Interplay between axonal Wnt5-Vang and dendritic Wnt5-Drl/Ryk signaling controls glomerular patterning in the Drosophila antennal lobe
Authors:
Huey Hing aff001; Noah Reger aff001; Jennifer Snyder aff001; Lee G. Fradkin aff002
Authors place of work:
Department of Biology, State University of New York at Brockport, Brockport, NY, United States of America
aff001; Department of Neurobiology, University of Massachusetts Medical School, Worcester, MA, United States of America
aff002
Published in the journal:
Interplay between axonal Wnt5-Vang and dendritic Wnt5-Drl/Ryk signaling controls glomerular patterning in the Drosophila antennal lobe. PLoS Genet 16(5): e32767. doi:10.1371/journal.pgen.1008767
Category:
Research Article
doi:
https://doi.org/10.1371/journal.pgen.1008767
Summary
Despite the importance of dendritic targeting in neural circuit assembly, the mechanisms by which it is controlled still remain incompletely understood. We previously showed that in the developing Drosophila antennal lobe, the Wnt5 protein forms a gradient that directs the ~45˚ rotation of a cluster of projection neuron (PN) dendrites, including the adjacent DA1 and VA1d dendrites. We report here that the Van Gogh (Vang) transmembrane planar cell polarity (PCP) protein is required for the rotation of the DA1/VA1d dendritic pair. Cell type-specific rescue and mosaic analyses showed that Vang functions in the olfactory receptor neurons (ORNs), suggesting a codependence of ORN axonal and PN dendritic targeting. Loss of Vang suppressed the repulsion of the VA1d dendrites by Wnt5, indicating that Wnt5 signals through Vang to direct the rotation of the DA1 and VA1d glomeruli. We observed that the Derailed (Drl)/Ryk atypical receptor tyrosine kinase is also required for the rotation of the DA1/VA1d dendritic pair. Antibody staining showed that Drl/Ryk is much more highly expressed by the DA1 dendrites than the adjacent VA1d dendrites. Mosaic and epistatic analyses showed that Drl/Ryk specifically functions in the DA1 dendrites in which it antagonizes the Wnt5-Vang repulsion and mediates the migration of the DA1 glomerulus towards Wnt5. Thus, the nascent DA1 and VA1d glomeruli appear to exhibit Drl/Ryk-dependent biphasic responses to Wnt5. Our work shows that the final patterning of the fly olfactory map is the result of an interplay between ORN axons and PN dendrites, wherein converging pre - and postsynaptic processes contribute key Wnt5 signaling components, allowing Wnt5 to orient the rotation of nascent synapses through a PCP mechanism.
Keywords:
Drosophila melanogaster – Phenotypes – Cloning – Neurites – Neuronal dendrites – Axons – Olfactory receptor neurons – Neuropil
Introduction
The prevailing view of neural circuit assembly is that axons and dendrites are separately guided by molecular gradients to their respective positions whereupon they form synapses with each other [1–4]. However, careful observation of developing neural circuits reveals that the process may be more complex. For example, in the developing retina outer plexiform layer (OPL) the axon terminals of rods and cones, and dendrites of their respective postsynaptic cells, the rod and cone bipolar cells, are initially intermingled in the nascent OPL [5]. Even as the rod and cone axons are connecting with their target dendrites, the terminals are segregating into rod - and cone-specific sub-laminae, suggesting that the processes of targeting and synaptic partner matching may be coordinated. Whether the two processes are functionally linked and what mechanisms might be involved are unknown.
The stereotyped neural circuit of the Drosophila olfactory map offers a unique opportunity to unravel the mechanisms of neural circuit development. Dendrites of 50 classes of uniglomerular projection neurons (PNs) form synapses with the axons of 50 classes of olfactory receptor neurons (ORNs) in the antennal lobe (AL) in unique glomeruli [6, 7]. This precise glomerular map is thought to be established during the pupal stage by the targeting of PN dendrites [8–10]. We previously reported that during the establishment of the fly olfactory map, two adjacent dendritic arbors located at the dorsolateral region of the AL, the DA1 and VA1d dendrites (hereafter referred to as the DA1/VA1d dendritic pair), undergo rotational migration of ~45˚ around each other to attain their final adult positions [11]. This rearrangement (in the lateral/90˚ → dorsal/0˚ → medial/270˚ → ventral/180˚ direction) occurs between 16 and 30 hour After Puparium Formation (hAPF), a period of major ORN axon ingrowth to the AL [8, 12, 13]. We showed that a Wnt5 signal guides this rotation by repelling the dendrites [11]. Wnt5 is expressed by a set of AL-extrinsic cells and forms a dorsolateral-high to ventromedial-low (DL>VM) gradient in the AL neuropil which provides a directional cue to align the dendritic pattern relative to the axes of the brain. We also showed that the Derailed (Drl)/Ryk kinase-dead receptor tyrosine kinase, a Wnt5 receptor [14–17], is differentially expressed by the PN dendrites, thus providing cell-intrinsic information for their targeting in the Wnt5 gradient. Interestingly, drl opposes Wnt5 repulsive signaling so that dendrites expressing high levels of drl terminate in regions of high Wnt5 concentration and vice versa. To further unravel the mechanisms of PN dendritic targeting, we have screened for more mutations that disrupt the rotation of the DA1/VA1d dendritic pair.
Here we report that mutations in the Van Gogh (Vang) gene disrupted the rotation of the DA1/VA1d dendritic pair, thus mimicking the Wnt5 mutant phenotype. Vang encodes a four-pass transmembrane protein [18, 19] of the core Planar Cell Polarity (PCP) group, an evolutionarily conserved signaling module that imparts polarity to cells [20, 21]. The loss of Vang suppressed the repulsion of the VA1d dendrites by Wnt5, indicating that Vang is a downstream component of Wnt5 signaling. Surprisingly, Vang acts in the ORNs, which suggests an obligatory codependence of ORN axon and PN dendritic migration. We also show that the drl gene is selectively expressed in the DA1 dendrites where it antagonizes Vang and appears to convert Wnt5 repulsion of the DA1 glomerulus into attraction. The opposing responses of the DA1 and VA1d glomeruli likely create the forces by which Wnt5 directs the rotation of the glomerular pair. Our work shows that converging pre - and postsynaptic processes contribute key signaling components of the Wnt5 pathway, allowing the processes to be co-guided by the Wnt5 signal.
