#PAGE_PARAMS# #ADS_HEAD_SCRIPTS# #MICRODATA#

Caenorhabditis elegans PTR/PTCHD PTR-18 promotes the clearance of extracellular hedgehog-related protein via endocytosis


Authors: Hirohisa Chiyoda aff001;  Masahiko Kume aff001;  Carla Cadena del Castillo aff002;  Kenji Kontani aff001;  Anne Spang aff002;  Toshiaki Katada aff001;  Masamitsu Fukuyama aff001
Authors place of work: Department of Physiological Chemistry, Graduate School of Pharmaceutical Sciences, The University of Tokyo, Tokyo, Japan aff001;  Biozentrum, University of Basel, Basel, Switzerland aff002
Published in the journal: Caenorhabditis elegans PTR/PTCHD PTR-18 promotes the clearance of extracellular hedgehog-related protein via endocytosis. PLoS Genet 17(4): e1009457. doi:10.1371/journal.pgen.1009457
Category: Research Article
doi: https://doi.org/10.1371/journal.pgen.1009457

Summary

Spatiotemporal restriction of signaling plays a critical role in animal development and tissue homeostasis. All stem and progenitor cells in newly hatched C. elegans larvae are quiescent and capable of suspending their development until sufficient food is supplied. Here, we show that ptr-18, which encodes the evolutionarily conserved patched-related (PTR)/patched domain-containing (PTCHD) protein, temporally restricts the availability of extracellular hedgehog-related protein to establish the capacity of progenitor cells to maintain quiescence. We found that neural progenitor cells exit from quiescence in ptr-18 mutant larvae even when hatched under starved conditions. This unwanted reactivation depended on the activity of a specific set of hedgehog-related grl genes including grl-7. Unexpectedly, neither PTR-18 nor GRL-7 were expressed in newly hatched wild-type larvae. Instead, at the late embryonic stage, both PTR-18 and GRL-7 proteins were first localized around the apical membrane of hypodermal and neural progenitor cells and subsequently targeted for lysosomal degradation before hatching. Loss of ptr-18 caused a significant delay in GRL-7 clearance, causing this protein to be retained in the extracellular space in newly hatched ptr-18 mutant larvae. Furthermore, the putative transporter activity of PTR-18 was shown to be required for the appropriate function of the protein. These findings not only uncover a previously undescribed role of PTR/PTCHD in the clearance of extracellular hedgehog-related proteins via endocytosis-mediated degradation but also illustrate that failure to temporally restrict intercellular signaling during embryogenesis can subsequently compromise post-embryonic progenitor cell function.

Keywords:

Caenorhabditis elegans – Embryos – Hedgehog signaling – Larvae – Lysosomes – Molting – Reporter genes – Stem cells

Introduction

C. elegans L1 larvae hatch out of their eggshells with quiescent stem and progenitor cells. Sufficient food supply initiates L1 development by coordinating the release of stem and progenitor cells from quiescence [14]. Conversely, under nutritionally unfavorable conditions, the newly hatched larvae enter developmental dormancy, called L1 arrest or L1 diapause, and survive for weeks until ample food becomes available [5]. Because of the ease of manipulating and tracking their quiescence and reactivation, stem and progenitor cells in C. elegans L1 larvae have served as excellent models to study the nutritional regulation of stem cells in vivo.

Previous studies have shown that the insulin/insulin-like growth factor signaling (IIS) pathway plays a critical role in the developmental decision in response to nutrient availability. For example, loss of daf-16/foxo, which results in the constitutive activation of the IIS pathway, causes unwanted reactivation of many types of somatic progenitor cells, such as the P neuronal and M mesodermal progenitor cells [2,6]. MicroRNA (miR)-235 acts partly downstream of the IIS pathway to regulate a subset of L1 developmental events during L1 arrest [7]. Expression analysis and rescue experiments suggested that the miRNA primarily acts in the hypodermis to suppress the reactivation of P and M progenitor cells [7]. These findings led us to identify grl-5 and grl-7 as target genes of miR-235 that mediate the non-autonomous regulation of P cell quiescence by the hypodermis [8]. Both grl-5 and grl-7 encode putative secreted proteins and belong to the hedgehog-related (hh-r) gene family, which has been proposed to have evolved from the same ancestral gene as hedgehog (Hh) in other animals [9]. Inhibition of grl-5 and grl-7 can partially suppress the inappropriate reactivation of P cells in starved mir-235 larvae, suggesting that these grl genes promote cellular events.

Several genes in the Hh signaling pathway, such as Hh, Smoothened, Cos2, Fused, and Suppressor of Fused are absent in the C. elegans genome [10]. However, the nematode possesses two patched orthologs, ptc-1 and ptc-3 [11]. Knockdown of ptc-3 and multiple hh-r genes results in molting defects, raising the possibility that these genes act together in the same genetic pathway [12,13]. In addition to hh-r and ptc genes, some of the ptr (patched-related) genes were also shown to result in similar molting defects [12,14]. PTR, also called patched domain-containing (PTCHD) proteins, are found in other species such as Drosophila, mouse, and human [11,15]. PTR/PTCHD contains a region that is conserved among the Niemann-Pick Type C proteins, which are involved in cholesterol transport, the Dispatched protein, which promotes the secretion of Hh protein, and the Hh receptor Patched [1619]. This membrane-spanning region contains the “sterol-sensing domain,” which is involved in binding to and sensing cholesterol [19,20]. In addition, PTR/PTCHD, NPC1, Dispatched, and Patched proteins belong to the resistance, nodulation, and division (RND) transporter superfamily [21]. Members of the superfamily generally contain a 12-transmembrane (TM) domain, which is thought to have arisen from an intragenic duplication of a six-transmembrane domain [22], and a conserved GXXXD motif, which has been shown to play a critical role in the bacterial RND transporter activity [23,24]. Furthermore, Patched, Dispatched, and PTR/PTCHD proteins contain not only an expanded GXXXDD motif within TM4 but also a GXXXD/E motif within TM10 [13]. Introduction of mutations in Patched GXXXDD motif and in Dispatched GXXXDD and GXXXD/E motifs impairs their activities [13,2527].

Although the ptr/ptchd genes are conserved among several animal species, little is known about their cellular functions. Mutations in the human ptchd1 gene are found in patients with autistic spectrum disorders and learning disabilities [2834]. Furthermore, ptchd1 knockout mice show attention-deficit hyperactivity disorder (ADHD)-like phenotypes [35]. Loss of the Drosophila ptr gene results in embryonic lethality [36]. In addition to their involvement in molting, the functions of few C. elegans ptr genes have been reported in detail. For instance, daf-6 is involved in the formation of the glial channel that surrounds the receptive endings of the sensory neurons and likely regulates vesicular transport [3740]. ptr-24 has been proposed to act downstream of the hh-r gene, grl-21, to regulate mitochondrial fragmentation and lipid accumulation [41]. Additionally, wrt-10, which belongs to another subfamily of hh-r genes, reportedly promotes oocyte quality maintenance and delays reproductive decline via ptc-1 and ptr-2 [42].

Here, we show that C. elegans PTR-18 promotes the clearance of extracellular Hh-related proteins via endocytosis-mediated degradation, potentially acting as its decoy receptor. Under nutrient-deficient conditions that force the wild-type larvae to enter L1 arrest, newly hatched ptr-18 mutant L1 larvae show reactivation of P progenitor cells. This arrest-defective phenotype is suppressed by the inhibition of a particular set of grl genes, including grl-5, grl-7, and grl-27. Unexpectedly, analysis using reporter genes showed that neither PTR-18 nor GRL-7 were expressed in newly hatched larvae. Instead, these proteins are temporally localized along the periphery of the apical membranes of hypodermal and P neuronal progenitor cells during late embryogenesis and are subsequently targeted to lysosomal degradation before hatching. This temporally controlled clearance of GRL-7 requires activity of PTR-18, so that newly hatched ptr-18 mutant larvae still exhibit extracellular GRL-7 accumulation. Furthermore, the GXXXDD motif within TM4, the GXXXD/E motif within TM10, and the cytoplasmic C-terminal portion of PTR-18 protein are indispensable for its appropriate function. These findings reveal a previously undescribed function of PTR/PTCHD as a sink for extracellular Hh-related proteins and illuminate the importance of the temporal regulation of extracellular signaling in maintaining progenitor cell function.

Results

ptr-18 is required to maintain the quiescence of progenitor cells during L1 arrest

As shown in Fig 1A, six pairs of P neural progenitor cells first reside along the ventrolateral sides in newly hatched larvae. When the larvae are supplied with ample food, the most anterior pair of quiescent P cells migrate into the ventral nerve cord during the mid-L1 stage, followed successively by the more posterior pairs. This reactivation of quiescent P cells is easily detected under a differential interference contrast microscope [43]. Our previous studies showed that forced expression of the hh-r gene, grl-7, in starved L1 larvae can reactivate P neuroblasts [8]. In addition, grl-7 and another hh-r gene, grl-5, partially mediate reactivation of P neuroblasts in starved mir-235 mutant L1 larvae [8]. RNAi targeting some of the hh-r and ptr genes results in similar developmental defects, such as failure to complete molting and small body size [1214], suggesting that these genes act in the same genetic pathway. Similarly, previous studies have proposed that grl-21 negatively regulates ptr-23 to regulate mitochondrial fragmentation and lipid accumulation [41]. Thus, we hypothesized that the ptr gene may be involved in maintaining the quiescence of P cells during L1 arrest by antagonizing the activity of grl-5 and grl-7. We found that among the available ptr mutants, the majority of ptr-18 mutant larvae showed reactivation of P cells when starved after hatching (Fig 1B and 1C). Further, we conducted RNAi against ptr-2, 4, 6, 9, 11, 13, 14, 16, 17, 19, 20, 22, 23, and 24, and none of the starved L1 larvae from RNAi-treated mothers showed abnormal P cell reactivation (50 animals were scored; n = 1). Since ptr-18 mutant animals exhibit a P cell defect at relatively high penetrance, we decided to focus our analysis on the ptr-18 gene. In addition, reactivation of the mesoblast M cell and molting were observed in starved ptr-18 mutant larvae (Fig 1D). As observed in mir-235 mutant animals [7], animals that had undergone M cell proliferation always show migrated P cell(s), whereas molted animals always harbor reactivated P and M cells (Fig 1E), suggesting that P cells, M cell, and molt become activated in this strict order in starved ptr-18 animals. In contrast, the primordial germ cells, Z2 and Z3, remain quiescent in ptr-18 mutant larvae after 5-day L1 starvation (S1A Fig), similar to the daf-16/foxo and mir-235 mutant animals [3,7]. When starved in cholesterol -⁠ and ethanol-free complete S medium after hatching, most of the daf-16/foxo-null mutant animals could not survive beyond 10 days (S1B Fig). In contrast, ptr-18 mutant animals were relatively resistant to starvation stress, similar to the wild-type animals (S1B Fig).

