatory mechanisms may function transiently within cells and thereby contribute to the episodic occurrence of the APOBEC mutation signature reported in cultured BRCA cells [34]. Currently, the cellular contexts in which these regulatory mechanisms operate as well as how they are modulated during cancer development remain unclear. Characterizing these mechanisms that regulate APOBEC-induced mutagenesis during carcinogenesis will be essential to fully understanding the roles of APOBEC enzymes in cancer etiology.
Materials and methods
RNA-seq and primary tumor mutation data sets
RSEM RNA-seq expression values for BRCA cell lines and TCGA sequenced primary tumors were obtained from the Cancer Cell Line Encyclopedia (https://data.broadinstitute.org/ccle/CCLE_RNAseq_rsem_transcripts_tpm_20180929.txt.gz) and the Broad Institute Genomic Data Analysis Center (http://gdac.broadinstitute.org/runs/stddata__2016_01_28/data/BRCA/20160128/gdac.broadinstitute.org_BRCA.Merge_rnaseqv2__illuminahiseq_rnaseqv2__unc_edu__Level_3__RSEM_genes_normalized__data.Level_3.2016012800.0.0.tar.gz; http://gdac.broadinstitute.org/runs/stddata__2016_01_28/data/BLCA/20160128/gdac.broadinstitute.org_BLCA.Merge_rnaseqv2__illuminahiseq_rnaseqv2__unc_edu__Level_3__RSEM_genes_normalized__data.Level_3.2016012800.0.0.tar.gz; http://gdac.broadinstitute.org/runs/stddata__2016_01_28/data/CESC/20160128/gdac.broadinstitute.org_CESC.Merge_rnaseqv2__illuminahiseq_rnaseqv2__unc_edu__Level_3__RSEM_genes__data.Level_3.2016012800.0.0.tar.gz; and http://gdac.broadinstitute.org/runs/stddata__2016_01_28/data/HNSC/20160128/gdac.broadinstitute.org_HNSC.Merge_rnaseqv2__illuminahiseq_rnaseqv2__unc_edu__Level_3__RSEM_genes_normalized__data.Level_3.2016012800.0.0.tar.gz), respectively. Raw RNA-seq reads for unambiguous RNA-seq analysis were obtained from the NCBI Short Read Archive for BRCA cell lines in the GEO series “Transcriptional profiling of a breast cancer cell line panel using RNAseq technology” (GEO accession number: GSE48213). Similar raw RNA-seq reads for TCGA sequenced primary BRCA tumors were downloaded as BAM Slices from the controlled-access portion of the NCI Genomics Data Commons (https://portal.gdc.cancer.gov/). Lists of mutations identified in BRCA cell lines were downloaded from the Cancer Cell Line Encyclopedia (https://data.broadinstitute.org/ccle/CCLE_DepMap_18Q1_maf_20180207.txt) and the COSMIC database (CosmicCLP_MutantExport.tsv.gz from https://cancer.sanger.ac.uk/cell_lines/download), while primary tumor mutations were obtained from http://gdac.broadinstitute.org/runs/stddata__2016_01_28/data/BRCA/20160128/gdac.broadinstitute.org_BRCA.Mutation_Packager_Oncotated_Calls.Level_3.2016012800.0.0.tar.gz; http://gdac.broadinstitute.org/runs/stddata__2016_01_28/data/BLCA/20160128/gdac.broadinstitute.org_BLCA.Mutation_Packager_Oncotated_Calls.Level_3.2016012800.0.0.tar.gz; http://gdac.broadinstitute.org/runs/stddata__2016_01_28/data/CESC/20160128/gdac.broadinstitute.org_CESC.Mutation_Packager_Oncotated_Calls.Level_3.2016012800.0.0.tar.gz; and http://gdac.broadinstitute.org/runs/stddata__2016_01_28/data/HNSC/20160128/gdac.broadinstitute.org_HNSC.Mutation_Packager_Oncotated_Calls.Level_3.2016012800.0.0.tar.gz.
Cell culture
All breast cancer cell lines were obtained directly from ATCC as part of a breast cancer cell line panel, ATCC 30-4500K, and cultured utilizing conditions specified by ATCC. Antibiotic concentrations used for establishing stable cell populations are listed in (S4 Table). HEK293T cells were passaged in DMEM + 10% FBS at 5% CO2.
shRNA mediated knockdown of APOBECs in BRCA cell lines
Oligonucleotides containing shRNA sequences targeting A3A, A3B, and a non-targeting scrambled sequence were cloned into pLKO.1 hygro (Addgene, #24150) to create lentiviral shRNA expression plasmids pTM-66 (A3A-shRNA), pTM-382 (A3B-shRNA-1), pTM-383 (A3B-shRNA-2), and pTM-238 (non-targeting shRNA). Plasmids psPAX2 (Addgene, #12260), pMD2.G (Addgene, #12259), and individual lentiviral shRNA plasmids were co-transfected into HEK293T cells for production of lentivirus. All the shRNA target sequences and oligonucleotides used for cloning are listed in S5 Table. Cell-free lentiviral supernatant was collected and used to transduce target cells in the presence of 8 μg/mL polybrene (MilliporeSigma) or Lentiblast transduction reagent (OZ biosciences), which was diluted 1 : 250 into lentiviral supernatant. Stable cell populations were selected with HygromycinB at concentrations listed in S4 Table. Although there are three mismatches between A3B-shRNA-1 and the A3A transcript-1 mRNA sequence, this shRNA, which is equivalent to Broad Institute TRCN0000140546, reduced A3A expression (S4 Fig). Therefore, pTM-383 (A3B-shRNA-2) was used for all A3B knockdown experiments.
Generation of A3A CRISPR/Cas9 knockout lines
Oligonucleotides corresponding to five A3A-targeting gRNA sequences were cloned into the BsaI site of pGL3-U6-sgRNA-PGK-puromycin (Addgene, #51133) to create plasmids expressing sgRNAs targeting A3A. All the sgRNA target sequences and oligonucleotides used to create these plasmids are listed in the S5 Table. AU565 derived A3A knockout cell lines were generated by transiently co-transfecting AU565 cells with pST1374-nls-flag-cas9 (Addgene, #44758) and all five plasmids expressing A3A specific gRNAs. Cells expressing both Cas9 and gRNA were transiently selected by the addition of puromycin and blasticidin to the cell culture media for 3 days. Surviving cells were plated at approximately 100 cells / 10 cm dish and clonal cell lines were isolated via cloning cylinders. A3A knockouts were confirmed by PCR and sequencing using primers oTM-499 and oTM-501 (S2 Fig).
Measurement of gene expression by qRT-PCR
RNA was isolated from cell populations in log-phase growth using homogenizer columns and a total RNA kit (Omega Bio-tek) and treated with DNAse I (ThermoFisher). cDNA was generated by combining 2 μg of denatured RNA from each sample with a reaction mixture (2.5 μM oligo dT23VN and 3.5 μM random hexamers, 0.5 mM dNTPs, 1x ProtoScript II Buffer, 10 mM DTT, 400U Protoscript II RT (NEB), and 16 U RNase Inhibitor (Superase-IN, Invitrogen) in a total volume of 40 μL. Reactions mixtures were incubated at 42°C for 1 hr, then 65°C for 20min and cDNA was stored at -20°C. qPCR was performed using 2 μL template with 1x SsoAdvanced Universal SYBR Green Supermix (Bio-Rad) and 0.2 μM primers (20 μL total reaction volume) on a Bio-Rad CFX96. Reactions were incubated at 95°C for 5 mins, then run for 40 cycles of 95°C for 10 s and 62.5°C for 1 min. Analysis of melt curves indicated singular products for all quantified products. Additionally, the qRT-PCR products were separated on an agarose gel to verify the products were of the expected sizes and lacked non-specific amplification (S14A Fig). The identities of qPCR products were validated by cloning products into plasmid pCR-Blunt (ThermoFisher) and sequencing 10 independent clones per qPCR reaction (S14B Fig). In order to minimize potentially confounding batch effects, the location of samples and primer sets was partially randomized using R x64 3.4.3. Primers for quantifying APOBEC transcripts are described in [36] and listed in the S5 Table.