Results
Vang promotes the rotation of DA1/VA1d dendrites
We have shown that during wild-type development the adjacent DA1 and VA1d dendrites rotate around each other, such that DA1 moves from its original position lateral to VA1d at 18 hAPF to its final position dorsolateral to VA1d in the adult, an ~45˚ rotation [11]. We also showed that this rotation requires the Wnt5 gene, for in the null Wnt5400 mutant the rotation is abolished, resulting in an adult DA1/VA1d angle of 76.03˚ ± 3.6˚ (N = 29, vs 29.32˚ ± 2.5˚, N = 22 in the Wnt5400/+ heterozygous control, Student’s t test p<0.0001) (See Materials and Methods and S1 Fig for quantification) (Fig 1A–1C). The DA1 and VA1d pair of dendrites were visualized by expressing UAS-mCD8::GFP under the control of Mz19-Gal4, which specifically labels the DA1, VA1d and DC3 dendrites [22, 23]. To elucidate the molecular mechanisms by which Wnt5 controls the rotation of the PN dendrites, we screened a panel of signal transduction mutants for similar defects in DA1/VA1d rotation. We found that animal homozygous for Vang mutations exhibit a DA1/VA1d phenotype that mimicked that of the Wnt5400 mutant. For example, in the null Vang6 allele, the DA1/VA1d angle was 54.72˚ ± 2.8˚ (N = 24, vs 27.78˚ ± 4.6˚, N = 18 in the Vang6/+ heterozygous control, t-test p<0.0001) (Fig 1D–1F) suggesting that Vang might function in the Wnt5 pathway. Since the Vang6 allele, which encodes a truncated 128 amino acid product [19], displayed a highly penetrant phenotype, we examined this allele further. We therefore examined the positioning of glomeruli in different regions of the Vang6 AL by expressing UAS-mCD8::GFP under the control of various Or-Gal4 drivers [6] (Fig 1G–1O, see Materials and Methods for quantification). We observed that glomeruli in the lateral region of the AL, such as the VA1v glomerulus (Fig 1G–1I), showed the greatest displacement compared with glomeruli in other regions, suggesting that Vang primarily controls neurite targeting in the lateral AL. Since the Wnt5 protein is highly concentrated at the dorsolateral region of the AL [11], the Vang mutant defects are consistent with Vang playing a role in Wnt5 signaling. We hypothesized that Vang mediates Wnt5 signaling in the control of the DA1/VA1d dendritic rotation.
To obtain further evidence for Vang’s role in regulating the rotation of the DA1/VA1d dendritic pair, we stained ALs during a time of active glomerular rotation (24 hAPF) [11] with an antibody directed against the N-terminal 143 amino acids of Vang [24]. We observed that the Vang staining has a punctate appearance and is highly concentrated in the dorsolateral region of the AL between 0–9 μm from the AL anterior surface (Fig 2A). Co-labeling of the DA1/VA1d dendrites with the Mz19-Gal4 driver showed that they reside between ~3–6 μm in this high Vang expression domain. Vang staining in the neuropil begins to decline at 10 μm but strongly highlighted the nerve fiber layer (arrow) and the antennal nerve at 8–12 μm (arrow and arrowheads in Fig 2A and 2B), as well as the antennal commissure at 22 μm depth. The antibody stained the Vang6 mutant ALs (Fig 2C), likely because the Vang6 allele encodes a truncated protein. Nonetheless, the strong reduction in staining intensity compared with wild-type ALs attested to the antibody’s specificity. We concluded that Vang is expressed in the AL during the period of active AL neuropil rotation, where it colocalized with the DA1 and VA1d dendrites. The Vang expression pattern is consistent with the hypothesis that Vang mediates Wnt5 control of the DA1/VA1d dendritic rotation.
Vang is required in the ORNs for DA1-VA1d dendritic rotation
Since the Vang antibody strongly stained the AL nerve fiber layer, the antennal nerve and the antennal commissure, we hypothesized that Vang is expressed by ORNs and carried by axons to the developing AL. To identify the cell type in which Vang functions, we first used transgenic techniques to modulate Vang activity in specific cell types and examined the effect on the DA1/VA1d dendritic rotation. When we expressed the UAS-Vang transgene with the Elav-Gal4 pan-neuronal driver [25] in the Vang6 mutant, the DA1/VA1d dendritic angles became smaller (32.88˚ ± 2.19˚, N = 24) compared with that of the mutant control (51.40˚ ± 3.39˚, N = 20, t-test p<0.0001), indicating that Vang functions in neurons to promote dendritic rotation (Fig 3A–3C and 3M). When we expressed UAS-Vang using the ORN-specific drivers, peb-Gal4 and SG18.1-Gal4, the DA1/VA1d dendritic angles were also reduced (29.18˚ ± 1.6˚, N = 37 and 32.12˚ ± 2.12˚, N = 58 respectively) compared with that of the Vang6 mutant (60.82˚ ± 2.52˚, N = 17, peb rescue vs. Vang6, p<0.0001; SG18.1 rescue vs. Vang6, p<0.0001; peb rescue vs SG18.1 rescue, p = 0.8283; one-way ANOVA with post hoc Tukey test), indicating that Vang acts in the ORNs (Fig 3D–3I and 3M). In contrast, expression of UAS-Vang using a PN-specific driver, GH146-Gal4, did not significantly alter the DA1/VA1d rotational angles of the Vang6 mutant (47.87˚ ± 2.21˚, N = 39, t-test p = 0.3894; Fig 3M). In further support of Vang acting in the ORNs, when we drove the UAS-VangRNAi transgene [26] in the Vang6/+ heterozygote with peb-Gal4, the rotation of the DA1/VA1d dendritic angle increased slightly compared with that of the Vang6/+ heterozygote, indicating that Vang is required in the ORNs for DA1/VA1d dendritic rotation (36.40˚ ± 2.93˚, N = 24 compared with 30.09˚ ± 1.01˚, N = 22, t-test p = 0.0518) (Fig 3J–3L and 3N).
To confirm the above findings, we used mosaic techniques to induce ORNs or PNs lacking the Vang gene and examined the effects on the DA1/VA1d dendritic rotation. Induction of either Vangf04290 or Vang6 mutant ORN axons using the ey-FLP/FRT technique, which induces large clones in the antenna [27], resulted in the DA1/VA1d dendritic pair exhibiting larger angles (54.73˚ ± 3.26˚, N = 30 and 51.03˚ ± 2.62˚, N = 28 respectively) compared with animals innervated by wild-type ORN axons (20.24˚ ± 2.51˚, N = 20, wild type vs. Vangf04290, p<0.0001; wild type vs. Vang6, p<0.0001; Vang6 vs Vangf04290, p = 0.7297; one-way ANOVA with post hoc Tukey test) (Fig 4A–4C, 4G and 4H), confirming that Vang is required in the ORNs for DA1/VA1d dendritic rotation. Next, we induced Vang6 mutant PN clones using the MARCM system [28] with GH146-Gal4 as the PN marker. We observed that Vang6 mutant PN neuroblast and single-cell clones extended their dendrites into AL and innervated the glomeruli normally (Fig 4D–4F). Importantly, ALs innervated by large vang6 PN clones exhibited normal dendritic pattern, as judged by the angles of the DA1/VA1d dendrites (27.50˚ ± 4.89˚, N = 12) compared with those of the control (23.29˚ ± 5.27˚, N = 7, t-test p = 0.56) (Fig 4E, 4G and 4H). Thus, our transgenic rescue and mosaic experiments showed that Vang functions in the ORNs to non-autonomously promote the rotation of the DA1/VA1d dendritic pair.