Fig. 1. ptr-18 is required for maintaining the quiescence of progenitor cells during L1 arrest.
<i>ptr-18</i> is required for maintaining the quiescence of progenitor cells during L1 arrest.

Activities of grl-5, grl-7, and grl-27 are required for P cell reactivation in starved ptr-18 mutant animals

Given the similarity of GRLs to Hh and PTR-18 to PTC, we examined whether GRL-5 and GRL-7 would act through PTR-18 or independently. To this end, we tested whether the activities of grl-5 and grl-7 contribute to the inappropriate reactivation of P cells in the starved ptr-18 mutant larvae. Deletion mutations of these grl genes were introduced in ptr-18 mutant animals. Unexpectedly, we found that the inhibition of both grl-5 and grl-7 almost completely suppressed the phenotype in the ptr-18 mutant larvae, suggesting that ptr-18 acts upstream of, but not downstream of, these grl genes (Fig 1F). Previous studies have shown that the inhibition of grl-5 and grl-7 activities only partially suppresses the defect in mir-235 mutant larvae [8]. Thus, these observations suggest that the reactivation of P cells in ptr-18 mutant animals is heavily dependent on the activity of these grl genes. Previous studies using reporter genes suggested that in addition to grl-5 and grl-7, several other grl genes are expressed in the P and hypodermal cells [44]. Strikingly, the inhibition of grl-27 comparably suppressed the phenotype in ptr-18 mutant animals, similarly to grl-5 and grl-7 (Fig 1F). In contrast, the elimination of grl-2, grl-4, grl-5, grl-10, grl-15, grl-17, and grl-21 activities did not significantly affect the defect (Fig 1F). These findings suggest that ptr-18 antagonizes the activity of a specific subset of grl genes among those expressed in the P and hypodermal cells. Because grl-5, grl-7, and grl-27 are required for P cell activation in starved ptr-18 mutant animals, these grl genes might also play a critical role in the exit of P cells from quiescence in well-fed wild type animals. However, the triple mutant animals of grl-5, grl-7, and grl-27 did not exhibit a delay in the timing of P cell activation under the fed condition (S1C Fig). These findings suggest that these grl genes do not contribute to P cell reactivation under the fed condition. Alternatively, an additional hh-r gene may act together with these grl genes.

Spatiotemporal dynamics of PTR-18::GFP reporter expression

To elucidate the expression pattern of ptr-18, we constructed a GFP translational reporter by inserting the gfp gene into the open reading frame of the ptr-18 gene in the fosmid WRM0613dH03.1. This fosmid ptr-18 reporter gene was introduced as an extrachromosomal array. Expression of PTR-18::GFP was bright enough for live imaging, though it should be noted that genes in the extrachromosomal array generally tend to be overexpressed. PTR-18::GFP was first detected along the apical side of surface cells that cover the whole body, which consists of hypodermal, seam, and P cells at the 3-fold stage during embryogenesis (Fig 2A; also see S4 Fig below). To determine the localization pattern of PTR-18::GFP in 3-fold embryos in detail, we dissolved the gravid, transgenic animals to harvest early embryos and allowed them to grow synchronously. Transition of the population ratio of 2-fold embryos, 3-fold embryos, and L1 larvae from 9 to 16 h after harvest confirmed the developmental synchronization of the collected embryos (S2A Fig). During the early time point, the majority of the 3-fold embryos initially showed apical localization of PTR-18::GFP (Fig 2A and 2B). As development continued, the percentage of the apical localization decreased, the fraction that exhibited localization of PTR-18::GFP in the vesicular punctate structures increased, and eventually, most of the embryos did not show its expression (Fig 2A and 2B). These observations indicate that PTR-18::GFP first localizes at the apical side of the hypodermal, seam, and P cells, subsequently accumulates in the vesicular structures, and eventually disappears before hatching. Unexpectedly, despite the robust phenotypes of ptr-18(ok3532) animals during L1 arrest, faint expression of PTR-18::GFP was only occasionally observed in the excretory duct and G1 pore cells during L1 starvation (Fig 2C). Expression of PTR-18::GFP only reappeared along the apical surface of the hypodermal, seam and P cells 11 h after the L1-arrested larvae were fed, which was several hours after P cell reactivation was initiated (S2B Fig). These observations raise the possibility that ptr-18 acts before hatching to regulate the quiescence of P cells. PTR-18::GFP was also expressed in the descendants of P cells (S2B Fig; arrows), rectal epithelial F, K, and U cells (S2B Fig; arrowhead), and some seam cells in late L1 larvae (S2C Fig; red arrowheads).

Fig. 2. ptr-18 acts in P and hypodermal cells.
<i>ptr-18</i> acts in P and hypodermal cells.

ptr-18 acts in P and hypodermal cells

There is an open reading frame, Y38F1A.4, within the third intron of the ptr-18 gene. However, the expression of ptr-18 cDNA::venus fusion gene under the control of its native promoter almost completely suppressed the inappropriate reactivation of P cells in starved ptr-18 mutant larvae, indicating that the observed defects were caused by the reduced activity of ptr-18 and not of Y38F1A.4 (Fig 2D).

To determine the site of ptr-18 action, ptr-18 cDNA::venus was expressed under the control of promoters whose activities were specific to the cells and tissues where the ptr-18::gfp was expressed (S2D Fig). When ptr-18 cDNA::venus was expressed under the control of the dpy-7 promoter, which is active in hypodermal, part of seam, and P cells [45], it rescues the P cell activation defect of ptr-18 mutant animals as efficiently as ptr-18 cDNA::venus driven by the native promoter (Fig 2D). In contrast, the phenotype was hardly affected when ptr-18::venus was expressed under the control of the lin-48 promoter, which is active in the excretory duct as well as F, K, U cells [46], and the dct-5 promoter, which was previously used to mark the G1 and duct cells [47]. Furthermore, the expression of ptr-18::venus in either P or hypodermal and some seam cells driven by the hlh-3 promoter [48] and Q system [49], respectively, could efficiently suppress the phenotype (Figs 2E and S2E–S2G), suggesting that ptr-18 acts both autonomously and non-autonomously to maintain the quiescence of P cells. Because PTR-18::GFP was detected in the hypodermal, seam, and P cells only during the 3-fold stage before P cells become reactivated (Fig 2A and 2B; see also S4 Fig below), ptr-18 acts before hatching to regulate the quiescence of P cells.

GRL-5 and GRL-7 reporter proteins show expression patterns similar to that of PTR-18::GFP

Although the loss of grl-5, grl-7, and grl-27 can suppress the defects in ptr-18 mutant animals, whether PTR-18 and these GRL proteins act in spatial and temporal proximity remains undetermined. To assess the interaction between ptr-18 and grl genes, we constructed a grl-7::mcherry::3xflag gene by inserting the mcherry::3xflag tag into the grl-7 genomic region in the fosmid WRM0615cE01 (see Materials and Methods). Similar to PTR-18::GFP, GRL-7::mCherry::3xFLAG was first detected in the 3-fold embryos (Fig 3A). Previous studies have shown that grl-7 encodes a protein with a predicted signal sequence at the N-terminus, and its transcriptional reporter genes are expressed in hypodermal, seam and P cells [44]. Consistently, GRL-7::mCherry::3xFLAG localized along the apical side of the surface cells that cover the whole body as well as in the intracellular structures of these cells (Fig 3A; also see S4 Fig for details). As observed for PTR-18::GFP, the majority of the GRL-7::mCherry::3xFLAG embryos initially showed an apical distribution. However, as the embryos neared hatching, internal, vesicular localization became predominant (Figs 3B and S3A). After hatching under the feeding condition, apical localization of GRL-7::mCherry::3xFLAG remained undetectable until 11 h post-feeding of the L1-arrested larvae (S3B Fig). To further define the expression patterns of GRL-7, the mcherry tag was introduced before the stop codon of the grl-7 gene using the CRISPR/Cas9 system, and its expression patterns were analyzed via super-resolution confocal microscopy. We first confirmed that GRL-7::mCherry was removed from the apical side of the cell before hatching by comparing its fluorescence intensity along the apical side of the cell and inside the cell, which is marked by cytoplasmically localized GFP::RAB-7, (Fig 3C and 3D; also see below). As predicted by the presence of N-terminal signal sequence [9], the apically localized GRL-7::mCherry does not overlap with cytoplasmic GFP::RAB-7, suggesting that GRL-7 was secreted (Fig 3C). During this analysis, we noticed that GRL-7::mCherry-positive vesicular structures were found in hypodermal, seam, and P cells in newly hatched larvae (Fig 3E). To compare the spatiotemporal dynamics of PTR-18 and GRL-7, the ptr-18::gfp fosmid reporter gene was introduced as an extrachromosomal array to the CRISPR-generated grl-7::mcherry strain (S4 Fig). GRL-7::mCherry exhibits striped patterns of localization, which likely shows annular furrows [50] (S4A, S4B and S4D Fig). On the other hand, PTR-18::GFP is relatively uniformly distributed over the body surface, consisting of hypodermal, seam, and P cells. Consistent with the prediction that PTR-18 localizes to the plasma membrane, PTR-18::GFP formed a layer underneath the apically distributed GRL-7::mCherry (S4C Fig). All of the embryos that expressed detectable levels of PTR-18::GFP also clearly showed apically localized GRL-7::mCherry (n = 25), consistent with the observations that the former was removed from the apical side slightly earlier than the latter (compare Figs 2B and 3B). We noticed that the PTR-18::GFP positive and GRL-7::mCherry positive internal structures show a partial overlap (S4E Fig). The co-localization was further confirmed via structured illumination microscopy in L4 larvae (S4F Fig).

Fig. 3. GRL-7 reporter proteins show expression patterns similar to that of PTR-18::GFP.
GRL-7 reporter proteins show expression patterns similar to that of PTR-18::GFP.

Additionally, GRL-5::mCherry::3xFLAG expressed from the fosmid-based reporter gene showed a spatiotemporal expression pattern similar to that of GRL-7::mCherry::3xFLAG (S3C and S3D Fig). On the other hand, we could not detect the expression of GRL-27::mCherry::3xFLAG in several lines of animals carrying the grl-27::mcherry::3xflag fosmid-based transgene under the fluorescent microscope. In contrast to the GRL-7 and GRL-5 reporter proteins, mCherry-fused DPY-7 collagen protein remained predominant along the apical surface of hypodermal cells around hatching (S3E Fig). Previous studies have shown that DPY-7 protein localizes to annular furrows [51], at which GRL-7::mCherry also likely resides (S4 Fig). These observations implicated that dynamic remodeling of the cuticle components around the hatching takes place despite the absence of molting.

