Adaptive evolution among cytoplasmic piRNA proteins leads to decreased genomic auto-immunity
Authors:
Luyang Wang aff001; Daniel A. Barbash aff002; Erin S. Kelleher aff001
Authors place of work:
Dept. Biology & Biochemistry, University of Houston, Houston, Texas, United States of America
aff001; Dept. Molecular Biology & Genetics, Cornell University, Ithaca, New York, United States of America
aff002
Published in the journal:
Adaptive evolution among cytoplasmic piRNA proteins leads to decreased genomic auto-immunity. PLoS Genet 16(6): e32767. doi:10.1371/journal.pgen.1008861
Category:
Research Article
doi:
https://doi.org/10.1371/journal.pgen.1008861
Summary
In metazoan germlines, the piRNA pathway acts as a genomic immune system, employing small RNA-mediated silencing to defend host DNA from the harmful effects of transposable elements (TEs). Expression of genomic TEs is proposed to initiate self regulation by increasing the production of repressive piRNAs, thereby “adapting” piRNA-mediated control to the most active TE families. Surprisingly, however, piRNA pathway proteins, which execute piRNA biogenesis and enforce silencing of targeted sequences, evolve rapidly and adaptively in animals. If TE silencing is ensured through piRNA biogenesis, what necessitates changes in piRNA pathway proteins? Here we used interspecific complementation to test for functional differences between Drosophila melanogaster and D. simulans alleles of three adaptively evolving piRNA pathway proteins: Armitage, Aubergine and Spindle-E. In contrast to piRNA-mediated transcriptional regulators examined in previous studies, these three proteins have cytoplasmic functions in piRNA maturation and post-transcriptional silencing. Across all three proteins we observed interspecific divergence in the regulation of only a handful of TE families, which were more robustly silenced by the heterospecific piRNA pathway protein. This unexpected result suggests that unlike transcriptional regulators, positive selection has not acted on cytoplasmic piRNA effector proteins to enhance their function in TE repression. Rather, TEs may evolve to “escape” silencing by host proteins. We further discovered that D. simulans alleles of aub and armi exhibit enhanced off-target effects on host transcripts in a D. melanogaster background, as well as modest reductions in the efficiency of piRNA biogenesis, suggesting that promiscuous binding of D. simulans Aub and Armi proteins to host transcripts reduces their participation in piRNA production. Avoidance of genomic auto-immunity may therefore be a critical target of selection. Our observations suggest that piRNA effector proteins are subject to an evolutionary trade-off between defending the host genome from the harmful effect of TEs while also minimizing collateral damage to host genes.
Keywords:
Gene expression – Drosophila – Drosophila melanogaster – Messenger RNA – Biosynthesis – RNA sequencing – Evolutionary adaptation – Invertebrate genomics
Introduction
Transposable elements (TEs) are ubiquitous mobile genetic entities, whose unrestricted propagation can cause deleterious insertional mutations and chromosome rearrangements, and are often associated with cancer and sterility [1–4]. TE regulation is therefore essential, especially in germline cells, where TE insertions and associated mutations can be transmitted to the next generation. In metazoan germlines, regulation of TE transcripts is enacted by a small RNA silencing pathway, the PIWI-interacting RNA pathway (piRNA pathway), in which piRNAs complexed with PIWI-clade Argonaute proteins target complementary TEs for post-transcriptional and transcriptional silencing [5].
Host genomes are often parasitized by multiple TE families, which change rapidly in their presence and abundance [6–9]. The control of TE transcripts by complementary piRNAs may facilitate adaptation to genomic TEs through changes in piRNA species [10,11]. Surprisingly, however, the protein components of the piRNA pathway that enact piRNA biogenesis and enforce TE silencing also evolve adaptively in diverse metazoan lineages [12–16]. Evidence for adaptive evolution of piRNA pathway proteins is particularly strong in Drosophila [12–15,17], which has also emerged as a work horse for uncovering the mechanisms of piRNA-mediated silencing [reviewed in 18]. For example, a recent meta analysis including both D. melanogaster and D. pseudoobscura revealed that 22 of 26 piRNA pathway proteins exhibit significant signatures of adaptive protein evolution in one or both species [14].
Adaptive evolution of piRNA effector proteins is proposed to arise from an evolutionary arms race between TEs and host silencing machinery [reviewed in 19]. In the simplest scenario, effector proteins evolve adaptively in order to restore silencing of newly invading or escaper TE families. Alternatively, if TEs “fight back” by encoding RNA or protein antagonists of host silencing machinery, piRNA pathway proteins could evolve adaptively to escape TE antagonism [20]. Finally, piRNA proteins may evolve adaptively to avoid “genomic auto-immunity” in the form of off-target silencing of host genes [19,21]. Uncovering which of these selective forces drives the adaptive evolution of piRNA effector proteins requires elucidating the resulting functional consequences of piRNA-effector-protein divergence. For example, adaptive evolution among transcriptional silencers has led to incompatibilities between alleles of interacting proteins from different species, with dramatic consequences for piRNA production and TE control [20,22,23]. In particular, functional changes in Rhino are proposed to reflect evolutionary escape from a TE-encoded antagonist [20].