Vang is not required for ORN axon growth or correct ORN-PN pairing
A possible explanation for the Vang mutant phenotype is that Vang is required for ORN axon growth to the AL, the failure of which indirectly disrupted glomerular patterning. Mutations in Vang have been shown to result in abnormal projection of mushroom body axons [29]. To determine if ORN axons entered the AL in the Vang6 mutant, we labeled eight different ORN axon terminals in the AL using Or-Gal4 drivers. We found that Vang6 mutant axons entered the AL normally, although their terminals were shifted in the AL neuropil (Fig 1). To investigate if the Vang mutation disrupted the proper matching of the ORN axons and PN dendrites, we simultaneously labeled pre - and postsynaptic partners of glomeruli for which specific markers were available. We achieved this by labeling the DA1, VA1d and DM1 dendrites with Mz19-Gal4 driving UAS-mCD8::GFP and simultaneously the ORN axons targeting the VA1d and VA1v glomeruli with the Or88a-CD2 and Or47b-CD2 transgenes respectively. We observed that Or88a axons were strictly paired with VA1d PN dendrites in the Vang6 mutant as in the wild type (Fig 5A and 5B). Likewise, the Or47b axons strictly innervated the VA1v glomerulus, and never strayed into the VA1d territory in the Vang6 mutant (Fig 5C). Thus, Vang is not required for ORN axon projection into the AL or their correct pairing with their postsynaptic partners. We propose that Vang functions in the context of paired axons and dendrites allowing the neurites to coordinately respond to the Wnt5 signal. This idea is consistent with our observation that PN dendritic rotation occurs between 16 and 30 hAPF [11], the period of major ORN axon invasion into the AL [8, 12].
Vang acts downstream of Wnt5 to repel the VA1d glomerulus
The close resemblance of the Vang and Wnt5 mutant phenotypes raised the questions of whether and how Vang might function in the Wnt5 signaling pathway to regulate the rotation of the DA1 and VA1d glomeruli. To address these questions, we asked if loss of Vang would block Wnt5 signaling. We previously showed that overexpression of Wnt5 in the DA1 and VA1d dendrites with the Mz19-Gal4 driver split the VA1d dendrites into two smaller arbors probably due to repulsion between the dendrites (Fig 6A and 6B) [11]. Interestingly, Wnt5 overexpression had no effect on the DA1 dendrites, indicating that the DA1 and VA1d dendrites respond differentially to the Wnt5 signal. The VA1d defect provided an opportunity to assess if Vang is needed for the Wnt5 gain-of-function phenotype. Whereas only 9.37% (3/32) of the VA1d dendrites in the Mz19>Wnt5 animals were intact, this fraction rose to 45.65% (21/46) in the Mz19>Wnt5; Vang6/Vang6 animals (Fig 6C and 6F). Moreover, the distances between the split VA1d arbors in the Mz19>Wnt5; Vang6/Vang6 animals were smaller than those in the Mz19>Wnt5 animals (11.83 μm ± 0.61 μm, N = 25, vs 21.06 μm ± 0.96 μm, N = 29, t-test p<0.0001) (Fig 6B, 6C and 6G). Despite severe distortion, the VA1d dendrites were faithfully paired with their Or88a axon partners, reinforcing the idea that Wnt5 signaling does not play a role in ORN-PN matching (Fig 6D and 6E). Overexpression of Wnt5 in the DA1 and VA1d dendrites did not affect the development of the Or88a neurons (S2 Fig). We conclude that Wnt5 signals through Vang to repel the VA1d glomerulus.
To further probe the relationship between Wnt5 and Vang, we examined the DA1/VA1d rotation in animals lacking both genes. We observed that the rotation in the Wnt5400; Vang6 double mutant (92.20˚ ± 4.1˚, N = 41) is more severely disrupted than that in either single mutant (76.03˚ ± 3.62˚ in Wnt5400, n = 29, t-test p = 0.0031 and 54.12˚ ± 2.8˚ in Vang6, n = 34, t-test p<0.0001) (Fig 7). The enhanced phenotype of the Wnt5400; Vang6 mutant suggested that Wnt5 and Vang could function independently to promote DA1/VA1d rotation (Fig 7F). We currently do not know how Vang acts independently of Wnt5. However, it interesting that Wnt5 directs the rotation of the DA1/VA1d glomeruli through both Vang-dependent and Vang-independent pathways. Since Wnt5 acts through Vang in the VA1d glomerulus, we hypothesized that Wnt5 acts through a Vang-independent mechanism in the DA1 glomerulus.
drl promotes the rotation of DA1-VA1d glomeruli
The Drl atypical receptor tyrosine kinase has been shown to bind Wnt5 and mediates its signaling in the migration of a number of cell types [14–17]. We previously demonstrated that Drl is differentially expressed by PN dendrites wherein it antagonizes Wnt5’s repulsion of the dendrites [11]. To delineate the AL region where drl functions, we examined the positioning of several glomeruli in the null drl2 mutant by expressing UAS-mCD8::GFP under the control of various Or-Gal4 drivers (Fig 8A–8I). We observed that, as in the Vang mutant, the lateral glomeruli showed the strongest displacements in positions compared with the control indicating that drl primarily regulates neurite targeting in the lateral AL (Fig 8A–8C). To better characterize the neuropil defect in this region we employed the Crispr/Cas9 technique [30] to create the null drlJS allele on the Mz19-Gal4 chromosome (Materials and Methods), which allowed us to assess the DA1/VA1d dendritic arrangement in the drl mutant. To our surprise, we observed that the DA1/VA1d dendritic pair in the drlJS/drl2 null mutant showed strong deficits in DA1/VA1d rotation, resembling the Wnt5400 null phenotype (Fig 8J–8L). Indeed, measurement of the DA1/VA1d angle of the drlJS/drl2 mutant (76.55˚ ± 3.75˚, N = 31) showed that it was even slightly larger than that of the Wnt5400 mutant (69.22˚ ± 5.03˚, N = 32, t-test p = 0.2493). The similarity of the drl and Wnt5 mutant phenotypes indicates that drl cooperates with Wnt5 in promoting the rotation of the DA1/VA1d glomeruli.
drl acts in the DA1 dendrites to promote glomerular attraction to Wnt5
How does drl mediate Wnt5 function in glomerular rotation? We hypothesized that drl functions in the DA1 dendrites, to regulate migration of the DA1 glomerulus towards the Wnt5 source. In support of this idea, antibody staining of the Drl protein showed that it is highly expressed by the DA1 dendrites but not the VA1d dendrites (Fig 2D and 2E) [11]. The domain of high Drl expression occupies the anterior dorsolateral domain of the 24 hAPF ALs (0–8 μm from anterior), a region in which Wnt5 is also highly expressed [11]. The hypothesis predicts that ablation of drl in DA1 alone would disrupt the rotation of the DA1/VA1d glomeruli. To test this hypothesis, we used MARCM to induce drlJS homozygosity in either DA1 or VA1d dendrites and assessed the effects on DA1/VA1d glomerular rotation. The DA1 and VA1 dendrites could be independently identified since their cell bodies are located in the lateral and anterodorsal PN clusters respectively. We observed that drlJS mutant VA1d dendrites were associated with glomerular pairs with small angles (17.13˚ ± 3.68˚, N = 16), that is, with the DA1 glomerulus closely associated with the dorsolateral AL (Fig 9C–9F). In contrast, drlJS mutant DA1 dendrites are associated with glomeruli with wide variations in angles (58.43˚ ± 8.33˚, N = 14, t-test p = 0.0003), that is, with the DA1 glomerulus not closely associated with the dorsolateral AL (Fig 9A, 9B, 9E and 9F). Thus, drl appears to act in the DA1 dendrites to confer directionality of the DA1 glomerulus towards the Wnt5 source.