APOBEC3H haplotyping
cDNA was generated as described under the methods for qRT-PCR, except for the use of 5 μM oligo dT23VN as a primer. A3H was amplified utilizing KOD hot start DNA polymerase (MilliporeSigma) and a nested PCR approach. Products from 34 cycles of PCR with primers oTM-885 and oTM-883 were column purified and amplified for an additional 30 cycles with oTM-196 and oTM-884. The products were purified via PEG precipitation, cloned into pCR-Blunt, and Sanger sequenced with oTM-196 and oTM-884. Haplotypes were assigned as in [64].
Mutation analysis in BRCA cell lines and TCGA tumors
Mutation lists for BRCA cell lines (from the Cancer Cell Line Encyclopedia and COSMIC) and TCGA-BRCA tumors (from the Broad GDAC) where subjected to statistical analyses similar to [1] to determine whether each sample was APOBEC-mutated, the total number of APOBEC - and non-APOBEC-induced mutations, and the minimum estimate of APOBEC-induced mutations. For the analysis of total mutation load in BRCA samples, the total number of APOBEC-induced mutations was determined as the number of TCW to TTW and TCW to TGW (including the complementary mutations WGA to WAA and WGA to WCA). Non-APOBEC-induced mutations were classified as all other mutations observed in the samples. APOBEC-mutated samples were defined as samples containing more APOBEC-induced mutations than expected by random mutagenesis. This was assessed statistically using a Fisher’s exact test comparing the number of APOBEC-induced mutations and non-APOBEC-induced mutations to the ratio of TCW to C bases (complementary sequences were combined) in a 40 bp window surrounding each mutation in a BRCA cell line from the COSMIC mutation list. Fisher’s exact p-values were adjusted for multiple hypothesis testing by Benjamini-Hochberg. BRCA cell lines with adjusted p-values of less than 0.05 with an odds ratio greater than 2 were classified as APOBEC-mutagenized; cell lines that did not meet these criteria were deemed non-APOBEC mutagenized. For comparisons of A3A and A3B expression to APOBEC-induced mutations, Log10 transformed qRT-PCR values, RSEM normalized RNA-seq values, or normalized unambiguous RNA-seq read values were compared to Log10 transformed values of the minimum estimate of APOBEC mutations. The minimum estimate of APOBEC-induced mutations in each sample was defined as the number of TCW to TTW and TCW to TGW (including the complementary mutations WGA to WAA and WGA to WCA) mutations in excess of what would be expected by random mutagenesis. Samples without a statistical over-representation of APOBEC-induced mutations display a minimum estimate of APOBEC-induced mutations equal to zero. Mutations in BRCA cell lines (obtained from the Cancer Cell Line Encyclopedia and COSMIC Cell Line Project) and TCGA-sequenced primary BRCA tumors were also de-convoluted into the COSMIC mutation signatures using the Mutational Patterns module in R [68]. The number of mutations occurring in Signatures 2 and 13 were totaled and Log10 transformed to compare to A3A and A3B expression.
Lentiviral vectors for expression of UGI, APOBEC3A, and APOBEC3B
Plasmid pLenti CMV Puro DEST (Addgene, #17452) was modified in a series of cloning steps to create pTM-637, a lentiviral destination vector suitable for gateway cloning. pTM-637 has a modified CMV promoter for reduced expression and contains a pair of TETO sequences, which allows for doxycycline-induced expression in cells expressing TETR, and the CMV promoter and gateway module is orientated opposite the 5’ UTR. These attributes of pTM-637 prevent the expression of transgenes cloned into gateway module from being expressed in HEK-293T-TETR during lentiviral production, which was key for consistent production of high-titer lentivirus for the APOBEC expression vectors described below. Synthetic DNA fragments corresponding to the coding sequence (CDS) of A3A transcript 1 (NCBI accession NM_145699.4) with A3A intron 3, a C-terminal flexible linker and Strep-tag (A3A-geneblock) and the CDS of A3B transcript 1 (NCBI accession NM_004900.5) with A3B intron 6, a C-terminal flexible linker and Strep-tag (A3B-geneblock) were amplified with phosphorylated oligos oTM-58 and oTM-59, digested with EcoRV, and cloned into the HincII and EcoRV sites of pENTR1A no ccDB (Addgene, #17398) to produce plasmids pTM-216 and pTM-218, respectively. LR-Clonase (ThermoFisher) reactions between pTM-637 and pTM-216 or pTM-218 produced lentiviral vectors pTM-664 (A3A expression) and pTM-666 (A3B expression).
A synthetic DNA sequence encoding human-codon optimized Uracil Glycosylase inhibitor (UGI) from Bacillus phage PBS2 was cloned into the EcoRV site of pENTR1A no ccDB to create pTM-775. A LR-Clonase reactions between pTM-775 and pLenti CMV Puro DEST or pLenti PGK Hygro DEST (Addgene, #19066) was used to create lentiviral vectors for UGI expression pTM-601 and pTM-553, respectively.
Sequences of synthetic DNA sequences used for A3A, A3B, and UGI cloning are provided in (S1 Text), GenBank formatted sequences for pTM-637, pTM-664, and pTM-666 will be made available from NCBI or Addgene (upon publication) and other sequences will be provided upon request.
Whole-cell extracts
Whole-cell lysates were produced from approximately 5x106 cells in log-phase growth. Prior to lysate generation, cells were washed twice with PBS, flash frozen in liquid nitrogen, and stored at -80°C. Lysates were generated by resuspending cells in 150 μL of lysis buffer (25mM HEPES, 150mM NaCl, 1mM EDTA, 10% Glycerol, 0.5% Triton X-100, and 2x Proteinase Inhibitor), and sonicating for 30 sec on setting “1” using a Misonix Sonicator 3000. Lysates were clarified by centrifugation at 13,000 g for 10 min at 4°C. Protein concentrations of lysates were measured by BCA assay and equal amounts of protein in lysates used for deaminase assays were confirmed by immunoblots as described below.
Purification of APOBEC3A and APOBEC3B
The cell populations used for purification of A3A and A3B proteins were created by sequential transduction of HEK-293T cells with pLenti CMV TetR Blast (Addgene, #17492), pTM-553 (UGI), and either pTM-664 (A3A) or pTM-666 (A3B). Induction of A3A and A3B expression was achieved by seeding 1X106 cells in 10 cm dishes in DMEM + 10% FBS + 2 μg/ml doxycycline. Cells were harvested at a density close to 9x106 cells per 10 cm, which corresponded to approximately 84 hours of growth, washed twice with PBS, and frozen in liquid nitrogen.