PTR-18 and GRL-7 reporter proteins are internalized by endocytosis

To determine the identity of vesicles in the PTR-18::GFP internal structures, we transformed both ptr-18::gfp reporter and endo-lysosomal markers and analyzed them for potential co-localization by the super-resolution microscopy. PTR-18::GFP partially co-localized with mCherry::RAB-5 [52] (Fig 4A), mCherry::RAB-7 [53] (Fig 4B), mCherry::RAB-11 [53] (Fig 4C), and LMP-1::mCherry [54] (Fig 4D), which reside in early, late, and recycling endosomes and lysosomes, respectively. These observations suggest that PTR-18 is internalized by endocytosis, and a fraction can be recycled to the plasma membrane, while the other fraction is degraded in the lysosome. Next, we transformed the CRISPR-generated grl-7::mcherry strain with endo-lysosomal markers. Although most of the endosomes and lysosomes during the 3-fold stage could not be recognized as ring structures (Fig 4), GRL-7::mCherry localized within GFP::RAB-5, GFP::RAB-7, and LMP-1::GFP-positive vesicles (Fig 5A, 5C and 5D). In addition, GRL-7::mCherry colocalized with GFP::RAB-11 (Fig 5B). These findings suggest that the localization of both PTR-18 and GRL-7 is regulated by the endocytic pathway.

Fig. 4. PTR-18::GFP localized to endosomes and lysosomes.
PTR-18::GFP localized to endosomes and lysosomes.
Super-resolution images showing expression patterns of PTR-18::GFP and markers for endosomes and lysosomes. (A–D) Images on top rows show the maximum intensity Z projection of an entire embryo expressing indicated reporters, and scale bars indicate 10 μm. Images in the bottom rows show a magnified view of a Z section selected from the Z stacks of the above row, and scale bars indicate 1 μm (A, B, and D) or 2 μm (C). Intensity profiles along the arrow in each of the magnified image are shown on the right.
Fig. 5. GRL-7::mCherry are localized to endosomes and lysosomes.
GRL-7::mCherry are localized to endosomes and lysosomes.
Super-resolution images showing the expression patterns of GRL-7::mCherry and markers for endosomes and lysosomes. (A–D) Images on top rows show the maximum intensity Z projection of an entire embryo expressing indicated reporters, and scale bars indicate 10 μm. Images on bottom rows show a magnified view of a Z section selected from the Z stacks of the above row, and scale bars indicate 1 μm. Intensity profiles along the arrow in each of the magnified image are shown on the right.

To test this possibility, we examined whether rab-5(RNAi), which blocks endocytosis [52], suppresses the internalization of GRL-7::mCherry. Strikingly, some of the newly hatched rab-5(RNAi) L1 larvae exhibited apical, striped patterns of GRL-7::mCherry (Fig 6A). Quantitation of the fluorescence intensity of apical and cytoplasmic GRL-7::mCherry in newly hatched larvae indicates that rab-5(RNAi) interferes with the internalization of the reporter protein (Fig 6B and 6C). We also conducted rab-5(RNAi) using the CRISPR-generated grl-7::mcherry strains carrying ptr-18::gfp in extrachromosomal arrays. Whereas no newly hatched larvae derived from mothers treated with control RNAi showed detectable levels of PTR-18::GFP (n = 300), rab-5(RNAi) caused the apical distribution of PTR-18::GFP (Fig 6D; 18,9%; n = 53). These findings suggest that extracellular GRL-7 is sequestered with PTR-18 from the apical side of cells via endocytosis.

Fig. 6. GRL-7::mCherry and PTR-18::GFP are internalized via endocytosis.
GRL-7::mCherry and PTR-18::GFP are internalized via endocytosis.
(A) Images of maximum intensity Z projections showing a part of the bodies of newly hatched larvae. Note the apical localization of GRL-7::mCherry in the rab-5(RNAi) animal. Scale bar: 10 μm. (B) Magnified images of RNAi-treated animals. Apically localized GRL-7::mCherry are indicated by arrowheads. Scale bar: 1 μm. (C) Quantitation of fluorescence intensity of apical and cytoplasmic GRL-7::mCherry. Localization of apical and cytoplasmic GRL-7::mCherry are defined by the area outside and within GFP::RAB-7 distribution, respectively. ***: P<0.001 (unpaired two-sided t-test). (D) Apical localization of PTR-18::GFP are detected in newly hatched rab-5(RNAi) larvae. Images of maximum intensity Z projections are shown. Scale bar: 10 μm.

ptr-18 is required for the temporally-regulated internalization of GRL-7 reporter protein

Genetic interactions suggest that ptr-18 acts upstream of grl-5, grl-7, and grl-27. To test whether ptr-18 contributes to the spatiotemporal distribution of these GRL proteins, a grl-7::mcherry::3xflag fosmid reporter was introduced into the ptr-18 mutant animals. As shown in Fig 3A–3D, almost all of the newly hatched wild-type larvae showed a vesicular pattern of GRL-7::mCherry::3xFLAG localization (Fig 7A and 7B). In contrast, in the newly hatched ptr-18 mutant larvae, GRL-7::mCherry::3xFLAG still accumulated along the apical surface of hypodermal cells (Fig 7A and 7B). These apically-localized GRL-7::mCherry::3xFLAG in the newly hatched ptr-18 mutant larvae was eventually internalized, when these larvae were continuously cultured under starved and fed conditions (S5A–S5C Fig). This prolonged apical localization of GRL-7::mCherry::3xFLAG in starved ptr-18 L1 larvae was suppressed by the expression of ptr-18::venus under the control of the P cell-specific, hlh-3 promoter (S5D and S5E Fig), showing a correlation between defects in the clearance of apical GRL-7 reporter and maintenance of P cell quiescence (Fig 2E).

Fig. 7. ptr-18 is required for the timely internalization of GRL-7.
<i>ptr-18</i> is required for the timely internalization of GRL-7.
(A) Newly hatched wild-type and ptr-18 mutant L1 larvae showing vesicular (left) and apical/vesicular (right) distribution of GRL-7::mCherry::3xFLAG, respectively. The bottom panels are magnified views of the area within the rectangle from the images above. Scale bars indicate 10 μm (upper panel) and 1 μm (bottom panel). Photographs were taken with the same exposure time. (B) Apical localization of GRL-7::mCherry::3xFLAG was detected in most of the starved ptr-18 mutant larvae. n ≥50 animals were scored for each genotype. Data were collected after 24 h L1 starvation and are presented as mean ± SD. Experiments were repeated three times, and n ≥50 animals were scored for each trial. ****: p <0.0001 (Fisher’s exact test). (C) Loss of ptr-18 blocks the sequestration of GRL-7::VENUS. Wild-type and ptr-18 mutant 3-fold embryos and L1 larvae after 24 h L1 starvation are shown. Photographs were taken with the same exposure time. Scale Bars: 10 μm. (D) Percentage of starved wild-type and ptr-18 mutant L1 larvae showing GRL-7::VENUS expression. Data were collected after 24 h L1 starvation and are presented as mean ± SD. Experiments were repeated three times, and n ≥50 animals were scored for each trial. ****: p <0.0001 (Fisher’s exact test). (E) GRL-7 reporter protein is upregulated in newly hatched ptr-18 mutant animals. Lysates from three biological samples were examined for newly hatched wild-type and ptr-18 mutant larvae. GRL-7::VENUS::3xFLAG was detected by anti-GFP antibody. The specificity of the antibody was confirmed using the lysate from non-transgenic wild-type animals on the right lane. Intensity of GFP bands were normalized by those of the corresponding tubulin bands for quantitation. *: P <0.05 (unpaired two-sided t-test).

In general, GFP and its derivatives are sensitive to acid quenching in lysosomes. In contrast, RFP and its derivatives are relatively acid tolerant and resistant to lysosomal enzymes [55]. Similar to mCherry-fused GRL-7 reporter proteins, GRL-7::VENUS driven by the native promoter was found to exhibit apical localization in wild-type 3-fold embryos (Fig 7C). However, GRL-7::VENUS was undetectable after hatching (Fig 7D). These observations are consistent with the above data, suggesting that GRL-7 is internalized via endocytosis before hatching (Figs 5 and 6). Furthermore, most of the newly hatched ptr-18 L1 larvae exhibited detectable levels of GRL-7::VENUS (Fig 7C and 7D), suggesting that the loss of ptr-18 causes a significant delay in GRL-7 endocytosis. Although the difference in these expression patterns between wild-type and ptr-18 mutant animals is obvious, it remains possible that this was caused by the overexpression of the grl-7 reporter from extrachromosomal arrays. To exclude this possibility and obtain more quantitative insights into the regulation of GRL-7 protein levels by ptr-18, we introduced a venus::3xflag tag in front of the stop codon of the grl-7 gene using the CRISPR/Cas9 system. Although the GRL-7::VENUS::3xFLAG expression was too faint for live cell imaging, immunoblot analysis showed that the level of tagged GRL-7 protein was upregulated in newly hatched ptr-18 L1 animals compared to that in wild-type animals (Fig 7E). Thus, these observations explain why the loss of ptr-18 causes developmental defects in a grl-7-dependent manner under the post-hatch starved condition, although neither PTR-18 nor GRL-7 protein was detected in newly hatched wild-type larvae. The untimely extracellular presence of GRL-7 due to the absence of PTR-18 will lead to the re-activation of the P cell irrespective of the dietary environment.

In contrast, the temporally controlled internalization of GRL-5::mCherry::3xFLAG was not affected by the loss of ptr-18 (S6A and S6B Fig). Similar to GRL-7::VENUS, GRL-5::VENUS was also detected along the apical surface of hypodermal cells in both wild-type and ptr-18 mutant 3-fold embryos (S6C Fig). However, GRL-5::VENUS was undetectable in both wild-type and ptr-18 mutant L1 larvae (S6C and S6D Fig). Although we cannot exclude the possibility that similar to GRL-7, ptr-18 also promotes timely internalization of GRL-5, the above observations suggest that PTR-18 dependent uptake is not the major route, if at all.

Previous studies have shown that both daf-16/foxo and mir-235 mutant larvae fail to maintain the quiescence of multiple progenitor cells [2,6]. The temporally regulated internalization of GRL-7::mCherry::3xFLAG was not affected in newly hatched daf-16/foxo and mir-235 L1 larvae, suggesting that these genes and ptr-18 regulate L1 arrest through distinct mechanisms (S7A Fig). mir-235 downregulates grl-7 via the miR-235 target site on the 3’UTR of grl-7 mRNA [8]. In contrast, our findings suggest that ptr-18 suppresses grl-7 via endocytosis-mediated degradation, raising the possibility that ptr-18 and mir-235 regulate the quiescence of P cells in genetically parallel pathways. Consistent with this, the loss of mir-235 in ptr-18 mutant animals significantly enhanced the quiescent defective phenotype (S7B Fig).