drl likely converts Wnt5 repulsion of the DA1 glomerulus into attraction
How does drl promote the migration of the DA1 glomerulus towards Wnt5? We propose two models by which drl could accomplish this task. In the first model, drl acts as a positive effector of Wnt5 attractive signaling. In the second model, drl neutralizes Wnt5 repulsive signaling and/or converts the repulsive signaling into an attractive one. Careful examination of the DA1/VA1d targeting defects in drlJS/drl2 null mutant revealed differences with that of the Wnt5400 mutant, inconsistent with the idea that drl acts as a positive effector of Wnt5 signaling. First, the DA1 glomerulus is often displaced medially from the AL lateral border (6.26 μm ± 1.85 μm from border, N = 28) (Fig 10H), a defect not seen in the Wnt5400 mutant. This resulted in the frequent reversal in the positions of the DA1 and VA1d glomeruli (Fig 10B), or displacement of both glomeruli medially from the AL lateral border (Fig 10A). Second, the mean DA1/VA1d angle in the drlJS/drl2 null mutant is slightly but not significantly larger than that of Wnt5400 null mutant (Fig 10E and 10G). Instead the defects are more consistent with the second model, which predicts increased Wnt5 repulsion of the DA1 glomerulus in the drl mutant, thus driving the glomerulus ventromedially. To test this hypothesis, we simultaneously removed both drl and Wnt5 functions and examined the displacement of the DA1/VA1d glomeruli. We observed that the DA1 glomerulus is restored to AL lateral border in the Wnt5400; drlJS/drl2 double mutant, as it is in the Wnt5 homozygote (0.00 μm from border, N = 30 and N = 25 respectively) (Fig 10C and 10H). We also observed that the DA1/VA1d angle in the Wnt5; drl double mutant (70.66˚ ± 4.39˚, N = 29) is more similar to that of the Wnt5 mutant (69.22˚ ± 5.03˚, N = 32, t-test p = 0.83) than that of the drl mutant (76.55˚ ± 3.75˚, N = 31, t-test p = 0.3102) (Fig 10E and 10G). We conclude that Wnt5 repels the DA1 glomerulus ventromedially and that drl antagonizes the Wnt5 repulsive activity. Since we showed above that drl promotes the migration of DA1 towards Wnt5, we conclude that drl acts in the DA1 glomerulus to convert Wnt5 repulsion of the DA1 glomerulus into attraction. Taken together, our results suggest that Wnt5 orients the rotation of the VA1d/DA1 glomeruli by attracting the DA1 glomerulus through Wnt5-drl signaling and repelling the VA1d glomerulus through Wnt5-Vang signaling.
To investigate the mechanism by which drl converts Wnt5 repulsion of the DA1 glomerulus into attraction, we examined the mechanism by which Wnt5 repels the DA1 glomerulus. A likely scenario is that Wnt5 repels the DA1 glomerulus through Vang. To test this idea, we simultaneously removed both drl and Vang functions and measured the displacement of the DA1 glomerulus from the AL lateral border as well as the DA1/VA1d rotational angle. We found that in the Vang6 drlJS/Vang6 drl2 double mutant, the DA1 glomerulus is restored to the AL lateral border (0.156 μm ± 0.132 μm, N = 28, t-test p = 0.0017) (Fig 10D and 10H). We conclude that drl neutralizes the Wnt5-Vang repulsion of the DA1 glomerulus. Interestingly, measurement of the DA1/VA1d angles in the Vang drl double mutant showed that the rotation of the glomeruli is more severely impaired (93.41˚ ± 3.65˚ N = 29) than that of either single mutants (76.55˚ ± 3.75˚ in drl2, N = 31, t-test p = 0.0021 and 54.57˚ ± 2.75˚ in Vang6, N = 35, t-test p<0.0001) (Fig 10F and 10G). The enhanced phenotype of the Vang drl double mutant indicated that drl and Vang act in parallel pathways to promote DA1/VA1d rotation. The parallel functions are in accord with our model that drl acts in the DA1 glomerulus while Vang acts in the adjacent VA1d glomerulus to promote DA1/VA1d rotation. Simultaneous loss of Vang and drl would be expected to exacerbate the DA1/VA1d rotational defect.
Discussion
Elucidating the mechanisms that shape dendritic arbors is key to understanding the principles of nervous system assembly. Genetic approaches have revealed both intrinsic and extrinsic cues that regulate the patterning of dendritic arbors [31, 32]. In contrast, there are only a few reports on the roles of axons in shaping dendritic arborization [33, 34]. In this paper we provide evidence that final patterning of the fly olfactory map is the result of an interplay between ORN axons, PN dendrites and the Wnt5 directional signal (Fig 11). We show that the Vang PCP protein [20, 21] is an axon-derived factor that mediates the Wnt5 repulsion of the VA1d dendrites. We also show that the Drl protein is specifically expressed by the DA1 dendrites where it antagonizes the Wnt5-Vang repulsion of the DA1 glomerulus and likely converts it into an attractive response. The differential responses of the DA1 and VA1d glomeruli to Wnt5 would produce the forces by which Wnt5 effects the rotation of the glomerular pair. We present the following lines of evidence in support of this model of olfactory neural circuit development.
Immunostaining showed that Vang is expressed at the same time and place as Wnt5 and Drl, and concentrated in the dorsolateral AL where major dendritic reorganization occurs [11]. Mutations in Vang strongly disrupted the pattern of glomeruli in the AL, mimicking the Wnt5 mutant phenotype. Notably, mutation of Vang suppressed the strong repulsion of the VA1d dendritic arbor caused by Wnt5 overexpression, indicating that Vang acts downstream of Wnt5 to repel the VA1d dendrites. Unexpectedly, using cell type-specific transgenic experiments and mosaic analyses we found that Vang functions specifically in the ORNs, indicating an obligatory codependence of ORN axon and PN dendritic targeting. Unlike the VA1d glomerulus, which expresses low levels of drl and is repelled by Wnt5, the adjacent DA1 glomerulus expresses high levels of drl. Mosaic analyses showed that drl acts specifically in the DA1 dendrites to confer directionality of the DA1 glomerulus towards Wnt5. Finally, in the absence of drl, the DA1 glomerulus is displaced away from the Wnt5 source, a defect that is suppressed by the removal of either Wnt5 or Vang. Taken together, we propose that drl likely converts Wnt5 repulsion of the DA1 glomerulus into attraction by inhibiting Wnt5-Vang repulsive signaling.
We envision that Vang and Drl act cell autonomously to regulate axonal and dendritic guidance respectively and cell non-autonomously to modulate each other’s functions. Both Vang and Drl/Ryk have well-documented cell autonomous functions in neurite guidance. For example, vertebrate Vangl2 was localized to the filopodia of growth cones [35, 36] and Drosophila Vang mediates the repulsion of mushroom body axon branches in respond to Wnt5 [29, 37]. Similarly, Drl and Ryk mediate the functions of Wnt5 and Wnt5a respectively in the targeting of dendrites [16, 38] and axons [5, 14, 17, 39, 40]. Both proteins also have well-documented cell non-autonomous functions. Vertebrate Vangl2 acts as a ligand to steer migrating neurons [41, 42]. We and others have shown that Drl could sequester Wnt5 using its extracellular Wnt Inhibitory Factor (WIF) motif [38, 43–45]. Indeed, in this manner Drl may reduce Wnt5-Vang interaction, thus neutralizing Wnt5 repulsion of the glomeruli. How would Drl convert a glomerulus’s response to Wnt5 from repulsion to attraction? Increasing Ryk levels were proposed to titrate out Fz5 in chick retinal ganglion axons, thus converting growth cone response to Wnt3 from attraction to repulsion [46]. Whether Drl function through a similar mechanism in the DA1 dendrites will require further investigation.