Lysates for A3A and A3B purification were similarly prepared from cell pellets harvested from approximately 60 - and 128–10 cm dishes, respectively. Cells lysates were prepared by addition of 30 mL of M-PER buffer (ThermoFisher) supplemented with 1 mM DTT and 2X Protease Inhibitor cocktail (SIGMAFAST, MilliporeSigma) and incubation at 4°C for 30 mins with gentle agitation. Lysates were subjected to three rounds of sonication on ice for 15 s on setting “5.5” using a Misonix Sonicator 3000. In order to reduce the nucleic acid content, MgCl2 and Benzonase (MilliporeSigma) were added to 1 mM and 40 U/mL respectively and lysates incubated at 4°C for 30 min. For A3B, RNAseA (Qiagen) was added to 6.6 μg/ml and the lysate was incubated 10 hours at 4°C, which was required to prevent RNA from co-purifying with A3B. To increase binding of the Strep-tagged protein and decrease non-specific protein binding during affinity purification, Tris-HCl pH 8, NaCl, and avidin were added to 15 mM, 50 mM, and 33 μg/mL respectively. Insoluble material was removed via centrifugation at 20,000 RCF for 30 mins and filtration through a 0.2 μM PES membrane.
A3A was purified as follows. A3A-Strep-tag was batch bound to 1 mL of Strep-Tactin Superflow Plus (Qiagen) at 4°C for 1 hr. The lysate was centrifuged at 400 RCF for 5 min at 4°C for and the supernatant removed from the Strep-Tactin resin. The Strep-Tactin resin was resuspended in 20 mL of buffer-1 (30 mM Tris-HCl (pH 7.9 at 25°C), 5% glycerol, 150 mM NaCl, 0.05% triton-100, 1 mM DTT) and transferred to a 1x20 cm glass econo-column. The Strep-Tactin resin was washed with an additional 40 mL of buffer-1 and A3A-strep-tag was eluted with buffer-1 containing 20 mM d-desthiobiotin. Fractions containing A3A-strep-tag were pooled and loaded to 1 mL Enrich-Q column (Bio-Rad) in buffer-1, washed with buffer-2 (30 mM Tris-HCl (pH 7.5 at 25°C), 5% glycerol, 150 mM NaCl, 0.05% triton-100, 1 mM DTT) and eluted utilizing a 20 mL linear gradient to 100% buffer-3 (30 mM Tris-HCl (pH 7.5 at 25°C), 5% glycerol, 1200 mM NaCl, 0.05% triton-100, 1 mM DTT). Purified A3A-strep-tag was extensively dialyzed in buffer-4 (30 mM Tris-HCl (pH 7.5 at 25°C), 10% glycerol, 150 mM NaCl, 0.05% triton-100, 1 mM DTT), frozen as aliquots in liquid nitrogen, and stored at -80°C.
A3B was purified as follows. A3B-Strep-tag containing lysate was loaded to a 1 mL Streptrap HP column (GE Healthcare) in buffer-5 (30 mM Tris-HCl (pH 7.9 at 25°C), 5% glycerol, 150 mM NaCl, 0.1% CHAPS, 1 mM DTT). The Streptrap HP column was then washed with 5 mL of buffer-5, 10 mL of buffer-6 (30 mM Tris-HCl (pH 7.9 at 25°C), 5% glycerol, 1000 mM NaCl, 0.1% CHAPS, 1 mM DTT) and 5 mL of buffer-7 (30 mM Tris-HCl (pH 7.9 at 25°C), 5% glycerol, 50 mM NaCl, 0.1% CHAPS, 1 mM DTT). A3B-strep-tag was eluted with buffer-7 containing 20 mM d-desthiobiotin. Approximately 6 mL of A3B-strep-tag containing fractions pooled and loaded to 1 mL Enrich-Q column (Bio-Rad) in buffer-1, washed with buffer-8 (30 mM Tris-HCl (pH 7.5 at 25°C), 5% glycerol, 50 mM NaCl, 0.1% CHAPS, 1 mM DTT) and eluted utilizing a 20 mL linear gradient to 100% buffer-9 (30 mM Tris-HCl (pH 7.5 at 25°C), 5% glycerol, 1200 mM NaCl, 0.1% CHAPS, 1 mM DTT) Purified A3B-strep-tag was extensively dialyzed in buffer-4 (30 mM Tris-HCl (pH 7.5 at 25°C), 10% glycerol, 150 mM NaCl, 0.05% CHAPS, 1 mM DTT), frozen as aliquots in liquid nitrogen, and stored at -80°C.
Measurement of deaminase activity
Deaminase activity assays were performed with linear oligonucleotide oTM-910, /5Cy5/T*T* T*GTAGATGTAGATGTAGATTCAGTAGTAGAGTATGTAGT* A*T*T* T, and hairpin forming oligonucleotide substrates hairpin forming oligonucleotide substrates oTM-814, /5Cy5/TTTTATTTTGCAATTGTTCAATTGCAAAATTT*G*T*T. In S5 Fig, cytidine deaminase activity was assessed on both oTM-814 and oTM-818, /5Cy5/TTTTATTTTGCAATTGATCAATTGCAAAATTT*G*T*T (the * denotes phosphorothioate bonds, which protect against nuclease degradation). These substrates contain a YTCA, the A3A preferred motif or RTCA, the A3B preferred motif respectively. All other experiments assessing APOBEC cytidine deaminase activity on a hairpin substrate used only oTM-814. Deaminase activity assays with purified APOBEC enzymes (with concentrations A3A or A3B as indicated, 5 units of Uracil DNA glycosylase (NEB), 0.25 μM oligonucleotide substrate, 20 mM Tris HCl pH7.5, 1 mM DTT, and 1 mM EDTA), in a 20 μL volume were incubated for 30 minutes (unless otherwise indicated) at 37°C and terminated by the addition of 20 μL formamide buffer (47.5% formamide, 9mM EDTA, and 0.0125% SDS) and incubation at 95°C for 10 min. Deaminase activity assays with whole-cell lysates (40 μg of cell lysate, 0.25 μM oligonucleotide substrate, 22.5 mM Tris pH 7.56, 2 mM KCl, 2.5 mM NaCl, 0.005%Triton X-100, 1.5 mM DTT, and 1.25 mM EDTA), in a 20 μL volume were incubated for 24 hrs (unless otherwise indicated) at 37°C and terminated by the addition of 20 μL formamide buffer (47.5% formamide, 9 mM EDTA, and 0.0125% SDS). Reactions were incubated at 95°C for 10 min and placed on ice prior to electrophoresis. Deaminase activity assays were separated on pre-warmed 15% polyacrylamide gels with 7.9 M urea (7 cm) in 1x TBE buffer at 15 W for 15 min. Gels were imaged on a BioRad Chemidoc using the Cy5 setting. Percent substrate cleaved was determined by quantification of the intensity of the substrate and cytidine deamination cleavage product using BioRad’s Image Lab software version 5.2.