These findings suggest that the internalization and subsequent lysosomal degradation of GRL-7 before hatching play critical roles in establishing the capacity of neural progenitor cells to maintain quiescence under starved conditions.

The GXXXDD and GXXXD/E motifs and C-terminal cytoplasmic region of PTR-18 protein are required for appropriate localization and function

Similar to the Patched and Dispatched proteins of the Hh signaling pathway, PTR/PTCHD contains GXXXDD and GXXXD/E motifs within TM4 and TM10, respectively [13]. These proteins belong to the RND transporter superfamily [21], and the GXXXD motif in its bacterial prototype transporters is indispensable for their transporter activity [23,24]. Furthermore, mutations in GXXXDD and GXXXD/E motifs have been shown to be functionally essential for Patched and Dispatched proteins [13,2527]. To test whether these conserved motifs (Fig 8A) and carboxy-terminal cytoplasmic tail, which is predicted by the TMHMM algorithm (Fig 8B) [56], critically contributed to the activity of PTR-18, PTR-18(D337A, D338A)::VENUS, PTR-18(G746A, D750A)::VENUS, and PTR-18(Δ837–895)::VENUS were expressed in ptr-18(ok3532) animals. All these mutant PTR-18::VENUS proteins failed to restore the defect in maintaining P cell quiescence (Fig 8C). These findings demonstrated that GXXXDD and GXXXD/E motifs and putative carboxy-terminal cytoplasmic tail are required for appropriate function. Therefore, PTR-18 is most likely a transporter, similar to the bacterial RND transporters, human PTCH, and C. elegans PTC-3 [25,5759].

Fig. 8. The GXXXDD and GXXXD/E motifs and C-terminal cytoplasmic region of PTR-18 protein are required for appropriate function.
The GXXXDD and GXXXD/E motifs and C-terminal cytoplasmic region of PTR-18 protein are required for appropriate function.
(A) Comparison of GXXXDD and GXXXD/E motifs. The amino acid substitutions introduced in PTR-18(D337A, D338A)::VENUS and PTR-18(G746A, D750A)::VENUS are shown in the bottom panel. (B) Membrane topology of PTR-18 predicted by the TMHMM algorithm. Note that the C-terminal portion of PTR-18 is predicted to be cytoplasmic. (C) Effects of mutated PTR-18::VENUS on the defects of ptr-18 mutant animals in maintaining P cell quiescence. Animals that did not inherit the array expressing PTR-18::VENUS were used as “control.” NS: Not statistically significant (Fisher’s exact test). (D) Model of the clearance of extracellular GRL-7 by PTR-18. In 3-fold, wild-type embryos, PTR-18 promotes the endocytosis of secreted GRL-7 to facilitate their degradation, so that newly hatched animals can retain developmental quiescence under a starvation condition. In contrast, residual activity of extracellular GRL-7 in newly hatched, ptr-18 mutant animals can cause unwanted initiation of L1 developmental events such as P and M cell activation when the animals happen to encounter a starvation condition. Although PTR-18 and GRL-7 are transported together to lysosomes, whether PTR-18 and GRL-7 physically associate with each other remains undetermined.

Altogether, we conclude that ptr-18 temporally restricts the activity of GRL-7 within 3-fold stage of embryogenesis by facilitating its internalization and subsequent lysosomal degradation. Defects in this temporal restriction cause prolonged accumulation of extracellular GRL-7 beyond hatching, which compromises the capacity of neural progenitor cells to respond to nutritional stress (Fig 8D).

Discussion

ptr-18-dependent restriction of GRL activity allows neural progenitor cells to anticipate nutritional stresses before hatching

In this study, we first found that one of the C. elegans ptr/ptchd orthologs, ptr-18, is required to prevent P neuronal progenitor cells from undergoing unwanted reactivation when newly hatched larvae encounter starvation conditions. This reactivation requires the activity of grl-5, grl-7, and grl-27 hh-r genes but not other grl genes known to be expressed in the hypodermal and P cells. While PTR-18 first begin to accumulate along the apical cell membrane of hypodermal, seam and P cells at the late embryonic stage, GRL-7 becomes enriched at the specific regions of the cuticle, which are probably annular furrows. PTR-18 is subsequently internalized slightly earlier than GRL-7. However, both proteins eventually together populate endosomal and lysosomal compartments, resulting in the clearance of their apically localized fractions before hatching. Loss of ptr-18 activity causes significant delay in this endocytosis-mediated degradation of GRL-7, such that newly hatched ptr-18 mutant larvae still exhibit extracellular GRL-7 accumulation. Furthermore, the potential transporter activity of PTR-18 is required for its appropriate function. These findings suggest that ptr-18 temporally limits the activity of GRL-7 to establish the capacity of neural progenitor cells to maintain quiescence in response to nutritional stresses and also provide unique insights into the cellular role of PTR/PTCHD in promoting the clearance of extracellular Hh-related protein by targeting it to lysosomal degradation.

Potential role of PTR-18 as a decoy receptor for GRL-7

Our studies suggest that PTR-18 temporally restricts the availability of extracellular GRL-7 protein by targeting it to lysosomal degradation via endocytosis. Similarly, previous studies have shown that Hh receptor Patched sequesters Hh through endocytosis to limit the spatiotemporal range of its action in Drosophila and vertebrates [6063]. In addition to sequestering Hh ligand, Patched also confers “ligand-independent antagonism” against Hh signaling by inhibiting Smo activity [60]. On the other hand, the reactivation of P cells observed, caused by the loss of ptr-18, was almost completely dependent on the activity of grl genes. Thus, in contrast to Patched, PTR-18 is unlikely to be coupled to the signaling components that act downstream of GRL-7. PTR-18 seems to act as its decoy receptor, whose function is only to sequester extracellular GRL-7 protein. This model is reminiscent of the D6 chemokine receptor, which has been proposed to act as a decoy receptor that is unfit for signaling, but can scavenge chemokines by constitutively delivering it to lysosomes [64,65] and whose loss results in prolonged inflammation due to impaired chemokine clearance [66]. This could explain the observation that the expression of ptr-18 in hypodermal or P cells can restore the quiescent defective phenotype of prt-18 mutant animals (Fig 2E). In these experiments, ptr-18 could be overexpressed under the control of the heterologous promoter from the extrachromosomal arrays, and when sufficient amount of PTR-18 protein is expressed in either type of cells, extracellular GRL-7 protein would be removed before hatching.

In addition to PTR-18, other PTR/PTCHD proteins such as Drosophila PTR and the C. elegans DAF-6 reporter protein reportedly localize to unidentified intracellular vesicles [36,37,67]. Conversely, daf-6 mutations result in excessive accumulation of glial-secreted extracellular matrix in a channel formed by glial cells [68], which led to the model where daf-6 antagonizes the secretion of vesicles containing the matrix or promotes their uptake [69]. Although the involvement of hh-r genes in daf-6-dependent processes remains unexplored, reporters of some hh-r genes have been shown to be expressed in the glial socket and sheath cells, in which daf-6 restricts the channel size [9,38,44,70]. In contrast to the hh-r genes [9,44], a comprehensive reporter expression analysis of C. elegans ptr genes has not yet been reported. However, a genome-wide expression analysis showed that most of the ptr genes exhibit oscillatory expression patterns, similarly to hh-r genes [71]. Considering that C. elegans hh-r and ptr genes are extensively diverged [9,11,72], each PTR protein may further fine-tune the oscillatory activity of a particular set of Hh-r proteins via their endocytosis-mediated degradation.

Receptor for GRL-5, GRL-7, and GRL-27

In this study, we showed that ptr-18 acts upstream of the grl-5, grl-7, and grl-27 genes. Little is known about the genetic pathway that the hh-r genes act on. In Drosophila and vertebrates, Hh and sonic hedgehog (Shh) stimulate Hh signaling through their receptor, Patched [73,74]. Although C. elegans possesses two genes, ptc-1 and ptc-3, which encode patched orthologs, their relationship with hh-r genes remains ambiguous. However, RNAi targeting ptc-3 and several ptr and hh-r genes results in molting defects [12], suggesting that ptc-3 and at least some of the ptr and hh-r genes may participate in similar pathways [10]. Our attempt to test whether ptc-3 is involved in maintaining L1 arrest was hampered by the severe embryonic lethality caused by the loss of ptc-3. This technical difficulty will need to be overcome for further elucidation of the ptr-18-dependent regulation of L1 arrest.

Do PTR/PTCHD proteins in other animals also act as decoys for Hh? Overexpression of human PTR/PTCHD, PTCHD1, and PTCH53 (also called PTCHD4) proteins in Shh-responsive C3H10T1/2 cells suppressed Hh signaling [29,75]. In contrast, the expression of PTCHD1 in patched1 (ptch1)-deficient mouse embryonic fibroblasts did not repress the canonical Hh signaling pathway [76]. These observations raise the possibility that PTCHD functions upstream of Patched, possibly by acting as a decoy receptor for Shh. However, the expression of PTCH53 in the DAOY cancer cell line inhibited the upregulation of the Hh pathway via the Smo agonist, purmorphamine, raising the possibility that PTCH53 acts downstream of Smo [75]. In contrast to these in vitro studies, there is insufficient evidence that Drosophila PTR and mammalian PTCHD proteins impinge upon the Hh pathway in vivo. Unlike ptch1-deficient mice, ptchd1-knockout mice did not show overproliferation of neuronal precursors in the brain [77]. In vertebrates, a vertebrate-specific Hh-interacting protein 1 (Hhip1, also called Hip1) also functions together with Patched to antagonize Hh activity through its direct binding [7882]. Thus, the loss of ptchd1 might be compensated by Hhip1 in vertebrates. In Drosophila, which does not have the Hhip1 ortholog, Hh is still internalized in the absence of Patched [63]. Thus, this patched-independent internalization might be mediated by PTR.