The opposing functions of Vang and Drl in a migrating glomerulus satisfies Geirer’s postulate for topographic mapping, which states that targeting neurites must detect two opposing forces in the target so that each neurite would come to rest at the point where the opposing forces cancel out [47]. Thus, the relative levels of Drl and Vang activities in a glomerulus may determine its targeting position in the Wnt5 gradient (Fig 11). For the DA1/VA1d glomerular pair, the relative levels of Drl and Vang activities would result in the migration of DA1 up the gradient and VA1d down the gradient, that is, the rotation of the glomerular pair. The opposing effects of Wnt5 on the targeting glomeruli could allow the single Wnt5 gradient to refine the pattern of the olfactory map.
The rotation of the DA1/VA1d glomeruli bears intriguing resemblance to the PCP-directed rotation of multicellular structures such as mouse hair follicles and fly ommatidia, whose mechanisms remain incompletely understood [48–50]. Our demonstration of the push-pull effect of Wnt5 on the glomeruli suggests that similar mechanisms may be involved in other PCP-directed rotations. Planar polarity signaling has emerged as an important mechanism in the morphogenesis of many tissues [20, 51, 52]. However, apart from the molecules of the core PCP group (Vang, Prickle, Frizzled and Dishevelled) the identities of other signaling components are subjects of debate. A key question is the extracellular cue that aligns the core PCP proteins with the global tissue axes. Although Wnt ligands have been implicated, a definitive link between them and PCP signaling has been difficult to establish [20, 21, 53]. Our work showing that Wnt5 and Vang act together to direct the orientation of nascent glomeruli adds to two other reports [54, 55] that Wnt proteins play instructive roles in PCP signaling. Another debate surrounds the role of Drl/Ryk role in PCP signaling. First identified as signal transducing receptors for a subset of Wnt ligands in Drosophila [17, 56], vertebrate Ryk was subsequently shown to act in PCP signaling [57, 58]. These reports, combined with the lack of classical wing-hair PCP phenotypes in the drl mutant, led to the proposal that Ryk’s PCP function is a vertebrate innovation [59]. Our demonstration of drl’s role in Wnt5-Vang signaling suggests, however, that the Drl/Ryk’s PCP function is likely to be evolutionarily ancient.
Materials and methods
Fly strains and Crispr/Cas9 knockout of the drl gene
All mutant and transgenic fly lines were obtained from the Bloomington Drosophila Stock Center except for UAS-Vang, which was a gift from B. A. Hassan. The Wnt5400 allele is a null allele generated by the imprecise excision of an adjacent P element, resulting in the deletion of most of the Wnt5 open reading frame [14]. The drl2 allele is a null allele generated by the imprecise excision of a P element in the 5’ non-coding region, resulting in the deletion of the 5’ regulatory sequences and the first exon of drl [60]. To generate a new drl null allele on the Mz19-Gal4 chromosome, exons 2, 3 and 4 of the drl locus (encompassing ~90% of the drl open reading frame) were excised from the chromosome by Crispr/Cas9-mediated deletion using the sgRNAs GACAAGTGAAGGGGTGCTGT and GACACCTGTAGTGAGAGGTA following a published protocol [61]. Ten individual offspring from Crispr/Cas9 fathers were crossed to Adv/CyO virgins to establish lines. The lines were screened by PCR using deletion-spanning primers to identify potential drl mutants. The PCR products were sequenced and one mutant, drlJS, with the expected precise deletion of the drl locus in the Mz19-Gal4 background was chosen for study. The drlJS mutation failed to complement the AL phenotype of the drl2 mutation, consistent with drlJS being a null allele.
Clonal analyses
To induce Vang mutant ORNs, adults of the following genotype, ey-FLP/+; FRT42 w+ cl/Mz19-Gal4 FRT42 Vang6 or (+), were obtained and dissected. To induce Vang and drl mutant PNs, the MARCM technique was employed [28]. Third instar larvae of the following genotypes: hs-FLP UAS-mCD8::GFP/+; FRT42 tub-Gal80/FRT42 GH146-Gal4 Vang6 or (+) and hs-FLP UAS-mCD8::GFP/+; FRT40 tub-Gal80/FRT40 Mz19-Gal4 drlJS or (+); UAS-mCD8::GFP/+ were heat-shocked at 37˚C for 40 minutes. Adult brains were dissected and processed as described below.
Immunohistochemistry
Dissection, fixing and staining of adult or pupal brains were performed as previously described [27, 62]. Rabbit anti-DRL (1 : 1000) was a generous gift from J. M. Dura; rat anti-Vang (1 : 500) was a gift from D. Strutt; mAb nc82 (1 : 20) [63] was obtained from the Iowa Antibody Bank; rat anti-mCD8 mAb (1 : 100) was obtained from Caltag,. The secondary antibodies, FITC-conjugated goat anti-rabbit, Cy3-conjugated goat anti-mouse and FITC-conjugated goat anti-rat, were obtained from Jackson Laboratories and used at 1 : 100 dilutions. The stained brains were imaged using a Zeiss 710 confocal microscope
Quantification of glomerular rotation
Two different quantification strategies were employed. To quantify the displacements of single glomeruli labeled by the Or-Gal4 drivers [6], the angle subtended at the VA6 glomerulus (close to the center of the AL) by the dorsal pole and the labeled glomerulus (in the dorsal/0˚ → lateral/90˚ → ventral/180˚ → medial direction/270˚) was measured. To quantify the rotation of the DA1 and VA1d glomeruli [22] around each other, the angle subtended at the VA1d glomerulus by the dorsal pole and the DA1 glomerulus (in the dorsal/0˚ → lateral/90˚ → ventral/180˚ → medial/270˚ direction) was measured. Data were collected, analyzed and plotted using the Prism statistical software. For two-sample comparisons, unpaired Student’s t-tests were applied. For comparisons among more than two groups, one-way AVOVA tests were used followed by Tukey’s test. Rose diagrams were plotted using the Excel program.
Supporting information
S1 Fig [tif]
Method for quantifying the rotation of the DA1 and VA1d glomeruli around each other.
S2 Fig [a]
Overexpression of in the DA1 and VA1d dendrites does not disrupt ORN differentiation or survival.