RNA preparation from cytosolic and nuclear fractions
Nuclear and cytoplasmic RNA was prepared from 20–10 cm dishes of MDA-MB-453 cells. After harvesting the cells using trypsin, the cells were pelleted and washed twice with cold PBS. All subsequent steps were performed at 4°C. The cell pellet was resuspended in 10 mL of buffer CF (50 mM HEPES, 5 mM KCl, 140 mM NaCl, 1 mM EDTA, 0.8 M Hexylene Glycol, 1 mM DTT, 1X protease inhibitor cocktail) containing 25 μg/mL digitonin (MilliporeSigma) and incubated for 10 min with gentle agitation. This resulted in almost no cell lysis. The cells were pelleted by centrifugation at 2000 RCF for 10 minutes. The resulting cell pellet was resuspended in buffer CF supplemented with 0.5 mM NP-40 and incubated for 20 minutes with periodic gentle agitation. The nuclei were pelleted by centrifugation at 5000 RCF for 10 minutes. The supernatant (the cytoplasmic fraction) was removed, of which 1 mL was set aside for validation of fractionation by immunoblot. RNA was extracted from 7 mL of the cytoplasmic fraction by sequential phenol chloroform extraction, ethanol precipitation, and cleaned up using an RNA purification kit. The nuclei were washed 4 times in 40 mL of buffer CF. After the fourth wash, 10 percent of the total resuspended nuclei were transferred to a separate tube, pelleted, resuspended in buffer CF and lysed by sonication for validation of fractionation by immunoblot. The remaining nuclei were pelleted and used for RNA purification using an RNA purification kit.
Immunoblots
40 μg of protein from each extract or subcellular fraction were separated on pre-made Mini Protean TGX gels (Bio-Rad) and run at 180 V for 35 min in 1xTGS buffer (25 mM Tris, 250 mM Glycine, 0.1% SDS). Gels were transferred via a Mini-Transblot Cell (Bio-Rad), at 55 V for 90 min at 4°C onto Immun-Blot PVDF membrane (BioRad) in 1xTransfer buffer (25 mM Tris, 192 mM Glycine, 20% (v/v) Methanol). Membranes were blocked in 2% ECL prime blocking reagent (GE Healthcare) in 1xTBST solution (20 mM Tris and 150 mM NaCl, 0.1% Tween-20). Anti-GAPDH (10494-I-AP, Proteintech), anti-TBP (8515S, Cell Signaling Technology), or anti-α-Tubulin (ab4074, Abcam) primary antibodies were used at 1 : 10000, 1 : 2000, and 1 : 20000 dilutions, respectively. A 1 : 20000 dilution of anti-rabbit secondary antibody (NA934-1ML, GE Healthcare) in 0.2% ECL Block in 1x TBST was used for all blots. Blots were developed with ECL Prime Western Blotting Detection Reagent (GE Healthcare) for 2 min before imaging on the BioRad Chemidoc MP Imaging System, using the Blots-Chemi setting.
Unambiguous RNA-seq
To measure A3A and A3B expression in BRCA cell lines by RNA-seq without the complication of reads potentially mis-mapping between the highly homologous regions of the two genes, we conducted a pairwise alignment of the major Refseq transcripts for the APOBEC3A and APOBEC3B genes (NCBI accession numbers NM_145699.3 and NM_004900.4, respectively) with the Geneious Alignment module in Geneious v10.2.2 using Global alignment with free end gaps and a 93% similarity cost matrix. Regions in the 5’ and 3’ of each transcript that contain low sequence identity were identified. Raw RNA-seq reads were aligned with BWA using default settings to a reference genome containing the APOBEC3A and APOBEC3B transcripts (NCBI accession numbers NM_145699.3 and NM_004900.4, respectively). Reads aligning to regions between nucleotides 1 and 350 in the APOBEC3A transcript and displaying a CIGARSTRING of 75M, 101M or 105M (indicating complete matching of the read to the reference) were counted for each BRCA cell line, increased by 0.5, and compared to the total number of reads within the corresponding sequencing library. Similarly, reads mapping to the 1 to 622 and 1371 to 1560 regions of the APOBEC3B transcript and displaying a CIGARSTRINGs of 75M, 101M or 105M were counted, augmented by 0.5, and normalized to the total number of reads per sample. These values were Log10 transformed for analyses comparing A3A and A3B expression to minimum estimates of APOBEC-induced mutation in BRCA cell lines. Unambiguous RNA-seq for A3A and A3B expression in BRCA tumors was conducted by counting reads mapping to the genomic coordinates chr22 : 38957522–38957715 and chr22 : 38962652–38963183 for A3A transcripts and chr22 : 38982399–38986411 and chr22 : 38992611–38992779 for A3B transcripts, augmenting the counts by 0.5, and dividing the resulting values by the number of reads mapping to the HPRT1 gene. As with unambiguous RNA-seq of BRCA cell lines, the normalized unambiguous RNA-seq values for BRCA tumors were Log10 transformed prior to statistical comparisons.
Supporting information
S1 Text [a]
Sequences of synthetic DNA molecules used to construct APOBEC and UGI expression vectors.S1 Fig [l]
A3A and A3B are more active on stem-loop substrates versus linear DNA substrates.S2 Fig [a]
Validation of CRISPR/Cas9 mediated deletion of APOBEC3A in AU565 cells.S3 Fig [tif]
Comparison of A3A and A3B expression to the number of COSMIC Signatures 2 and 13 mutations.S4 Fig [tif]
Specificity of shRNAs.S5 Fig [tif]
APOBEC3A is the predominant cytidine deaminase acting at RTCA motifs in BT474 cells.S6 Fig [a]
Abundant APOBEC3A cytidine deaminase activity in CAMA-1 and MDA-MB-453 cells.S7 Fig [tif]
Correlation of cytidine deaminase activity with A3A and A3B mRNA expression level in untreated and RNAseA treated BRCA cell extracts.S8 Fig [tif]
A3A activity in the presence of high amounts of cellular RNA.S9 Fig [a]
A3B, but not A3A is inhibited by nuclear and cytoplasmic RNA.S10 Fig [tif]
Alignment of the amino acid sequences for A3A and A3H.S11 Fig [tif]
Similarity between RSEM normalized RNA-seq and unambiguous RNA-seq measurements of APOBEC3A and APOBEC3B expression.S12 Fig [tif]
Comparison of A3A and A3B expression to the number of COSMIC Signatures 2 and 13 mutations in primary TCGA BRCA tumors.S13 Fig [tif]
Correlation of A3A mRNA transcript level with the abundance of APOBEC-signature mutations in BRCA tumors expressing A3B at low levels.S14 Fig [a]
Specificity of qRT-PCR products for APOBEC3 family members.S1 Table [xlsx]
Mutation characteristics of BRCA cell lines and primary tumors.S2 Table [xlsx]
APOBEC expression on BRCA cell lines and primary tumors.S3 Table [xlsx]
A3H Haplotypes of BRCA cell lines.S4 Table [xlsx]
Concentrations of antibiotics used to select transduced BRCA cells.S5 Table [xlsx]
Sequences of sgRNAs, shRNA targets, and oligonucleotides.S6 Table [xlsx]
Numerical values of cytidine deaminase activity assays in .
Zdroje
1. Roberts SA, Lawrence MS, Klimczak LJ, Grimm SA, Fargo D, Stojanov P, et al. An APOBEC cytidine deaminase mutagenesis pattern is widespread in human cancers. Nat Genet. 2013;45(9):970–6. Epub 2013/07/16. doi: 10.1038/ng.2702 23852170; PubMed Central PMCID: PMC3789062.
2. Burns MB, Temiz NA, Harris RS. Evidence for APOBEC3B mutagenesis in multiple human cancers. Nat Genet. 2013;45(9):977–83. Epub 2013/07/16. doi: 10.1038/ng.2701 23852168; PubMed Central PMCID: PMC3902892.