hh-r genes may promote the progression of larval development

We have shown that grl-5, grl-7, and grl-27 contribute to the reactivation of quiescent P cells in starved ptr-18 L1 larvae. Although we could not detect the expression of the grl-27 fosmid reporter gene, we observed the accumulation of extracellular GRL-5 and GRL-7 reporter proteins only prior to hatching and around L1 molting but not around the time when P cells initiate ventral migration. On the other hand, simultaneous loss of grl-5, grl-7, and grl-27 did not cause a significant delay in P cell reactivation in well-fed L1 larvae. These observations raise the possibility that there is an additional Hh-r protein that is induced by feeding earlier than GRL-5, GRL-7, and GRL-27 and activates P cell migration. How can ectopic activation of these grl genes cause P cell reactivation and later developmental events in starved ptr-18 and mir-235 mutant larvae? Starved ptr-18 and mir-235 animals occasionally molt. On the other hand, previous studies have shown that most ptr and hh-r genes show transcriptional oscillations with distinct phases during larval stages and that multiple hh-r and ptr genes as well as ptc-3 are implicated in molting [12,71,83]. Thus, molting observed in starved ptr-18 and mir-235 mutant larvae is likely caused by the ectopic activation of transcriptional oscillations of hh-r and ptr genes. Furthermore, the activation of at least two hh-r-dependent processes, P cell reactivation and molting, always occur in this order. This apparent dependency of the latter events on the former can be explained by assuming 1) that each temporal transcriptional upregulation of hh-r genes promotes the subsequent hh-r genes one after another and 2) that each of the waves of upregulation sequentially activates distinct L1 developmental events. If so, the inhibition of grl-7 in starved ptr-18 and mir-235 mutant larvae would block the upregulation of a hh-r gene that promotes P cell reactivation in fed wild-type larvae by preventing the ectopic initiation of the transcriptional oscillations. This idea would also explain why ptr-18 deficiency conspicuously affected only the sequestration of the GRL-7 reporter but GRL-5 reporter. grl-5, potentially as well as grl-27, might act upstream of grl-7 to promote its oscillation of expression. Thus, the loss of grl-5 and potentially grl-27 would significantly suppress the quiescent defective phenotype of ptr-18 mutant animals via the downregulation of grl-7. Although the molecular mechanism that generates the transcriptional oscillations of hh-r and ptr genes remain to be fully elucidated, it is worth noting that nhr-23, which encodes a nuclear hormone receptor homologous to both mammalian RORα and Drosophila DHR3, has been shown to upregulate multiple hh-r and ptr genes, including grl-5, grl-7, and ptr-18, and regulate molting [8486]. In addition to nhr-23, dozens of genes whose inhibition causes molting defects have already been identified [87]. Instead of just regulating the molting cycle, some of these genes may promote the sequential activation of multiple developmental events by controlling the transcriptional oscillations of hh-r and ptr genes.

Materials and methods

Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Masamitsu Fukuyama (mfukuyam@mol.f.u-tokyo.ac.jp).

C. elegans strains

All nematode strains were cultured according to standard procedures [88]. The strains used in this study are listed below. The following strains were purchased from the Caenorhabditis Genetics Center: RB2058 grl-2(ok2721)V, RB1097 grl-4(ok1076)IV, RB2018 grl-5(ok2671) V, RB1999 grl-7(ok2644) V, RB2495 grl-15(ok3455) III, RB2322 grl-17(ok3017) V, RB2112 grl-21(ok2791) IV, PK172 ptc-1(ok122) unc-4(e120)/mnC1 dpy-10(e128) unc-52(e444) II, VC851 ptr-2(ok1338)/szT1 [lon-2(e678)] I, +/szT1 X, VC20514 ptr-3(gk333566) II, VC1110 +/szT1[lon-2(e678)] I, ptr-4(ok1576)/szT1 X, VC1067 ptr-5(gk472) X, VC2301 ptr-6(ok2988) II, MY1, which possesses the polymorphism WBVar01902623(S787Ochre) in the ptr-8 locus, RB1693 ptr-10(ok2106) I, VC20409 ptr-11(gk100342) I, VC40042 ptr-12(gk105502) I, VC40161 ptr-17(gk490736) I, RB2542 ptr-18(ok3532) II, RB2393 ptr-20(ok3263) II, VC3219 ptr-23(ok3663) I, and PD4666 ayIs6 X. Further, the following strain was purchased from the National BioResource Project: FX10640 grl-27(tm10640) IV. RB2058, RB1097, RB2018, RB1999, RB2495, RB2322, RB2112, and FX10640 were outcrossed against N2 six times and designated as YB3786, YB3788, YB3790, YB3289, YB3847, YB3848, YB3793 and YB4020, respectively, prior to experiments, while RB2542 was outcrossed against N2 four times to yield YB2891. grl-10(td193) was constructed by replacing the protein coding region of the grl-10 gene with Self-Excising Drug Selection Cassette (SEC), as described in [89], using a repair template plasmid, pCH104.1 and pCH102.1 and pCH103.1, both of which encode sgRNAs targeting the grl-10 locus. The introduced SEC was excised from the genome by heat shock, resulting in the td193 allele. pCH102.1 was made by PCR using primers, MF1515 and CH346 and PU6::unc-119_sgRNA plasmid as a template [90]. Similarly, pCH103.1 was made using primers, MF1515 and CH347. pCH104.1 was constructed by inserting homology arms derived from PCR products made with primer pairs CH342/CH343 and CH344/CH345 into pDD282 [89].

Construction of plasmids, and transformation of C. elegans

Fosmid-based reporter genes for ptr-18, grl-5, grl-7 and gel-27 were constructed using the fosmids WRM0613dH03, WRM0631aE09, WRM0615cE01 and WRM0636cB11, respectively, using “recombineering” as described previously [91]. GFP and mCherry::3x flag tags were PCR-amplified using pBalu1 and pCH78.1 plasmids, respectively. The primers used are listed in the Key Resources Table 1. Transformation of C. elegans was performed as described previously [92].

Tab. 1. Key Resources Table.
Key Resources Table.

Construction of grl-7 reporter genes using the CRISPR/Cas9 system

venus::3xflag and mCherry tags were inserted into the grl-7 gene using the CRISPR/Cas9 system according to the protocol described in [93]. Briefly, venus::3xflag and mCherry tags, both of which contain grl-7 homologous arm sequences at both the 5’ and 3’ ends were constructed via PCR using primer pairs MF2984-MF2985 and MF3047-MF3048, respectively. DNA fragments encoding venus and mCherry cDNA were PCR-amplified using primer pairs MF2607-MF2608 and MF3049-MF3050, respectively. These PCR products were subsequently annealed to make “dsDNA hybrid donors”, as described in [93]. Each of these dsDNA hybrid donors was co-injected with Alt-R S.p. Cas9 Nuclease V3 (IDT, 1081058), Alt-R CRISPR-Cas9 tracrRNA (IDT, 1072532), gene-specific Alt-R CRISPR-Cas9 crRNA, and pRF4 at certain concentrations as suggested by [93]. The partial sequence of the grl-7 gene CTATATTTACAATTGACGGT was used to custom-order the grl-7-specific Alt-R CRISPR-Cas9 crRNA. On the other hand, we could not insert venus and HA tags using CRISPR-Cas9 crRNAs targeting to the sequences, CTCCGAACGGATTTTTCAAC, AACCAGTTGAAAAATCCGTT, and CCGTTCACTTTGATAACTTT in the ptr-18 locus.

Immunostaining

A drop of the starved L1 larvae was placed on polylysine-coated slides, permeabilized using the freeze-cracking method, and fixed in MeOH/acetone at -20°C for 5 min, as described previously [94]. The slides were incubated with anti-PGL-1 antibody [95] diluted 1 : 40,000 in PBS containing 4% BSA at 4°C overnight. The slides were then washed in PBS three times and incubated with Alexa Fluor 568 goat anti-mouse IgG (H+L) highly cross-adsorbed secondary antibody (Thermo Fisher Scientific) diluted 1 : 2,000 in PBS containing 4% BSA at 37°C for 30 min. The slides were washed in PBS three times and subsequently mounted with PermaFluor mounting medium (Thermo Fisher Scientific) containing 1 μg/mL of DAPI (4’,6-diamidino-2-phenylindole).

Microscopy

The C. elegans embryos and adults were mounted on 4% agar pads, as described previously [96]. Fluorescent and differential interference contrast (DIC) images were obtained with an Axio Imager M1 equipped with Plan-Apochromat 63x/1.40 Oil DIC and HRm digital camera, and processed with the AxioVision (Carl Zeiss) and Photoshop (Adobe) software.

Structured illumination microscopy

C. elegans was cultured at 20°C in NGM agar plates. Live worms were immobilized with 50 mM levamisole in M9 and mounted on a slide with 2% agarose. The worms were imaged with a DeltaVision OMX Optical Microscope (version 4), Software: DeltaVision OMX softWoRx. Oil 1.518. Objective 60X NA 1.42. Pixel size: x = 0.08, y = 0.08, and z = 0.125 μm. All images were reconstructed using the same parameters. Images were post-processed with OMERO.web 5.3.4-ice36-b69.

Super-resolution microscopy

L1 larvae were anesthetized as described above. Super-resolution imaging was performed using a Zeiss LSM980 quipped with Airysccan2 and the Plan-Apochromat 63x/Oil 1.4 DIC objective. Approximately 150 Z-section images/embryo were acquired using the SR-4Y Multiplex mode at 0.17 μm intervals and processed with ZEN pro software and Fiji.

C. elegans culture

The L1 larvae were prepared and either starved in complete S medium or grown synchronously as described previously [7]. The concentration of L1 larvae was adjusted by culturing sterilized embryos at 10 embryos/μl. The starved L1 larvae in polypropylene tubes were continuously rotated at 30–40 rpm. The L1 larvae referred to as ‘after 5 days of L1 starvation’ indicate larvae that were allowed to hatch and were cultured in complete S medium for 5 days after the alkali/bleach treatment, except for L1 larvae in Figs 6A–6D and S6A–S6D, which were starved in cholesterol -⁠ and ethanol-free complete S medium for 24 h.

The synchronized embryos shown in Figs 2B and 3B and S2A and S3A were prepared by harvesting the early embryos by bleaching gravid adults as described above, hatched, and cultured in cholesterol -⁠ and ethanol-free complete S medium in a 15 mL polypropylene tube with continuous rotation at 30–40 rpm and 20°C. Embryos were observed 9–17 h after bleach treatment. Embryos in other experiments were harvested in M9 buffer using a spatula and a glass Pasteur pipet (after washing out the well-fed gravid worms) on 100 mm 4x peptone plates, which contained a 4x peptone concentration of the standard nematode growth medium (NGM) agar. The collected embryos were then washed five times with M9 buffer to remove E. coli before observation.