Zdroje
1. Hong W, Luo L. Genetic control of wiring specificity in the fly olfactory system. Genetics. 2014;196(1):17–29. doi: 10.1534/genetics.113.154336 24395823
2. Luo L, Flanagan JG. Development of continuous and discrete neural maps. Neuron. 2007;56(2):284–300. doi: 10.1016/j.neuron.2007.10.014 17964246
3. McLaughlin T, O'Leary DD. Molecular gradients and development of retinotopic maps. Annu Rev Neurosci. 2005;28 : 327–55. doi: 10.1146/annurev.neuro.28.061604.135714 16022599
4. Sakano H. Neural map formation in the mouse olfactory system. Neuron. 2010;67(4):530–42. doi: 10.1016/j.neuron.2010.07.003 20797531
5. Sarin S, Zuniga-Sanchez E, Kurmangaliyev YZ, Cousins H, Patel M, Hernandez J, et al. Role for Wnt Signaling in Retinal Neuropil Development: Analysis via RNA-Seq and In Vivo Somatic CRISPR Mutagenesis. Neuron. 2018;98(1):109–26 e8. doi: 10.1016/j.neuron.2018.03.004 29576390
6. Couto A, Alenius M, Dickson BJ. Molecular, anatomical, and functional organization of the Drosophila olfactory system. Curr Biol. 2005;15(17):1535–47. doi: 10.1016/j.cub.2005.07.034 16139208
7. Fishilevich E, Vosshall LB. Genetic and functional subdivision of the Drosophila antennal lobe. Curr Biol. 2005;15(17):1548–53. doi: 10.1016/j.cub.2005.07.066 16139209
8. Jefferis GS, Vyas RM, Berdnik D, Ramaekers A, Stocker RF, Tanaka NK, et al. Developmental origin of wiring specificity in the olfactory system of Drosophila. Development. 2004;131(1):117–30. doi: 10.1242/dev.00896 14645123
9. Komiyama T, Sweeney LB, Schuldiner O, Garcia KC, Luo L. Graded expression of semaphorin-1a cell-autonomously directs dendritic targeting of olfactory projection neurons. Cell. 2007;128(2):399–410. doi: 10.1016/j.cell.2006.12.028 17254975
10. Sweeney LB, Chou YH, Wu Z, Joo W, Komiyama T, Potter CJ, et al. Secreted semaphorins from degenerating larval ORN axons direct adult projection neuron dendrite targeting. Neuron. 2011;72(5):734–47. doi: 10.1016/j.neuron.2011.09.026 22153371
11. Wu Y, Helt JC, Wexler E, Petrova IM, Noordermeer JN, Fradkin LG, et al. Wnt5 and drl/ryk gradients pattern the Drosophila olfactory dendritic map. J Neurosci. 2014;34(45):14961–72. doi: 10.1523/JNEUROSCI.2676-14.2014 25378162
12. Jhaveri D, Sen A, Rodrigues V. Mechanisms underlying olfactory neuronal connectivity in Drosophila-the atonal lineage organizes the periphery while sensory neurons and glia pattern the olfactory lobe. Dev Biol. 2000;226(1):73–87. doi: 10.1006/dbio.2000.9855 10993675
13. Rodrigues V, Hummel T. Development of the Drosophila olfactory system. Adv Exp Med Biol. 2008;628 : 82–101. doi: 10.1007/978-0-387-78261-4_6 18683640
14. Fradkin LG, van Schie M, Wouda RR, de Jong A, Kamphorst JT, Radjkoemar-Bansraj M, et al. The Drosophila Wnt5 protein mediates selective axon fasciculation in the embryonic central nervous system. Dev Biol. 2004;272(2):362–75. doi: 10.1016/j.ydbio.2004.04.034 15282154
15. Harris KE, Beckendorf SK. Different Wnt signals act through the Frizzled and RYK receptors during Drosophila salivary gland migration. Development. 2007;134(11):2017–25. doi: 10.1242/dev.001164 17507403
16. Yasunaga K, Tezuka A, Ishikawa N, Dairyo Y, Togashi K, Koizumi H, et al. Adult Drosophila sensory neurons specify dendritic territories independently of dendritic contacts through the Wnt5-Drl signaling pathway. Genes Dev. 2015;29(16):1763–75. doi: 10.1101/gad.262592.115 26302791
17. Yoshikawa S, McKinnon RD, Kokel M, Thomas JB. Wnt-mediated axon guidance via the Drosophila Derailed receptor. Nature. 2003;422(6932):583–8. doi: 10.1038/nature01522 12660735
18. Taylor J, Abramova N, Charlton J, Adler PN. Van Gogh: a new Drosophila tissue polarity gene. Genetics. 1998;150(1):199–210. 9725839
19. Wolff T, Rubin GM. Strabismus, a novel gene that regulates tissue polarity and cell fate decisions in Drosophila. Development. 1998;125(6):1149–59. 9463361
20. Goodrich LV, Strutt D. Principles of planar polarity in animal development. Development. 2011;138(10):1877–92. doi: 10.1242/dev.054080 21521735
21. Yang Y, Mlodzik M. Wnt-Frizzled/planar cell polarity signaling: cellular orientation by facing the wind (Wnt). Annu Rev Cell Dev Biol. 2015;31 : 623–46. doi: 10.1146/annurev-cellbio-100814-125315 26566118
22. Ito K, Suzuki K, Estes P, Ramaswami M, Yamamoto D, Strausfeld NJ. The organization of extrinsic neurons and their implications in the functional roles of the mushroom bodies in Drosophila melanogaster Meigen. Learn Mem. 1998;5(1–2):52–77. 10454372
23. Zhu H, Luo L. Diverse functions of N-cadherin in dendritic and axonal terminal arborization of olfactory projection neurons. Neuron. 2004;42(1):63–75. doi: 10.1016/s0896-6273(04)00142-4 15066265
24. Strutt H, Strutt D. Differential stability of flamingo protein complexes underlies the establishment of planar polarity. Curr Biol. 2008;18(20):1555–64. doi: 10.1016/j.cub.2008.08.063 18804371
25. Robinow S, White K. Characterization and spatial distribution of the ELAV protein during Drosophila melanogaster development. J Neurobiol. 1991;22(5):443–61. doi: 10.1002/neu.480220503 1716300
26. Ni JQ, Zhou R, Czech B, Liu LP, Holderbaum L, Yang-Zhou D, et al. A genome-scale shRNA resource for transgenic RNAi in Drosophila. Nat Methods. 2011;8(5):405–7. doi: 10.1038/nmeth.1592 21460824
27. Ang LH, Kim J, Stepensky V, Hing H. Dock and Pak regulate olfactory axon pathfinding in Drosophila. Development. 2003;130(7):1307–16. doi: 10.1242/dev.00356 12588847
28. Lee T, Luo L. Mosaic analysis with a repressible cell marker for studies of gene function in neuronal morphogenesis. Neuron. 1999;22(3):451–61. doi: 10.1016/s0896-6273(00)80701-1 10197526
29. Shimizu K, Sato M, Tabata T. The Wnt5/planar cell polarity pathway regulates axonal development of the Drosophila mushroom body neuron. J Neurosci. 2011;31(13):4944–54. doi: 10.1523/JNEUROSCI.0154-11.2011 21451033
30. Gratz SJ, Cummings AM, Nguyen JN, Hamm DC, Donohue LK, Harrison MM, et al. Genome engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics. 2013;194(4):1029–35. doi: 10.1534/genetics.113.152710 23709638
31. Dong X, Shen K, Bulow HE. Intrinsic and extrinsic mechanisms of dendritic morphogenesis. Annu Rev Physiol. 2015;77 : 271–300. doi: 10.1146/annurev-physiol-021014-071746 25386991
32. Valnegri P, Puram SV, Bonni A. Regulation of dendrite morphogenesis by extrinsic cues. Trends Neurosci. 2015;38(7):439–47. doi: 10.1016/j.tins.2015.05.003 26100142
33. Altman J, Anderson WJ. Experimental reorganization of the cerebellar cortex. I. Morphological effects of elimination of all microneurons with prolonged x-irradiation started at birth. J Comp Neurol. 1972;146(3):355–406. doi: 10.1002/cne.901460305 5086676