3. Alexandrov LB, Nik-Zainal S, Wedge DC, Aparicio SA, Behjati S, Biankin AV, et al. Signatures of mutational processes in human cancer. Nature. 2013;500(7463):415–21. Epub 2013/08/16. doi: 10.1038/nature12477 23945592; PubMed Central PMCID: PMC3776390.
4. Refsland EW, Harris RS. The APOBEC3 family of retroelement restriction factors. Curr Top Microbiol Immunol. 2013;371 : 1–27. Epub 2013/05/21. doi: 10.1007/978-3-642-37765-5_1 23686230; PubMed Central PMCID: PMC3934647.
5. Henderson S, Chakravarthy A, Su X, Boshoff C, Fenton TR. APOBEC-Mediated Cytosine Deamination Links PIK3CA Helical Domain Mutations to Human Papillomavirus-Driven Tumor Development. Cell Rep. 2014. Epub 2014/06/10. doi: 10.1016/j.celrep.2014.05.012 24910434.
6. Roper N, Gao S, Maity TK, Banday AR, Zhang X, Venugopalan A, et al. APOBEC Mutagenesis and Copy-Number Alterations Are Drivers of Proteogenomic Tumor Evolution and Heterogeneity in Metastatic Thoracic Tumors. Cell Rep. 2019;26(10):2651–66 e6. doi: 10.1016/j.celrep.2019.02.028 30840888.
7. Law EK, Sieuwerts AM, LaPara K, Leonard B, Starrett GJ, Molan AM, et al. The DNA cytosine deaminase APOBEC3B promotes tamoxifen resistance in ER-positive breast cancer. Sci Adv. 2016;2(10):e1601737. doi: 10.1126/sciadv.1601737 27730215; PubMed Central PMCID: PMC5055383.
8. Nikkila J, Kumar R, Campbell J, Brandsma I, Pemberton HN, Wallberg F, et al. Elevated APOBEC3B expression drives a kataegic-like mutation signature and replication stress-related therapeutic vulnerabilities in p53-defective cells. Br J Cancer. 2017;117(1):113–23. doi: 10.1038/bjc.2017.133 28535155; PubMed Central PMCID: PMC5520199.
9. Green AM, Budagyan K, Hayer KE, Reed MA, Savani MR, Wertheim GB, et al. Cytosine Deaminase APOBEC3A Sensitizes Leukemia Cells to Inhibition of the DNA Replication Checkpoint. Cancer Res. 2017;77(17):4579–88. doi: 10.1158/0008-5472.CAN-16-3394 28655787; PubMed Central PMCID: PMC5581702.
10. Buisson R, Lawrence MS, Benes CH, Zou L. APOBEC3A and APOBEC3B Activities Render Cancer Cells Susceptible to ATR Inhibition. Cancer Res. 2017;77(17):4567–78. doi: 10.1158/0008-5472.CAN-16-3389 28698210; PubMed Central PMCID: PMC5609510.
11. Roberts SA, Sterling J, Thompson C, Harris S, Mav D, Shah R, et al. Clustered mutations in yeast and in human cancers can arise from damaged long single-strand DNA regions. Mol Cell. 2012;46(4):424–35. Epub 2012/05/23. doi: 10.1016/j.molcel.2012.03.030 22607975; PubMed Central PMCID: PMC3361558.
12. Nik-Zainal S, Alexandrov LB, Wedge DC, Van Loo P, Greenman CD, Raine K, et al. Mutational processes molding the genomes of 21 breast cancers. Cell. 2012;149(5):979–93. doi: 10.1016/j.cell.2012.04.024 22608084; PubMed Central PMCID: PMC3414841.
13. Haradhvala NJ, Polak P, Stojanov P, Covington KR, Shinbrot E, Hess JM, et al. Mutational Strand Asymmetries in Cancer Genomes Reveal Mechanisms of DNA Damage and Repair. Cell. 2016;164(3):538–49. doi: 10.1016/j.cell.2015.12.050 26806129; PubMed Central PMCID: PMC4753048.
14. Morganella S, Alexandrov LB, Glodzik D, Zou X, Davies H, Staaf J, et al. The topography of mutational processes in breast cancer genomes. Nat Commun. 2016;7 : 11383. doi: 10.1038/ncomms11383 27136393; PubMed Central PMCID: PMC5001788.
15. Seplyarskiy VB, Soldatov RA, Popadin KY, Antonarakis SE, Bazykin GA, Nikolaev SI. APOBEC-induced mutations in human cancers are strongly enriched on the lagging DNA strand during replication. Genome Res. 2016;26(2):174–82. doi: 10.1101/gr.197046.115 26755635; PubMed Central PMCID: PMC4728370.
16. Nik-Zainal S, Davies H, Staaf J, Ramakrishna M, Glodzik D, Zou X, et al. Landscape of somatic mutations in 560 breast cancer whole-genome sequences. Nature. 2016;534(7605):47–54. doi: 10.1038/nature17676 27135926; PubMed Central PMCID: PMC4910866.
17. Bhagwat AS, Hao W, Townes JP, Lee H, Tang H, Foster PL. Strand-biased cytosine deamination at the replication fork causes cytosine to thymine mutations in Escherichia coli. Proc Natl Acad Sci U S A. 2016;113(8):2176–81. doi: 10.1073/pnas.1522325113 26839411; PubMed Central PMCID: PMC4776466.
18. Hoopes JI, Cortez LM, Mertz TM, Malc EP, Mieczkowski PA, Roberts SA. APOBEC3A and APOBEC3B Preferentially Deaminate the Lagging Strand Template during DNA Replication. Cell Rep. 2016;14(6):1273–82. doi: 10.1016/j.celrep.2016.01.021 26832400; PubMed Central PMCID: PMC4758883.
19. Saini N, Roberts SA, Sterling JF, Malc EP, Mieczkowski PA, Gordenin DA. APOBEC3B cytidine deaminase targets the non-transcribed strand of tRNA genes in yeast. DNA Repair (Amst). 2017;53 : 4–14. doi: 10.1016/j.dnarep.2017.03.003 28351647; PubMed Central PMCID: PMC5450012.
20. Green AM, Landry S, Budagyan K, Avgousti DC, Shalhout S, Bhagwat AS, et al. APOBEC3A damages the cellular genome during DNA replication. Cell Cycle. 2016;15(7):998–1008. doi: 10.1080/15384101.2016.1152426 26918916; PubMed Central PMCID: PMC4889253.
21. Taylor BJ, Nik-Zainal S, Wu YL, Stebbings LA, Raine K, Campbell PJ, et al. DNA deaminases induce break-associated mutation showers with implication of APOBEC3B and 3A in breast cancer kataegis. Elife. 2013;2:e00534. doi: 10.7554/eLife.00534 23599896; PubMed Central PMCID: PMC3628087.
22. Burns MB, Lackey L, Carpenter MA, Rathore A, Land AM, Leonard B, et al. APOBEC3B is an enzymatic source of mutation in breast cancer. Nature. 2013;494(7437):366–70. Epub 2013/02/08. doi: 10.1038/nature11881 23389445; PubMed Central PMCID: PMC3907282.
23. Starrett GJ, Luengas EM, McCann JL, Ebrahimi D, Temiz NA, Love RP, et al. The DNA cytosine deaminase APOBEC3H haplotype I likely contributes to breast and lung cancer mutagenesis. Nat Commun. 2016;7 : 12918. doi: 10.1038/ncomms12918 27650891; PubMed Central PMCID: PMC5036005.