Immunoblot analysis

Wild-type and ptr-18 mutant animals after 24 h L1 starvation were prepared as described in C. elegans culture. Newly hatched larvae were first filtered through an L1 harvest filter (InVivo Biosystems, USA). Filtered animals were collected via centrifugation in 15 mL polypropylene tubes at 3,500 rpm for 1 min at 4°C, further centrifuged in 1.5 mL microtubes at 15,000 rpm for 1 min at 4°C, and snap-frozen by liquid nitrogen. Proteins were extracted in the urea lysis buffer (6 M urea, 2 M thiourea, 3% [w/v] CHAPS, 1% [v/v] Triton X -⁠ 100; [97]) by sonication using an ultrasonic disruptor UD-100 equipped with a TP-120 tip (TOMY, Japan). UD-100 was set to repeat the cycle of 10 s pulses at 99% power and 10 s intervals for 2 min. When unbroken larvae were found under the dissecting microscope, another around of sonication was performed. Protein extracts were resolved in 10% TGX by SDS-PAGE and blotted onto the Immun-blot PVDF membrane by the Transblot Turbo blotting system (Bio-Rad, USA). Blotted membranes were first blocked in the Everyblot blocking buffer for 5 min (Bio-Rad, USA), incubated with primary antibodies at 4°C overnight, and subsequently incubated with secondary antibodies at room temperature (20–25°C) for 1 h. Anti-GFP from mouse IgG1κ (clones 7.1 and 13.1) (Roche 11814460001), anti-α-tubulin antibody, mouse monoclonal clone DM1A (Sigma T6199), and Peroxidase-AffiniPure Goat Anti-Mouse IgG (Jackson ImmunoResearch 115-035-071) were used at 1 : 1,000, 5, 000, and 10,000 dilutions, respectively, in a 19 : 1 Tris Buffered Saline:Blocking One (Nacalai, Japan) solution containing 1% Tween 20. Signals were detected using Chemi-lumi One (Nacalai, Japan) with ChemiDoc XRS+ (Bio-Rad, USA). The gray intensity of each band circled by a fixed size of ROI was measured using Fiji (https://imagej.net/Fiji).

Viability assay

The embryos harvested using the alkali/bleach method described above and the resulting hatched larvae were cultured at 10 embryos/μl in 10 mL of cholesterol-, ethanol-free complete S medium in a 15 mL polypropylene tube with rotation at 30–40 rpm at 20°C for 10 days. The larvae were subsequently transferred onto freshly seeded plates, and the number of transferred and recovered larvae was scored after 3 days.

Feeding RNAi

Feeding RNAi targeting rab-5 was conducted using the ORFeome-RNAi v1.1 library [98] according to the standard procedure [99]. Empty pPD129.36 (L4440) vector [100] was used as a negative control for the RNAi experiments. L4 larvae expressing PTR-18::GFP and GRL-7::mCherry were transferred onto the RNAi plates, and the starved L1 larvae were prepared as previously described.

Statistical analysis

All statistical analyses were conducted using the Microsoft Excel software.

Supporting information

S1 Fig [a]
Loss of does not affect the quiescence of primordial germ cells and L1 survival.

S2 Fig [a]
acts in P and hypodermal cells.

S3 Fig [a]
Expression patterns of , , and reporter genes.

S4 Fig [green]
Coexpression of and reporter genes.

S5 Fig [a]
promotes temporally controlled endocytosis of GRL-7.

S6 Fig [a]
Loss of does not significantly affect the timely internalization of GRL-5.

S7 Fig [a]
and act in parallel pathways.


Zdroje

1. Hong Y, Roy R, Ambros V. Developmental regulation of a cyclin-dependent kinase inhibitor controls postembryonic cell cycle progression in Caenorhabditis elegans. Development. 1998;125 : 3585–3597. 9716524

2. Baugh LR, Sternberg PW. DAF-16/FOXO regulates transcription of cki-1/Cip/Kip and repression of lin-4 during C. elegans L1 arrest. Curr Biol. 2006;16 : 780–785. doi: 10.1016/j.cub.2006.03.021 16631585

3. Fukuyama M, Rougvie AE, Rothman JH. C. elegans DAF-18/PTEN mediates nutrient-dependent arrest of cell cycle and growth in the germline. Curr Biol. 2006;16 : 773–779. doi: 10.1016/j.cub.2006.02.073 16631584

4. Zheng S, Qu Z, Zanetti M, Lam B, Chin-Sang I. C. elegans PTEN and AMPK block neuroblast divisions by inhibiting a BMP-insulin-PP2A-MAPK pathway. Development. 2018;145: dev166876. doi: 10.1242/dev.166876 30487179

5. Baugh LR. To grow or not to grow: nutritional control of development during Caenorhabditis elegans L1 arrest. Genetics. 2013;194 : 539–555. doi: 10.1534/genetics.113.150847 23824969

6. Fukuyama M, Kontani K, Katada T, Rougvie AE. The C. elegans hypodermis couples progenitor cell quiescence to the dietary state. Curr Biol. 2015;25 : 1241–1248. doi: 10.1016/j.cub.2015.03.016 25891400

7. Kasuga H, Fukuyama M, Kitazawa A, Kontani K, Katada T. The microRNA miR-235 couples blast-cell quiescence to the nutritional state. Nature. 2013;497 : 503–506. doi: 10.1038/nature12117 23644454

8. Kume M, Chiyoda H, Kontani K, Katada T, Fukuyama M. Hedgehog-related genes regulate reactivation of quiescent neural progenitors in Caenorhabditis elegans. Biochemical and Biophysical Research Communications. 2019;520 : 532–537. doi: 10.1016/j.bbrc.2019.10.045 31615656

9. Aspöck G, Kagoshima H, Niklaus G, Bürglin TR. Caenorhabditis elegans has scores of hedgehog-related genes: sequence and expression analysis. Genome Res. 1999;9 : 909–923. doi: 10.1101/gr.9.10.909 10523520

10. Bürglin TR, Kuwabara PE. Homologs of the Hh signalling network in C. elegans. WormBook. 2006;: 1–14. doi: 10.1895/wormbook.1.76.1 18050469

11. Kuwabara PE, Lee MH, Schedl T, Jefferis GS. A C. elegans patched gene, ptc-1, functions in germ-line cytokinesis. Genes Dev. 2000;14 : 1933–1944. 10921907

12. Zugasti O, Rajan J, Kuwabara PE. The function and expansion of the Patchedand Hedgehog-related homologs in C. elegans. Genome Res. 2005;15 : 1402–1410. doi: 10.1101/gr.3935405 16204193

13. Soloviev A, Gallagher J, Marnef A, Kuwabara PE. C. elegans patched-3 is an essential gene implicated in osmoregulation and requiring an intact permease transporter domain. Dev Biol. 2011;351 : 242–253. doi: 10.1016/j.ydbio.2010.12.035 21215260

14. Frand AR, Russel S, Ruvkun G. Functional genomic analysis of C. elegans molting. PLoS Biol. 2005;3: e312. doi: 10.1371/journal.pbio.0030312 16122351

15. Johnson RL, Scott MP. Control of Cell Growth and Fate by patched Genes. Cold Spring Harb Symp Quant Biol. 1997;62 : 205–215. doi: 10.1101/SQB.1997.062.01.026 9598353

16. Carstea ED, Carstea ED, Morris JA, Morris JA, Coleman KG, Coleman KG, et al. Niemann-Pick C1 disease gene: homology to mediators of cholesterol homeostasis. Science. 1997;277 : 228–231. doi: 10.1126/science.277.5323.228 9211849

17. Loftus SK, Morris JA, Carstea ED, Gu JZ, Cummings C, Brown A, et al. Murine Model of Niemann-Pick C Disease: Mutation in a Cholesterol Homeostasis Gene. Science. 1997;277 : 232–235. doi: 10.1126/science.277.5323.232 9211850

18. Burke R, Nellen D, Bellotto M, Hafen E, Senti KA, Dickson BJ, et al. Dispatched, a novel sterol-sensing domain protein dedicated to the release of cholesterol-modified hedgehog from signaling cells. Cell. 1999;99 : 803–815. doi: 10.1016/s0092-8674(00)81677-3 10619433

19. Kuwabara PE, Labouesse M. The sterol-sensing domain: multiple families, a unique role? Trends in Genetics. 2002;18 : 193–201. doi: 10.1016/s0168-9525(02)02640-9 11932020

20. Chang T-Y, Chang CCY, Ohgami N, Yamauchi Y. Cholesterol sensing, trafficking, and esterification. Annu Rev Cell Dev Biol. 2006;22 : 129–157. doi: 10.1146/annurev.cellbio.22.010305.104656 16753029

21. Tseng TT, Gratwick KS, Kollman J, Park D, Nies DH, Goffeau A, et al. The RND permease superfamily: an ancient, ubiquitous and diverse family that includes human disease and development proteins. J Mol Microbiol Biotechnol. 1999;1 : 107–125. 10941792

22. Saier MH, Tam R, Reizer A, Reizer J. Two novel families of bacterial membrane proteins concerned with nodulation, cell division and transport. Molecular Microbiology. 1994;11 : 841–847. doi: 10.1111/j.1365-2958.1994.tb00362.x 8022262

23. Goldberg M, Pribyl T, Juhnke S, Nies DH. Energetics and topology of CzcA, a cation/proton antiporter of the resistance-nodulation-cell division protein family. J Biol Chem. 1999;274 : 26065–26070. doi: 10.1074/jbc.274.37.26065 10473554

24. Guan L, Nakae T. Identification of Essential Charged Residues in Transmembrane Segments of the Multidrug Transporter MexB ofPseudomonas aeruginosa. J Bacteriol. 2001;183 : 1734–1739. doi: 10.1128/JB.183.5.1734–1739.2001

25. del Castillo CEC, Hannich JT, Kaech A, Chiyoda H, Fukuyama M, Faergeman NJ, et al. Patched regulates lipid homeostasis by controlling cellular cholesterol levels. bioRxiv. 2019;7 : 816256. doi: 10.1101/816256

26. Ma Y, Erkner A, Gong R, Yao S, Taipale J, Basler K, et al. Hedgehog-Mediated Patterning of the Mammalian Embryo Requires Transporter-like Function of Dispatched. Cell. 2002;111 : 63–75. doi: 10.1016/s0092-8674(02)00977-7 12372301

27. Taipale J, Cooper MK, Maiti T, Beachy PA. Patched acts catalytically to suppress the activity of Smoothened. Nature. 2002;418 : 892–897. doi: 10.1038/nature00989 12192414

28. Marshall CR, Noor A, Vincent JB, Lionel AC, Feuk L, Skaug J, et al. Structural variation of chromosomes in autism spectrum disorder. Am J Hum Genet. 2008;82 : 477–488. doi: 10.1016/j.ajhg.2007.12.009 18252227

29. Noor A, Whibley A, Marshall CR, Gianakopoulos PJ, Piton A, Carson AR, et al. Disruption at the PTCHD1 Locus on Xp22.11 in Autism spectrum disorder and intellectual disability. Sci Transl Med. 2010;2 : 49ra68–49ra68. doi: 10.1126/scitranslmed.3001267 20844286