34. Ramirez-Suarez NJ, Belalcazar HM, Salazar CJ, Beyaz B, Raja B, Nguyen KCQ, et al. Axon-Dependent Patterning and Maintenance of Somatosensory Dendritic Arbors. Dev Cell. 2019;48(2):229–44 e4. doi: 10.1016/j.devcel.2018.12.015 30661986
35. Onishi K, Shafer B, Lo C, Tissir F, Goffinet AM, Zou Y. Antagonistic functions of Dishevelleds regulate Frizzled3 endocytosis via filopodia tips in Wnt-mediated growth cone guidance. J Neurosci. 2013;33(49):19071–85. doi: 10.1523/JNEUROSCI.2800-13.2013 24305805
36. Shafer B, Onishi K, Lo C, Colakoglu G, Zou Y. Vangl2 promotes Wnt/planar cell polarity-like signaling by antagonizing Dvl1-mediated feedback inhibition in growth cone guidance. Dev Cell. 2011;20(2):177–91. doi: 10.1016/j.devcel.2011.01.002 21316586
37. Gombos R, Migh E, Antal O, Mukherjee A, Jenny A, Mihaly J. The Formin DAAM Functions as Molecular Effector of the Planar Cell Polarity Pathway during Axonal Development in Drosophila. J Neurosci. 2015;35(28):10154–67. doi: 10.1523/JNEUROSCI.3708-14.2015 26180192
38. Sakurai M, Aoki T, Yoshikawa S, Santschi LA, Saito H, Endo K, et al. Differentially expressed Drl and Drl-2 play opposing roles in Wnt5 signaling during Drosophila olfactory system development. J Neurosci. 2009;29(15):4972–80. doi: 10.1523/JNEUROSCI.2821-08.2009 19369566
39. Li L, Hutchins BI, Kalil K. Wnt5a induces simultaneous cortical axon outgrowth and repulsive axon guidance through distinct signaling mechanisms. J Neurosci. 2009;29(18):5873–83. doi: 10.1523/JNEUROSCI.0183-09.2009 19420254
40. Liu Y, Shi J, Lu CC, Wang ZB, Lyuksyutova AI, Song XJ, et al. Ryk-mediated Wnt repulsion regulates posterior-directed growth of corticospinal tract. Nat Neurosci. 2005;8(9):1151–9. doi: 10.1038/nn1520 16116452
41. Davey CF, Mathewson AW, Moens CB. PCP Signaling between Migrating Neurons and their Planar-Polarized Neuroepithelial Environment Controls Filopodial Dynamics and Directional Migration. PLoS Genet. 2016;12(3):e1005934. doi: 10.1371/journal.pgen.1005934 26990447
42. Ghimire SR, Ratzan EM, Deans MR. A non-autonomous function of the core PCP protein VANGL2 directs peripheral axon turning in the developing cochlea. Development. 2018;145(12).
43. Grillenzoni N, Flandre A, Lasbleiz C, Dura JM. Respective roles of the DRL receptor and its ligand WNT5 in Drosophila mushroom body development. Development. 2007;134(17):3089–97. doi: 10.1242/dev.02876 17652353
44. Reynaud E, Lahaye LL, Boulanger A, Petrova IM, Marquilly C, Flandre A, et al. Guidance of Drosophila Mushroom Body Axons Depends upon DRL-Wnt Receptor Cleavage in the Brain Dorsomedial Lineage Precursors. Cell Rep. 2015;11(8):1293–304. doi: 10.1016/j.celrep.2015.04.035 25981040
45. Yao Y, Wu Y, Yin C, Ozawa R, Aigaki T, Wouda RR, et al. Antagonistic roles of Wnt5 and the Drl receptor in patterning the Drosophila antennal lobe. Nat Neurosci. 2007;10(11):1423–32. doi: 10.1038/nn1993 17934456
46. Schmitt AM, Shi J, Wolf AM, Lu CC, King LA, Zou Y. Wnt-Ryk signalling mediates medial-lateral retinotectal topographic mapping. Nature. 2006;439(7072):31–7. doi: 10.1038/nature04334 16280981
47. Gierer. Directional cues for growing axons forming the retinotectal projection. Development. 1987;101 : 479–89.
48. Devenport D, Fuchs E. Planar polarization in embryonic epidermis orchestrates global asymmetric morphogenesis of hair follicles. Nat Cell Biol. 2008;10(11):1257–68. doi: 10.1038/ncb1784 18849982
49. Mlodzik M. Planar polarity in the Drosophila eye: a multifaceted view of signaling specificity and cross-talk. EMBO J. 1999;18(24):6873–9. doi: 10.1093/emboj/18.24.6873 10601009
50. Reifegerste R, Moses K. Genetics of epithelial polarity and pattern in the Drosophila retina. Bioessays. 1999;21(4):275–85. doi: 10.1002/(SICI)1521-1878(199904)21 : 4<275::AID-BIES3>3.0.CO;2-5 10377890
51. Daulat AM, Borg JP. Wnt/Planar Cell Polarity Signaling: New Opportunities for Cancer Treatment. Trends Cancer. 2017;3(2):113–25. doi: 10.1016/j.trecan.2017.01.001 28718442
52. Humphries AC, Mlodzik M. From instruction to output: Wnt/PCP signaling in development and cancer. Curr Opin Cell Biol. 2018;51 : 110–6. doi: 10.1016/j.ceb.2017.12.005 29289896
53. Wu J, Mlodzik M. Wnt/PCP Instructions for Cilia in Left-Right Asymmetry. Dev Cell. 2017;40(5):423–4. doi: 10.1016/j.devcel.2017.02.023 28292419
54. Minegishi K, Hashimoto M, Ajima R, Takaoka K, Shinohara K, Ikawa Y, et al. A Wnt5 Activity Asymmetry and Intercellular Signaling via PCP Proteins Polarize Node Cells for Left-Right Symmetry Breaking. Dev Cell. 2017;40(5):439–52 e4. doi: 10.1016/j.devcel.2017.02.010 28292423
55. Wu J, Roman AC, Carvajal-Gonzalez JM, Mlodzik M. Wg and Wnt4 provide long-range directional input to planar cell polarity orientation in Drosophila. Nat Cell Biol. 2013;15(9):1045–55. doi: 10.1038/ncb2806 23912125
56. Fradkin LG, Dura JM, Noordermeer JN. Ryks: new partners for Wnts in the developing and regenerating nervous system. Trends Neurosci. 2010;33(2):84–92. doi: 10.1016/j.tins.2009.11.005 20004982
57. Andre P, Wang Q, Wang N, Gao B, Schilit A, Halford MM, et al. The Wnt coreceptor Ryk regulates Wnt/planar cell polarity by modulating the degradation of the core planar cell polarity component Vangl2. J Biol Chem. 2012;287(53):44518–25. doi: 10.1074/jbc.M112.414441 23144463
58. Macheda ML, Sun WW, Kugathasan K, Hogan BM, Bower NI, Halford MM, et al. The Wnt receptor Ryk plays a role in mammalian planar cell polarity signaling. J Biol Chem. 2012;287(35):29312–23. doi: 10.1074/jbc.M112.362681 22773843
59. Yang W, Garrett L, Feng D, Elliott G, Liu X, Wang N, et al. Wnt-induced Vangl2 phosphorylation is dose-dependently required for planar cell polarity in mammalian development. Cell Res. 2017;27(12):1466–84. doi: 10.1038/cr.2017.127 29056748
60. Dura JM, Taillebourg E, Preat T. The Drosophila learning and memory gene linotte encodes a putative receptor tyrosine kinase homologous to the human RYK gene product. FEBS Lett. 1995;370(3):250–4. doi: 10.1016/0014-5793(95)00847-3 7656987
61. Port F, Chen HM, Lee T, Bullock SL. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proc Natl Acad Sci U S A. 2014;111(29):E2967–76. doi: 10.1073/pnas.1405500111 25002478
62. Ang LH, Chen W, Yao Y, Ozawa R, Tao E, Yonekura J, et al. Lim kinase regulates the development of olfactory and neuromuscular synapses. Dev Biol. 2006;293(1):178–90. doi: 10.1016/j.ydbio.2006.01.030 16529736
63. Wagh DA, Rasse TM, Asan E, Hofbauer A, Schwenkert I, Durrbeck H, et al. Bruchpilot, a protein with homology to ELKS/CAST, is required for structural integrity and function of synaptic active zones in Drosophila. Neuron. 2006;49(6):833–44. doi: 10.1016/j.neuron.2006.02.008 16543132