24. Li MM, Emerman M. Polymorphism in human APOBEC3H affects a phenotype dominant for subcellular localization and antiviral activity. J Virol. 2011;85(16):8197–207. doi: 10.1128/JVI.00624-11 21653666; PubMed Central PMCID: PMC3147987.
25. Bogerd HP, Wiegand HL, Hulme AE, Garcia-Perez JL, O'Shea KS, Moran JV, et al. Cellular inhibitors of long interspersed element 1 and Alu retrotransposition. Proc Natl Acad Sci U S A. 2006;103(23):8780–5. Epub 2006/05/27. doi: 10.1073/pnas.0603313103 16728505; PubMed Central PMCID: PMC1482655.
26. Chester A, Somasekaram A, Tzimina M, Jarmuz A, Gisbourne J, O'Keefe R, et al. The apolipoprotein B mRNA editing complex performs a multifunctional cycle and suppresses nonsense-mediated decay. EMBO J. 2003;22(15):3971–82. doi: 10.1093/emboj/cdg369 12881431; PubMed Central PMCID: PMC169042.
27. Kidd JM, Newman TL, Tuzun E, Kaul R, Eichler EE. Population stratification of a common APOBEC gene deletion polymorphism. PLoS genetics. 2007;3(4):e63. doi: 10.1371/journal.pgen.0030063 17447845; PubMed Central PMCID: PMC1853121.
28. Nik-Zainal S, Wedge DC, Alexandrov LB, Petljak M, Butler AP, Bolli N, et al. Association of a germline copy number polymorphism of APOBEC3A and APOBEC3B with burden of putative APOBEC-dependent mutations in breast cancer. Nat Genet. 2014;46(5):487–91. doi: 10.1038/ng.2955 24728294; PubMed Central PMCID: PMC4137149.
29. Komatsu A, Nagasaki K, Fujimori M, Amano J, Miki Y. Identification of novel deletion polymorphisms in breast cancer. Int J Oncol. 2008;33(2):261–70. Epub 2008/07/19. 18636146.
30. OhAinle M, Kerns JA, Li MM, Malik HS, Emerman M. Antiretroelement activity of APOBEC3H was lost twice in recent human evolution. Cell Host Microbe. 2008;4(3):249–59. doi: 10.1016/j.chom.2008.07.005 18779051; PubMed Central PMCID: PMC2608726.
31. Suspene R, Mussil B, Laude H, Caval V, Berry N, Bouzidi MS, et al. Self-cytoplasmic DNA upregulates the mutator enzyme APOBEC3A leading to chromosomal DNA damage. Nucleic Acids Res. 2017;45(6):3231–41. doi: 10.1093/nar/gkx001 28100701; PubMed Central PMCID: PMC5389686.
32. Suspene R, Aynaud MM, Guetard D, Henry M, Eckhoff G, Marchio A, et al. Somatic hypermutation of human mitochondrial and nuclear DNA by APOBEC3 cytidine deaminases, a pathway for DNA catabolism. Proc Natl Acad Sci U S A. 2011;108(12):4858–63. doi: 10.1073/pnas.1009687108 21368204; PubMed Central PMCID: PMC3064337.
33. Chan K, Roberts SA, Klimczak LJ, Sterling JF, Saini N, Malc EP, et al. An APOBEC3A hypermutation signature is distinguishable from the signature of background mutagenesis by APOBEC3B in human cancers. Nat Genet. 2015;47(9):1067–72. doi: 10.1038/ng.3378 26258849; PubMed Central PMCID: PMC4594173.
34. Petljak M, Alexandrov LB, Brammeld JS, Price S, Wedge DC, Grossmann S, et al. Characterizing Mutational Signatures in Human Cancer Cell Lines Reveals Episodic APOBEC Mutagenesis. Cell. 2019;176(6):1282–94 e20. doi: 10.1016/j.cell.2019.02.012 30849372.
35. Caval V, Suspene R, Shapira M, Vartanian JP, Wain-Hobson S. A prevalent cancer susceptibility APOBEC3A hybrid allele bearing APOBEC3B 3'UTR enhances chromosomal DNA damage. Nat Commun. 2014;5 : 5129. doi: 10.1038/ncomms6129 25298230.
36. Refsland EW, Stenglein MD, Shindo K, Albin JS, Brown WL, Harris RS. Quantitative profiling of the full APOBEC3 mRNA repertoire in lymphocytes and tissues: implications for HIV-1 restriction. Nucleic Acids Res. 2010;38(13):4274–84. doi: 10.1093/nar/gkq174 20308164; PubMed Central PMCID: PMC2910054.
37. Periyasamy M, Patel H, Lai CF, Nguyen VTM, Nevedomskaya E, Harrod A, et al. APOBEC3B-Mediated Cytidine Deamination Is Required for Estrogen Receptor Action in Breast Cancer. Cell Rep. 2015;13(1):108–21. doi: 10.1016/j.celrep.2015.08.066 26411678; PubMed Central PMCID: PMC4597099.
38. Kouno T, Silvas TV, Hilbert BJ, Shandilya SMD, Bohn MF, Kelch BA, et al. Crystal structure of APOBEC3A bound to single-stranded DNA reveals structural basis for cytidine deamination and specificity. Nat Commun. 2017;8 : 15024. doi: 10.1038/ncomms15024 28452355; PubMed Central PMCID: PMC5414352.
39. Buisson R, Langenbucher A, Bowen D, Kwan EE, Benes CH, Zou L, et al. Passenger hotspot mutations in cancer driven by APOBEC3A and mesoscale genomic features. Science. 2019;364(6447). doi: 10.1126/science.aaw2872 31249028.
40. Shi K, Carpenter MA, Banerjee S, Shaban NM, Kurahashi K, Salamango DJ, et al. Structural basis for targeted DNA cytosine deamination and mutagenesis by APOBEC3A and APOBEC3B. Nat Struct Mol Biol. 2017;24(2):131–9. doi: 10.1038/nsmb.3344 27991903; PubMed Central PMCID: PMC5296220.
41. Di Noia J, Neuberger MS. Altering the pathway of immunoglobulin hypermutation by inhibiting uracil-DNA glycosylase. Nature. 2002;419(6902):43–8. doi: 10.1038/nature00981 12214226.
42. Kanu N, Cerone MA, Goh G, Zalmas LP, Bartkova J, Dietzen M, et al. DNA replication stress mediates APOBEC3 family mutagenesis in breast cancer. Genome Biol. 2016;17(1):185. doi: 10.1186/s13059-016-1042-9 27634334; PubMed Central PMCID: PMC5025597.
43. Smith HC. RNA binding to APOBEC deaminases; Not simply a substrate for C to U editing. RNA Biol. 2017;14(9):1153–65. doi: 10.1080/15476286.2016.1259783 27869537; PubMed Central PMCID: PMC5699538.
44. Feng Y, Wong L, Morse M, Rouzina I, Williams MC, Chelico L. RNA-Mediated Dimerization of the Human Deoxycytidine Deaminase APOBEC3H Influences Enzyme Activity and Interaction with Nucleic Acids. J Mol Biol. 2018;430(24):4891–907. doi: 10.1016/j.jmb.2018.11.006 30414963; PubMed Central PMCID: PMC6289724.