30. Pinto D, Pagnamenta AT, Klei L, Anney R, Merico D, Regan R, et al. Functional impact of global rare copy number variation in autism spectrum disorders. Nature. 2010;466 : 368–372. doi: 10.1038/nature09146 20531469

31. Whibley AC, Plagnol V, Tarpey PS, Abidi F, Fullston T, Choma MK, et al. Fine-scale survey of X chromosome copy number variants and indels underlying intellectual disability. Am J Hum Genet. 2010;87 : 173–188. doi: 10.1016/j.ajhg.2010.06.017 20655035

32. Filges I, Röthlisberger B, Blattner A, Boesch N, Demougin P, Wenzel F, et al. Deletion in Xp22.11: PTCHD1 is a candidate gene for X-linked intellectual disability with or without autism. Clin Genet. 2011;79 : 79–85. doi: 10.1111/j.1399-0004.2010.01590.x 21091464

33. Chaudhry A, Noor A, Degagne B, Baker K, Bok LA, Brady AF, et al. Phenotypic spectrum associated with PTCHD1 deletions and truncating mutations includes intellectual disability and autism spectrum disorder. Clin Genet. 2015; 88 : 224–233. doi: 10.1111/cge.12482 25131214

34. Torrico B, Fernàndez-Castillo N, Hervás A, Milà M, Salgado M, Rueda I, et al. Contribution of common and rare variants of the PTCHD1 gene to autism spectrum disorders and intellectual disability. Eur J Hum Genet. 2015;23 : 1694–1701. doi: 10.1038/ejhg.2015.37 25782667

35. Wells MF, Wimmer RD, Schmitt LI, Feng G, Halassa MM. Thalamic reticular impairment underlies attention deficit in Ptchd1Y/ -⁠ mice. Nature. 2016;532 : 58–63. doi: 10.1038/nature17427 27007844

36. Bolatto C, Parada C, Revello F, Zuñiga A, Cabrera P, Cambiazo V. Spatial and temporal distribution of Patched-related protein in the Drosophila embryo. Gene Expression Patterns. 2015;19 : 120–128. doi: 10.1016/j.gep.2015.10.002 26506022

37. Perens EA, Shaham S. C. elegans daf-6 encodes a patched-related protein required for lumen formation. Dev Cell. 2005;8 : 893–906. doi: 10.1016/j.devcel.2005.03.009 15935778

38. Oikonomou G, Perens EA, Lu Y, Watanabe S, Jorgensen EM, Shaham S. Opposing activities of LIT-1/NLK and DAF-6/patched-related direct sensory compartment morphogenesis in C. elegans. PLoS Biol. 2011;9: e1001121. doi: 10.1371/journal.pbio.1001121 21857800

39. Wallace SW, Singhvi A, Liang Y, Lu Y, Shaham S. PROS-1/Prospero Is a Major Regulator of the Glia-Specific Secretome Controlling Sensory-Neuron Shape and Function in C. elegans. Cell Reports. 2016;15 : 550–562. doi: 10.1016/j.celrep.2016.03.051 27068465

40. Wang W, Perens EA, Oikonomou G, Lu Y, Shaham S. IGDB-2, an Ig/FNIII protein, binds the ion channel LGC-34 and controls sensory compartment morphogenesis in C. elegans. Developmental Biology. 2017; 430 : 105–112.

41. Lin C-CJ, Wang MC. Microbial metabolites regulate host lipid metabolism through NR5A–Hedgehog signalling. Nat Cell Biol. 2017;19 : 550–557. doi: 10.1038/ncb3515 28436966

42. Templeman NM, Cota V, Keyes W, Kaletsky R, Murphy CT. CREB Non-autonomously Controls Reproductive Aging through Hedgehog/Patched Signaling. Dev Cell. 2020;54 : 92–105.e5. doi: 10.1016/j.devcel.2020.05.023 32544391

43. Sulston JE. Post-embryonic development in the ventral cord of Caenorhabditis elegans. Philos Trans R Soc Lond, B, Biol Sci. 1976;275 : 287–297. doi: 10.1098/rstb.1976.0084 8804

44. Hao L, Johnsen R, Lauter G, Baillie D, Bürglin TR. Comprehensive analysis of gene expression patterns of hedgehog-related genes. BMC Genomics. 2006;7 : 280. doi: 10.1186/1471-2164-7-280 17076889

45. Gilleard JS, Barry JD, Johnstone IL. cis regulatory requirements for hypodermal cell-specific expression of the Caenorhabditis elegans cuticle collagen gene dpy-7. Mol Cell Biol. 1997;17 : 2301–2311. doi: 10.1128/mcb.17.4.2301 9121480

46. Johnson AD, Fitzsimmons D, Hagman J, Chamberlin HM. EGL-38 Pax regulates the ovo-related gene lin-48 during Caenorhabditis elegans organ development. Development. Oxford University Press for The Company of Biologists Limited; 2001;128 : 2857–2865.

47. Parry JM, Sundaram MV. A non-cell-autonomous role for Ras signaling in C. elegans neuroblast delamination. Development. 2014;141 : 4279–4284. doi: 10.1242/dev.112045 25371363

48. Doonan R, Hatzold J, Raut S, Conradt B, Alfonso A. HLH-3 is a C. elegans Achaete/Scute protein required for differentiation of the hermaphrodite-specific motor neurons. Mechanisms of Development. 2008;125 : 883–893. doi: 10.1016/j.mod.2008.06.002 18586090

49. Wei X, Potter CJ, Luo L, Shen K. Controlling gene expression with the Q repressible binary expression system in Caenorhabditis elegans. Nature Methods. 2012;9 : 391–395. doi: 10.1038/nmeth.1929 22406855

50. Page A. The cuticle. WormBook. 2007. doi: 10.1895/wormbook.1.138.1 18050497

51. McMahon L, Muriel JM, Roberts B, Quinn M, Johnstone IL. Two Sets of Interacting Collagens Form Functionally Distinct Substructures within a Caenorhabditis elegans Extracellular Matrix. Mol Biol Cell. 2003;14 : 1366–1378. doi: 10.1091/mbc.e02-08-0479 12686594

52. Grant B, Hirsh D. Receptor-mediated Endocytosis in the Caenorhabditis elegans Oocyte. Kimble J, editor. Mol Biol Cell. 1999;10 : 4311–4326. doi: 10.1091/mbc.10.12.4311 10588660

53. Chen CC-H, Schweinsberg PJ, Vashist S, Mareiniss DP, Lambie EJ, Grant BD. RAB-10 Is Required for Endocytic Recycling in the Caenorhabditis elegans Intestine. Mol Biol Cell. 2006;17 : 1286–1297. doi: 10.1091/mbc.e05-08-0787 16394106

54. Treusch S, Knuth S, Slaugenhaupt SA, Goldin E, Grant BD, Fares H. Caenorhabditis elegans functional orthologue of human protein h-mucolipin-1 is required for lysosome biogenesis. Proceedings of the National Academy of Sciences. 2004;101 : 4483–4488. doi: 10.1073/pnas.0400709101 15070744

55. Shinoda H, Shannon M, Nagai T. Fluorescent Proteins for Investigating Biological Events in Acidic Environments. IJMS. 2018;19 : 1548. doi: 10.3390/ijms19061548 29789517

56. Krogh A, Larsson B, Heijne von G, Sonnhammer ELL. Predicting transmembrane protein topology with a hidden markov model: application to complete genomes. Journal of Molecular Biology. 2001;305 : 567–580. doi: 10.1006/jmbi.2000.4315 11152613

57. Weiss LE, Milenkovic L, Yoon J, Stearns T, Moerner WE. Motional dynamics of single Patched1 molecules in cilia are controlled by Hedgehog and cholesterol. Proceedings of the National Academy of Sciences. 2019;116 : 5550–5557. doi: 10.1073/pnas.1816747116 30819883

58. Myers BR, Neahring L, Zhang Y, Roberts KJ, Beachy PA. Rapid, direct activity assays for Smoothened reveal Hedgehog pathway regulation by membrane cholesterol and extracellular sodium. Proc Natl Acad Sci USA. 2017;114: E11141–E11150. doi: 10.1073/pnas.1717891115 29229834

59. Bidet M, Joubert O, Lacombe B, Ciantar M, Nehmé R, Mollat P, et al. The Hedgehog Receptor Patched Is Involved in Cholesterol Transport. Johannes L, editor. PLoS ONE. 2011;6: e23834. doi: 10.1371/journal.pone.0023834 21931618

60. Chen Y, Struhl G. Dual Roles for Patched in Sequestering and Transducing Hedgehog. Cell. 1996;87 : 553–563. doi: 10.1016/s0092-8674(00)81374-4 8898207

61. Incardona JP, Lee JH, Robertson CP, Enga K, Kapur RP, Roelink H. Receptor-mediated endocytosis of soluble and membrane-tethered Sonic hedgehog by Patched-1. Proc Natl Acad Sci USA. 2000;97 : 12044–12049. doi: 10.1073/pnas.220251997 11027307

62. Briscoe J, Chen Y, Jessell TM, Struhl G. A hedgehog-insensitive form of patched provides evidence for direct long-range morphogen activity of sonic hedgehog in the neural tube. Mol Cell. 2001;7 : 1279–1291. doi: 10.1016/s1097-2765(01)00271-4 11430830

63. Torroja C, Gorfinkiel N, Guerrero I. Patched controls the Hedgehog gradient by endocytosis in a dynamin-dependent manner, but this internalization does not play a major role in signal transduction. Development. 2004;131 : 2395–2408. doi: 10.1242/dev.01102 15102702

64. Fra AM, Locati M, Otero K, Sironi M, Signorelli P, Massardi ML, et al. Cutting Edge: Scavenging of Inflammatory CC Chemokines by the Promiscuous Putatively Silent Chemokine Receptor D6. The Journal of Immunology. 2003;170 : 2279–2282. doi: 10.4049/jimmunol.170.5.2279 12594248

65. Weber M, Blair E, Simpson CV, O’Hara M, Blackburn PE, Rot A, et al. The Chemokine Receptor D6 Constitutively Traffics to and from the Cell Surface to Internalize and Degrade Chemokines. Mol Biol Cell. 2004;15 : 2492–2508. doi: 10.1091/mbc.e03-09-0634 15004236

66. Jamieson T, Cook DN, Nibbs RJB, Rot A, Nixon C, Mclean P, et al. The chemokine receptor D6 limits the inflammatory response in vivo. Nat Immunol. 2005;6 : 403–411. doi: 10.1038/ni1182 15750596