Here, we broaden our understanding of the functional consequences of adaptive evolution among Drosophila piRNA effector proteins by examining three additional essential piRNA pathway components that play critical roles in piRNA maturation and post-transcriptional silencing [24–30]: Armitage (Armi), Aubergine (Aub) and Spindle-E (Spn-E). This work significantly extends a preliminary analysis of Aub divergence [31]. Aub is a Piwi-clade Argonaute protein which, guided by piRNAs, enacts post-transcriptional silencing of sense TE-derived mRNAs [24]. Aub cleavage also feeds forward the ping-pong amplification cycle, a core mechanism for the maturation of both sense and antisense piRNAs that also requires Spn-E [25,26,28,32]. Distinct from both Aub and Spn-E, Armi binds to antisense piRNA precursors to facilitate their sequential cleavage by the nuclease Zucchini in an alternate biogenesis mechanism referred to as “phasing” [29,33–37]. The loci encoding Aub, Spn-E and Armi all exhibit adaptive evolution along the lineage leading to D. melanogaster, D. simulans or both, yet the underlying evolutionary force(s) remain unknown [13,15].
To isolate diverged functions of these adaptively evolving proteins, we performed interspecific complementation, in which we compared the ability of D. melanogaster and D. simulans wild-type alleles to complement a D. melanogaster mutant background. While nuclear transcriptional silencers were previously demonstrated to exhibit dramatic interspecific divergence in TE regulation and piRNA production [20,23], we observed only minor allelic differences in both of these functions. Rather, we uncovered idiosyncratic differences in the regulation of a small handful of TEs, suggesting potential element-specific adaptations. We also observed that D. simulans alleles of aub and armi exhibit reduced efficiency of piRNA maturation in association with increased off-target regulation of host mRNAs. We propose that in contrast to nuclear transcriptional silencers, selection acts on cytoplasmic piRNA proteins to maximize their specificity to piRNA production and TE transcripts, while minimizing non-functional or deleterious interactions with host mRNA.
Results
Identifying functional divergence through interspecific complementation
Previous divergence-based analyses of Aub and Spn-E suggest that adaptive evolution is not confined to a particular functional domain but is dispersed throughout the proteins [12,15]. Consistent with these findings, we identified abundant amino-acid differences between D. melanogaster and D. simulans throughout Aub and Spn-E (Fig 1A). Armi does not exhibit strong evidence of positive selection in divergence-based tests, however, an excess of amino acid substitutions exists between D. melanogaster and D. simulans, which have likely arisen by positive selection in one or both lineages [15]. Similar to Aub and Spn-E, we observe that these amino acid differences are scattered throughout the protein, both inside and outside of functional domains (Fig 1A).
To isolate phenotypic differences between D. melanogaster and D. simulans alleles that result from adaptive evolution, we employed interspecific complementation, in which we compared the ability of D. melanogaster and D. simulans wild-type alleles to complement a D. melanogaster mutant background. For each selected piRNA protein, we generated and compared three genotypes: 1) a trans-heterozygous loss-of-function mutant, 2) the same mutant with a D. melanogaster genomic transgene rescue, and 3) the same mutant with a D. simulans genomic transgene rescue (S1 Fig). The transgenes include the complete genomic region from either D. melanogaster or D. simulans, including upstream and downstream sequences containing potential cis-regulatory elements. Transgenes were inserted into matched attP sites by ΦC31 integrase [41], in order to avoid variable position effects. Phenotypes for which the D. simulans alleles fail to fully complement the mutant, or otherwise differ between the alleles of the two species, point to diverged functions that are potential targets of adaptive evolution.
We first considered the effect of transgenic rescue on female fertility. Homozygosity or trans-heterozygosity for loss of function alleles in all three genes causes complete female sterility (Fig 1B, S1 Table), while heterozygotes are fertile [42]. For all three proteins, fertility is restored by transgenic rescues from the two species to different degrees, with D. melanogaster transgenes conferring higher fertility than their D. simulans counterparts (Fig 1B, S1 Table) [31]. Drosophila simulans transgenes do not exhibit significantly reduced expression when compared to D. melanogaster, in fact for spn-E the D. simulans transgene exhibits a modest 22% increase in expression (S2 Fig). Therefore, reduced fertility effects in the presence of D. simulans transgenes most likely reflect amino acid sequence divergence in the encoded proteins.