45. Shaban NM, Shi K, Lauer KV, Carpenter MA, Richards CM, Salamango D, et al. The Antiviral and Cancer Genomic DNA Deaminase APOBEC3H Is Regulated by an RNA-Mediated Dimerization Mechanism. Mol Cell. 2018;69(1):75–86 e9. doi: 10.1016/j.molcel.2017.12.010 29290613; PubMed Central PMCID: PMC5991973.
46. Bransteitter R, Pham P, Scharff MD, Goodman MF. Activation-induced cytidine deaminase deaminates deoxycytidine on single-stranded DNA but requires the action of RNase. Proc Natl Acad Sci U S A. 2003;100(7):4102–7. doi: 10.1073/pnas.0730835100 12651944; PubMed Central PMCID: PMC153055.
47. Chelico L, Pham P, Calabrese P, Goodman MF. APOBEC3G DNA deaminase acts processively 3' —> 5' on single-stranded DNA. Nat Struct Mol Biol. 2006;13(5):392–9. doi: 10.1038/nsmb1086 16622407.
48. Xiao X, Yang H, Arutiunian V, Fang Y, Besse G, Morimoto C, et al. Structural determinants of APOBEC3B non-catalytic domain for molecular assembly and catalytic regulation. Nucleic Acids Res. 2017;45(12):7540. doi: 10.1093/nar/gkx564 28645149; PubMed Central PMCID: PMC5499557.
49. Ito F, Fu Y, Kao SA, Yang H, Chen XS. Family-Wide Comparative Analysis of Cytidine and Methylcytidine Deamination by Eleven Human APOBEC Proteins. J Mol Biol. 2017;429(12):1787–99. doi: 10.1016/j.jmb.2017.04.021 28479091; PubMed Central PMCID: PMC5530319.
50. Tang F, Lao K, Surani MA. Development and applications of single-cell transcriptome analysis. Nat Methods. 2011;8(4 Suppl):S6–11. doi: 10.1038/nmeth.1557 21451510; PubMed Central PMCID: PMC3408593.
51. Liu Z, Lee Y, Jang J, Li Y, Han X, Yokoi K, et al. Microfluidic cytometric analysis of cancer cell transportability and invasiveness. Sci Rep. 2015;5 : 14272. doi: 10.1038/srep14272 26404901; PubMed Central PMCID: PMC4585905.
52. Zetterberg A. Nuclear and cytoplasmic nucleic acid content and cytoplasmic protein synthesis during interphase in mouse fibroblasts in vitro. Exp Cell Res. 1966;43(3):517–25. doi: 10.1016/0014-4827(66)90022-x 5957742.
53. Land AM, Law EK, Carpenter MA, Lackey L, Brown WL, Harris RS. Endogenous APOBEC3A DNA cytosine deaminase is cytoplasmic and nongenotoxic. J Biol Chem. 2013;288(24):17253–60. doi: 10.1074/jbc.M113.458661 23640892; PubMed Central PMCID: PMC3682529.
54. Mussil B, Suspene R, Aynaud MM, Gauvrit A, Vartanian JP, Wain-Hobson S. Human APOBEC3A isoforms translocate to the nucleus and induce DNA double strand breaks leading to cell stress and death. PLoS One. 2013;8(8):e73641. doi: 10.1371/journal.pone.0073641 23977391; PubMed Central PMCID: PMC3748023.
55. Landry S, Narvaiza I, Linfesty DC, Weitzman MD. APOBEC3A can activate the DNA damage response and cause cell-cycle arrest. EMBO Rep. 2011;12(5):444–50. doi: 10.1038/embor.2011.46 21460793; PubMed Central PMCID: PMC3090015.
56. Chen TW, Lee CC, Liu H, Wu CS, Pickering CR, Huang PJ, et al. APOBEC3A is an oral cancer prognostic biomarker in Taiwanese carriers of an APOBEC deletion polymorphism. Nat Commun. 2017;8(1):465. doi: 10.1038/s41467-017-00493-9 28878238; PubMed Central PMCID: PMC5587710.
57. Middlebrooks CD, Banday AR, Matsuda K, Udquim KI, Onabajo OO, Paquin A, et al. Association of germline variants in the APOBEC3 region with cancer risk and enrichment with APOBEC-signature mutations in tumors. Nat Genet. 2016;48(11):1330–8. doi: 10.1038/ng.3670 27643540.
58. Waszak SM, Tiao G, Zhu B, Rausch T, Muyas F, Rodriguez-Martin B, et al. Germline determinants of the somatic mutation landscape in 2,642 cancer genomes. bioRxiv. 2017 : 208330. doi: 10.1101/208330
59. Maciejowski J, Chatzipli A, Dananberg A, de Lange T, Campbell PJ. APOBEC3B-dependent kataegis and TREX1-driven chromothripsis in telomere crisis. bioRxiv. 2019 : 725366. doi: 10.1101/725366
60. Basu U, Meng FL, Keim C, Grinstein V, Pefanis E, Eccleston J, et al. The RNA exosome targets the AID cytidine deaminase to both strands of transcribed duplex DNA substrates. Cell. 2011;144(3):353–63. doi: 10.1016/j.cell.2011.01.001 21255825; PubMed Central PMCID: PMC3065114.
61. Pefanis E, Basu U. RNA Exosome Regulates AID DNA Mutator Activity in the B Cell Genome. Adv Immunol. 2015;127 : 257–308. doi: 10.1016/bs.ai.2015.04.002 26073986; PubMed Central PMCID: PMC4478610.
62. Soros VB, Yonemoto W, Greene WC. Newly synthesized APOBEC3G is incorporated into HIV virions, inhibited by HIV RNA, and subsequently activated by RNase H. PLoS Pathog. 2007;3(2):e15. doi: 10.1371/journal.ppat.0030015 17291161; PubMed Central PMCID: PMC1796622.
63. Wang X, Abudu A, Son S, Dang Y, Venta PJ, Zheng YH. Analysis of human APOBEC3H haplotypes and anti-human immunodeficiency virus type 1 activity. J Virol. 2011;85(7):3142–52. doi: 10.1128/JVI.02049-10 21270145; PubMed Central PMCID: PMC3067873.
64. Ebrahimi D, Richards CM, Carpenter MA, Wang J, Ikeda T, Becker JT, et al. Genetic and mechanistic basis for APOBEC3H alternative splicing, retrovirus restriction, and counteraction by HIV-1 protease. Nat Commun. 2018;9(1):4137. doi: 10.1038/s41467-018-06594-3 30297863; PubMed Central PMCID: PMC6175962.
65. Matsumoto T, Shirakawa K, Yokoyama M, Fukuda H, Sarca AD, Koyabu S, et al. Protein kinase A inhibits tumor mutator APOBEC3B through phosphorylation. Sci Rep. 2019;9(1):8307. doi: 10.1038/s41598-019-44407-9 31165764; PubMed Central PMCID: PMC6549188.
66. Aynaud MM, Suspene R, Vidalain PO, Mussil B, Guetard D, Tangy F, et al. Human Tribbles 3 protects nuclear DNA from cytidine deamination by APOBEC3A. J Biol Chem. 2012;287(46):39182–92. doi: 10.1074/jbc.M112.372722 22977230; PubMed Central PMCID: PMC3493958.
67. Hoopes JI, Hughes AL, Hobson LA, Cortez LM, Brown AJ, Roberts SA. Avoidance of APOBEC3B-induced mutation by error-free lesion bypass. Nucleic Acids Res. 2017;45(9):5243–54. doi: 10.1093/nar/gkx169 28334887; PubMed Central PMCID: PMC5605239.