67. Pastenes L, Ibáñez F, Bolatto C, Pavéz L, Cambiazo V. Molecular characterization of a novel patched-related protein in Apis mellifera and Drosophila melanogaster. Arch Insect Biochem Physiol. 2008;68 : 156–170. doi: 10.1002/arch.20245 18563713

68. Oikonomou G, Perens EA, Lu Y, Shaham S. Some, but not all, retromer components promote morphogenesis of C. elegans sensory compartments. Dev Biol. 2012;362 : 42–49. doi: 10.1016/j.ydbio.2011.11.009 22138055

69. Oikonomou G, Shaham S. On the morphogenesis of glial compartments in the sensory organs of Caenorhabditis elegans. Worm. 2014;1 : 51–55. doi: 10.4161/worm.19343 24058823

70. Singhal A, Shaham S. Infrared laser-induced gene expression for tracking development and function of single C. elegans embryonic neurons. Nature Communications. 2017;8 : 14100. doi: 10.1038/ncomms14100 28098184

71. Hendriks G-J, Gaidatzis D, Aeschimann F, Großhans H. Extensive oscillatory gene expression during C. elegans larval development. Mol Cell. 2014;53 : 380–392. doi: 10.1016/j.molcel.2013.12.013 24440504

72. Bürglin TR. Warthog and groundhog, novel families related to hedgehog. Curr Biol. 1996;6 : 1047–1050. doi: 10.1016/s0960-9822(02)70659-3 8805384

73. Marigo V, Davey RA, Zuo Y, Cunningham JM, Tabin CJ. Biochemical evidence that patched is the Hedgehog receptor. Nature. 1996;384 : 176–179. doi: 10.1038/384176a0 8906794

74. Stone DM, Hynes M, Armanini M, Swanson TA, Gu Q, Johnson RL, et al. The tumour-suppressor gene patched encodes a candidate receptor for Sonic hedgehog. Nature. 1996;384 : 129–134. doi: 10.1038/384129a0 8906787

75. Chung JH, Larsen AR, Chen E, Bunz F. A PTCH1 homolog transcriptionally activated by p53 suppresses Hedgehog signaling. J Biol Chem. 2014;289 : 33020–33031. doi: 10.1074/jbc.M114.597203 25296753

76. Ung DC, Iacono G, Méziane H, Blanchard E, Papon M-A, Selten M, et al. Ptchd1 deficiency induces excitatory synaptic and cognitive dysfunctions in mouse. Mol Psychiatry. 2018;23 : 1356–1367. doi: 10.1038/mp.2017.39 28416808

77. Tora D, Gomez AM, Michaud J-F, Yam PT, Charron F, Scheiffele P. Cellular Functions of the Autism Risk Factor PTCHD1 in Mice. Journal of Neuroscience. 2017;37 : 11993–12005. doi: 10.1523/JNEUROSCI.1393-17.2017 29118110

78. Chuang P-T, McMahon AP. Vertebrate Hedgehog signalling modulated by induction of a Hedgehog-binding protein. Nature. 1999;397 : 617–621. doi: 10.1038/17611 10050855

79. Chuang P-T, Kawcak T, McMahon AP. Feedback control of mammalian Hedgehog signaling by the Hedgehog-binding protein, Hip1, modulates Fgf signaling during branching morphogenesis of the lung. Genes Dev. 2003;17 : 342–347. doi: 10.1101/gad.1026303 12569124

80. Bishop B, Aricescu AR, Harlos K, O’Callaghan CA, Jones EY, Siebold C. Structural insights into hedgehog ligand sequestration by the human hedgehog-interacting protein HHIP. Nat Struct Mol Biol. 2009;16 : 1–8. doi: 10.1038/nsmb0109-1 19125164

81. Bosanac I, Maun HR, Scales SJ, Wen X, Lingel A, Bazan JF, et al. The structure of SHH in complex with HHIP reveals a recognition role for the Shh pseudo active site in signaling. Nat Struct Mol Biol. 2009;16 : 691–697. doi: 10.1038/nsmb.1632 19561609

82. Holtz AM, Peterson KA, Nishi Y, Morin S, Song JY, Charron F, et al. Essential role for ligand-dependent feedback antagonism of vertebrate hedgehog signaling by PTCH1, PTCH2 and HHIP1 during neural patterning. Development. 2013;140 : 3423–3434. doi: 10.1242/dev.095083 23900540

83. Hao L, Mukherjee K, Liegeois S, Baillie D, Labouesse M, Bürglin TR. The hedgehog-related gene qua-1 is required for molting in Caenorhabditis elegans. Dev Dyn. 2006;235 : 1469–1481. doi: 10.1002/dvdy.20721 16502424

84. Kostrouchova M, Krause M, Kostrouch Z, Rall JE. CHR3: a Caenorhabditis elegans orphan nuclear hormone receptor required for proper epidermal development and molting. Development. 1998;125 : 1617–1626. 9521900

85. Kostrouchova M, Krause M, Kostrouch Z, Rall JE. Nuclear hormone receptor CHR3 is a critical regulator of all four larval molts of the nematode Caenorhabditis elegans. Proceedings of the National Academy of Sciences. 2001;98 : 7360–7365. doi: 10.1073/pnas.131171898 11416209

86. Kouns NA, Nakielna J, Behensky F, Krause MW, Kostrouch Z, Kostrouchova M. NHR-23 dependent collagen and hedgehog-related genes required for molting. Biochem Biophys Res Commun. 2011;413 : 515–520. doi: 10.1016/j.bbrc.2011.08.124 21910973

87. Lažetić V, Fay DS. Molting in C. elegans. Worm. 2017;6: e1330246. doi: 10.1080/21624054.2017.1330246 28702275

88. Lewis JA, Fleming JT. Basic Culture Methods. Methods in Cell Biology. 1995;48 : 3–29. doi: 10.1016/S0091-679X(08)61381-3 8531730

89. Dickinson DJ, Pani AM, Heppert JK, Higgins CD, Goldstein B. Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette. Genetics. 2015;200 : 1035–1049. doi: 10.1534/genetics.115.178335 26044593

90. Friedland AE, Tzur YB, Esvelt KM, Colaiácovo MP, Church GM, Calarco JA. Heritable genome editing in C. elegans via a CRISPR-Cas9 system. Nat Methods. 2013;10 : 741–743. doi: 10.1038/nmeth.2532 23817069

91. Tursun B, Cochella L, Carrera I, Hobert O. A toolkit and robust pipeline for the generation of fosmid-based reporter genes in C. elegans. Hart AC, editor. PLoS ONE. 2009;4: e4625. doi: 10.1371/journal.pone.0004625 19259264

92. Mello CC, Kramer JM, Stinchcomb D, Ambros V. Efficient gene transfer in C.elegans: Extrachromosomal maintenance and integration of transforming sequences. EMBO J. 1991;10 : 3959–3970. 1935914

93. Dokshin GA, Ghanta KS, Piscopo KM, Mello CC. Robust Genome Editing with Short Single-Stranded and Long, Partially Single-Stranded DNA Donors in Caenorhabditis elegans. Genetics. 2018;210 : 781–787. doi: 10.1534/genetics.118.301532 30213854

94. Miller DM, Shakes DC. Chapter 16 Immunofluorescence Microscopy. Methods in Cell Biology. 1995;48 : 365–394. doi: 10.1016/S0091-679X(08)61396-5 8531735

95. Kawasaki I, Shim Y-H, Kirchner J, Kaminker J, Wood WB, Strome S. PGL-1, a Predicted RNA-Binding Component of Germ Granules, Is Essential for Fertility in C. elegans. Cell. 1998;94 : 635–645. doi: 10.1016/s0092-8674(00)81605-0 9741628

96. Sulston JE, Hodgkin J. Methods. In: Wood WB, editor. The nematode Caenorhabditis elegans. Cold Spring Harbor Laboratory Press; 1987. pp. 587–606.

97. Kondo T, Hirohashi S. Application of highly sensitive fluorescent dyes (CyDye DIGE Fluor saturation dyes) to laser microdissection and two-dimensional difference gel electrophoresis (2D-DIGE) for cancer proteomics. Nat Protoc. 2007;1 : 2940–2956. doi: 10.1038/nprot.2006.421 17406554

98. Reboul J, Vaglio P, Rual J-F, Lamesch P, Martinez M, Armstrong CM, et al. C. elegans ORFeome version 1.1: experimental verification of the genome annotation and resource for proteome-scale protein expression. Nat Genet. 2003;34 : 35–41. doi: 10.1038/ng1140 12679813

99. Kamath RS, Martinez-Campos M, Zipperlen P, Fraser AG, Ahringer J. Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans. Genome Biology 2015 16 : 1. doi: 10.1186/gb-2000-2-1-research0002 11178279

100. Timmons L, Fire A. Specific interference by ingested dsRNA. Nature. 1998;395 : 854–854. doi: 10.1038/27579 9804418

101. Fukuyama M, Sakuma K, Park R, Kasuga H, Nagaya R, Atsumi Y, et al. C. elegans AMPKs promote survival and arrest germline development during nutrient stress. Biol Open. 2012;1 : 929–936. doi: 10.1242/bio.2012836 23213370

102. Harfe BD, Gomes AV, Kenyon C, Liu J, Krause M, Fire A. Analysis of a Caenorhabditis elegans Twist homolog identifies conserved and divergent aspects of mesodermal patterning. Genes Dev. 1998;12 : 2623–2635. doi: 10.1101/gad.12.16.2623 9716413


Článek vyšel v časopise

PLOS Genetics


2021 Číslo 4
Nejčtenější tento týden
Nejčtenější v tomto čísle
Kurzy

Zvyšte si kvalifikaci online z pohodlí domova

Svět praktické medicíny 4/2025 (znalostní test z časopisu)
nový kurz

Denzitometrie v praxi: od kvalitního snímku po správnou interpretaci
Autoři: prof. MUDr. Vladimír Palička, CSc., Dr.h.c., doc. MUDr. Václav Vyskočil, Ph.D., MUDr. Petr Kasalický, CSc., MUDr. Jan Rosa, Ing. Pavel Havlík, Ing. Jan Adam, Hana Hejnová, DiS., Jana Křenková

Eozinofilie – multioborová otázka?
Autoři: MUDr. Irena Krčmová, CSc.

Čelistně-ortodontické kazuistiky od A do Z
Autoři: MDDr. Eleonóra Ivančová, PhD., MHA

Cesta od prvních příznaků RS k optimální léčbě
Autoři: prof. MUDr. Eva Kubala Havrdová, DrSc.

Všechny kurzy
Přihlášení
Zapomenuté heslo

Zadejte e-mailovou adresu, se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.

Přihlášení

Nemáte účet?  Registrujte se

#ADS_BOTTOM_SCRIPTS#