Článek vyšel v časopise
PLOS Genetics
2020 Číslo 5
- Máj pod bílým pláštěm aneb když mezi směnami vykvete láska
- Bezpečnost dlouhodobé terapie osteoporózy – aktuální data
- Umělá inteligence dokáže odhalit pacienty ohrožené deliriem
- Masturbační chování žen v ČR − dotazníková studie
- Bezlepková dieta může osobám bez celiakie více uškodit než prospět
-
Všechny články tohoto čísla
- A cross-disorder PRS-pheWAS of 5 major psychiatric disorders in UK Biobank
- Depletion of Ric-8B leads to reduced mTORC2 activity
- A copy number variant is associated with a spectrum of pigmentation patterns in the rock pigeon (Columba livia)
- An osteocalcin-deficient mouse strain without endocrine abnormalities
- Osteocalcin is necessary for the alignment of apatite crystallites, but not glucose metabolism, testosterone synthesis, or muscle mass
- Beyond SNP heritability: Polygenicity and discoverability of phenotypes estimated with a univariate Gaussian mixture model
- Accounting for long-range correlations in genome-wide simulations of large cohorts
- Novel frameshift variant in MYL2 reveals molecular differences between dominant and recessive forms of hypertrophic cardiomyopathy
- The domesticated transposase ALP2 mediates formation of a novel Polycomb protein complex by direct interaction with MSI1, a core subunit of Polycomb Repressive Complex 2 (PRC2)
- Rare protein-altering variants in ANGPTL7 lower intraocular pressure and protect against glaucoma
- The phosphorelay BarA/SirA activates the non-cognate regulator RcsB in Salmonella enterica
- Copy number variants and fixed duplications among 198 rhesus macaques (Macaca mulatta)
- The genomic landscape of metastasis in treatment-naïve breast cancer models
- Trans-ethnic meta-analysis of genome-wide association studies identifies maternal ITPR1 as a novel locus influencing fetal growth during sensitive periods in pregnancy
- Genome-wide DNA methylation and gene expression patterns reflect genetic ancestry and environmental differences across the Indonesian archipelago
- Single-nucleus RNA-seq identifies divergent populations of FSHD2 myotube nuclei
- Separable, Ctf4-mediated recruitment of DNA Polymerase α for initiation of DNA synthesis at replication origins and lagging-strand priming during replication elongation
- Bidirectional crosstalk between Hypoxia-Inducible Factor and glucocorticoid signalling in zebrafish larvae
- An EHBP-1-SID-3-DYN-1 axis promotes membranous tubule fission during endocytic recycling
- Simultaneous SNP selection and adjustment for population structure in high dimensional prediction models
- Interplay between axonal Wnt5-Vang and dendritic Wnt5-Drl/Ryk signaling controls glomerular patterning in the Drosophila antennal lobe
- Additive and mostly adaptive plastic responses of gene expression to multiple stress in Tribolium castaneum
- Polyploidy breaks speciation barriers in Australian burrowing frogs Neobatrachus
- Multiple mechanisms regulate H3 acetylation of enhancers in response to thyroid hormone
- A new neuropeptide insect parathyroid hormone iPTH in the red flour beetle Tribolium castaneum
- Scalable probabilistic PCA for large-scale genetic variation data
- An Out-of-Patagonia migration explains the worldwide diversity and distribution of Saccharomyces eubayanus lineages
- Alternative splicing of jnk1a in zebrafish determines first heart field ventricular cardiomyocyte numbers through modulation of hand2 expression
- ASEP: Gene-based detection of allele-specific expression across individuals in a population by RNA sequencing
- ALC1/eIF4A1-mediated regulation of CtIP mRNA stability controls DNA end resection
- A high-fat diet induces a microbiota-dependent increase in stem cell activity in the Drosophila intestine
- The genetic architecture of the maize progenitor, teosinte, and how it was altered during maize domestication
- Exome-wide association study reveals largely distinct gene sets underlying specific resistance to dengue virus types 1 and 3 in Aedes aegypti
- Correction: Regulation of ATG4B Stability by RNF5 Limits Basal Levels of Autophagy and Influences Susceptibility to Bacterial Infection
- Sex-biased genetic programs in liver metabolism and liver fibrosis are controlled by EZH1 and EZH2
- UVR8-mediated inhibition of shade avoidance involves HFR1 stabilization in Arabidopsis
- Yeast mismatch repair components are required for stable inheritance of gene silencing
- Dynamic genetic architecture of yeast response to environmental perturbation shed light on origin of cryptic genetic variation
- Activation of cryptic splicing in bovine WDR19 is associated with reduced semen quality and male fertility
- The temporal regulation of TEK contributes to pollen wall exine patterning
- Intimate functional interactions between TGS1 and the Smn complex revealed by an analysis of the Drosophila eye development
- Saccharomyces cerevisiae Mus81-Mms4 prevents accelerated senescence in telomerase-deficient cells
- Interaction of YAP with the Myb-MuvB (MMB) complex defines a transcriptional program to promote the proliferation of cardiomyocytes
- Glucose transporter 10 modulates adipogenesis via an ascorbic acid-mediated pathway to protect mice against diet-induced metabolic dysregulation
- Congenital hearing impairment associated with peripheral cochlear nerve dysmyelination in glycosylation-deficient muscular dystrophy
- Population genetic models of GERP scores suggest pervasive turnover of constrained sites across mammalian evolution
- The Mediator CDK8-Cyclin C complex modulates Dpp signaling in Drosophila by stimulating Mad-dependent transcription
- Correction: The persimmon genome reveals clues to the evolution of a lineage-specific sex determination system in plants
- Correction: Rapidly evolving protointrons in Saccharomyces genomes revealed by a hungry spliceosome
- PLOS Genetics
- Archiv čísel
- Aktuální číslo
- Informace o časopisu
Nejčtenější v tomto čísle
- A new neuropeptide insect parathyroid hormone iPTH in the red flour beetle Tribolium castaneum
- The domesticated transposase ALP2 mediates formation of a novel Polycomb protein complex by direct interaction with MSI1, a core subunit of Polycomb Repressive Complex 2 (PRC2)
- Polyploidy breaks speciation barriers in Australian burrowing frogs Neobatrachus
- The phosphorelay BarA/SirA activates the non-cognate regulator RcsB in Salmonella enterica
Zvyšte si kvalifikaci online z pohodlí domova
Mazová zátka a její řešení
nový kurzVšechny kurzy