68. Blokzijl F, Janssen R, van Boxtel R, Cuppen E. MutationalPatterns: comprehensive genome-wide analysis of mutational processes. Genome Med. 2018;10(1):33. doi: 10.1186/s13073-018-0539-0 29695279; PubMed Central PMCID: PMC5922316.
Štítky
Genetika Reprodukční medicína
Článek Selective breeding modifies mef2ca mutant incomplete penetrance by tuning the opposing Notch pathwayČlánek A transcriptome-based signature of pathological angiogenesis predicts breast cancer patient survivalČlánek A GWAS approach identifies Dapp1 as a determinant of air pollution-induced airway hyperreactivityČlánek Genetic determinants of genus—Level glycan diversity in a bacterial protein glycosylation system
Článek vyšel v časopisePLOS Genetics
Nejčtenější tento týden
2019 Číslo 12- Je „freeze-all“ pro všechny? Odborníci na fertilitu diskutovali na virtuálním summitu
- Kazuistika – Perspektivy využití precizované medicíny v rámci personalizované specifické terapie onkologických pacientů
- Nobelova cena za chemii pro genetické nůžky: Objev, který změní naši budoucnost?
- Technologie na bázi RNA v klinické praxi: od přebarvených petúnií k terapii vzácných a dosud jen obtížně léčitelných chorob u lidí
- „Nepředstavovali jsme si, že náš výzkum povede přímo ke vzniku nových léků, dokonce ještě za našeho života“
-
Všechny články tohoto čísla
- Crossover interference and sex-specific genetic maps shape identical by descent sharing in close relatives
- Identification of novel genes involved in phosphate accumulation in Lotus japonicus through Genome Wide Association mapping of root system architecture and anion content
- A mutant form of Dmc1 that bypasses the requirement for accessory protein Mei5-Sae3 reveals independent activities of Mei5-Sae3 and Rad51 in Dmc1 filament stability
- Restricted and non-essential redundancy of RNAi and piRNA pathways in mouse oocytes
- A candidate gene analysis and GWAS for genes associated with maternal nondisjunction of chromosome 21
- Experimental population modification of the malaria vector mosquito, Anopheles stephensi
- The polyamine transporter Slc18b1(VPAT) is important for both short and long time memory and for regulation of polyamine content in the brain
- Architecture of the Escherichia coli nucleoid
- Inhibition of FLT1 ameliorates muscular dystrophy phenotype by increased vasculature in a mouse model of Duchenne muscular dystrophy
- Leveraging allelic imbalance to refine fine-mapping for eQTL studies
- A transcriptome-based signature of pathological angiogenesis predicts breast cancer patient survival
- An autism-causing calcium channel variant functions with selective autophagy to alter axon targeting and behavior
- Are drug targets with genetic support twice as likely to be approved? Revised estimates of the impact of genetic support for drug mechanisms on the probability of drug approval
- Modulators of hormonal response regulate temporal fate specification in the Drosophila brain
- Common alleles of CMT2 and NRPE1 are major determinants of CHH methylation variation in Arabidopsis thaliana
- Defects in the GINS complex increase the instability of repetitive sequences via a recombination-dependent mechanism
- Use of >100,000 NHLBI Trans-Omics for Precision Medicine (TOPMed) Consortium whole genome sequences improves imputation quality and detection of rare variant associations in admixed African and Hispanic/Latino populations
- The MITF-SOX10 regulated long non-coding RNA DIRC3 is a melanoma tumour suppressor
- Latent transcriptional variations of individual Plasmodium falciparum uncovered by single-cell RNA-seq and fluorescence imaging
- Selective breeding modifies mef2ca mutant incomplete penetrance by tuning the opposing Notch pathway
- Mediator subunit MDT-15/MED15 and Nuclear Receptor HIZR-1/HNF4 cooperate to regulate toxic metal stress responses in Caenorhabditis elegans
- Identification of avoidance genes through neural pathway-specific forward optogenetics
- Common gardens in teosintes reveal the establishment of a syndrome of adaptation to altitude
- Drosophila RpS12 controls translation, growth, and cell competition through Xrp1
- An MCM family protein promotes interhomolog recombination by preventing precocious intersister repair of meiotic DSBs
- Correction: Large-scale genome-wide meta-analysis of polycystic ovary syndrome suggests shared genetic architecture for different diagnosis criteria
- Hybridization promotes asexual reproduction in Caenorhabditis nematodes
- Coacting enhancers can have complementary functions within gene regulatory networks and promote canalization
- Genome wide analysis reveals heparan sulfate epimerase modulates TDP-43 proteinopathy
- A GWAS approach identifies Dapp1 as a determinant of air pollution-induced airway hyperreactivity
- Genetic variation in GC and CYP2R1 affects 25-hydroxyvitamin D concentration and skeletal parameters: A genome-wide association study in 24-month-old Finnish children
- Genetic determinants of genus—Level glycan diversity in a bacterial protein glycosylation system
- A divergent CheW confers plasticity to nucleoid-associated chemosensory arrays
- Selection signatures in goats reveal copy number variants underlying breed-defining coat color phenotypes
- APOBEC3A is a prominent cytidine deaminase in breast cancer
- Phosphatidylserine synthetase regulates cellular homeostasis through distinct metabolic mechanisms
- Aspergillus fumigatus calcium-responsive transcription factors regulate cell wall architecture promoting stress tolerance, virulence and caspofungin resistance
- Zfh2 controls progenitor cell activation and differentiation in the adult Drosophila intestinal absorptive lineage
- CRISPR/Cas9 interrogation of the mouse Pcdhg gene cluster reveals a crucial isoform-specific role for Pcdhgc4
- Correction: Origins of DNA replication
- Characterization of Aspergillus nidulans TRAPPs uncovers unprecedented similarities between fungi and metazoans and reveals the modular assembly of TRAPPII
- BLISTER-regulated vegetative growth is dependent on the protein kinase domain of ER stress modulator IRE1A in Arabidopsis thaliana
- Cell elimination strategies upon identity switch via modulation of apterous in Drosophila wing disc
- PLOS Genetics
- Archiv čísel
- Aktuální číslo
- Informace o časopisu
Nejčtenější v tomto čísle- Aspergillus fumigatus calcium-responsive transcription factors regulate cell wall architecture promoting stress tolerance, virulence and caspofungin resistance
- Phosphatidylserine synthetase regulates cellular homeostasis through distinct metabolic mechanisms
- Architecture of the Escherichia coli nucleoid
- APOBEC3A is a prominent cytidine deaminase in breast cancer
Kurzy
Zvyšte si kvalifikaci online z pohodlí domova
Revma Focus: Spondyloartritidy
nový kurz
Autoři: prof. MUDr. Vladimír Palička, CSc., Dr.h.c., doc. MUDr. Václav Vyskočil, Ph.D., MUDr. Petr Kasalický, CSc., MUDr. Jan Rosa, Ing. Pavel Havlík, Ing. Jan Adam, Hana Hejnová, DiS., Jana Křenková
Autoři: MDDr. Eleonóra Ivančová, PhD., MHA
Autoři: prof. MUDr. Eva Kubala Havrdová, DrSc.
Všechny kurzyPřihlášení#ADS_BOTTOM_SCRIPTS#Zapomenuté hesloZadejte e-mailovou adresu, se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.
- Vzdělávání