Idiosyncratic differences in TE regulation
To uncover molecular phenotypes that relate to fertility differences, we first examined whether D. melanogaster and D. simulans alleles differed with respect to TE transcriptional control and associated piRNA production using RNA-seq and small RNA-seq (S3 Fig, S2 Table). Notably, our D. melanogaster transgenic rescues down-regulated TE transcripts and up-regulated piRNA production similarly to heterozygotes, which are generally considered wild-type with respect to piRNA production and TE silencing (Fig 2, S4 Fig, S3 and S4 Tables). Transgenically expressed D. melanogaster proteins are therefore fully functional with respect to TE silencing and piRNA biogenesis.
Enhanced piRNA-mediated negative regulation of TEs is an obvious target of positive selection acting on piRNA pathway proteins. However, sense transcripts for the majority of TEs are not differentially expressed between the transgenic rescues for armi and spn-E, implying that negative regulation of TEs is largely conserved between species (Fig 2A). Similarly, the majority of TEs are not differentially expressed between aub transgenic rescues (non-stranded RNA-seq, Fig 2A). Nevertheless, despite an overall conservation of TE repression, we discovered idiosyncratic differences in regulation, in which individual TE families are more robustly silenced by the D. melanogaster or D. simulans allele. Unexpectedly, 5 out of 5 TE families whose transcript abundance differs between transgenic rescues for one of the three proteins are more robustly silenced by the D. simulans allele. While differences in TE copy number could arise between transgenes through backcrossing, thereby creating the appearance of differential regulation, this would be equally likely to result in increased or decreased expression in the D. simulans rescue for any given TE. Thus, the bias towards enhanced negative regulation by D. simulans is not consistent with the random segregation of polymorphic TE insertion alleles during backcrossing, but rather suggests a true increase in negative regulation by the D. simulans allele. In particular, the tirant LTR retrotransposon is more robustly silenced by the D. simulans allele of both aub and spn-E. Furthermore, we did not observe any systematic differences in expression for germline or soma-specific protein-coding genes between the transgenic rescues, strongly suggesting that the germline-to-soma ratio is equivalent between transgenic genotypes (S2 Fig). Differences in silencing of individual TE families therefore suggest lineage-specific coevolution with the host-regulatory machinery.
Divergence in TE regulation between D. melanogaster and D. simulans alleles could arise from differential production of complementary antisense piRNAs. Of 5 TE families that are differentially regulated between transgenic rescues for one of the proteins (Fig 2A), only tirant differential expression between spn-E transgenes is associated with a corresponding change in antisense piRNA abundance (S5 Fig). Furthermore, tirant antisense piRNAs were increased in the D. melanogaster transgene, which is not consistent with piRNA loss as the cause of increased TE expression. Similar to their antisense counterparts, the abundances of sense piRNAs, which are produced during post-transcriptional silencing of TE-derived mRNAs, are not systematically different between transgenic rescues for differentially regulated TEs (S5 Fig). Differences in TE negative regulation between alleles therefore occur independently of piRNA production. Furthermore, D. simulans and D. melanogaster alleles have very similar effects on the overall pool of TE-derived piRNAs, with only 10 repeat classes differentially abundant for sense or antisense piRNAs for any of the three pairs of transgenic rescues, four of which are satellite repeats (HETRP, HMR1, SAR and SAR2, Fig 2B, S5 and S6 Figs). Interspecific divergence in piRNA production is therefore modest between alleles, with no detectable impact on the regulation of genomic TEs.
Drosophila simulans alleles exhibit reduced piRNA biogenesis
Despite the absence of large-scale interspecific differences in antisense piRNAs that regulate TEs (Fig 2B), we interrogated piRNA pools associated with each of the transgenic rescues for evidence of underlying differences in piRNA biogenesis. We examined molecular signatures of the two major mechanisms of piRNA biogenesis: ping-pong and phasing. Ping-pong biogenesis produces piRNAs through reciprocal cleavage of complementary precursors (Fig 3A) [24,25]. The frequency of ping-pong amplification is therefore estimated by the fraction of piRNAs occuring on opposite strands of the TE consensus whose sequences overlap by 10 bp, a reflection of the cleavage-site preference of the key ping-pong cycle factors Aub and Argonaute-3 (Ago-3, Fig 3A–3D, S5 Table) [24–26]. In contrast, phasing biogenesis occurs through sequential cleavage of a single RNA strand, which is usually antisense [33,34]. Phasing is detected from the fraction of piRNAs whose 3’ ends are immediately followed by a uracil residue (+1-U), as well as the frequency of piRNAs from the same strand that are separated by a distance of a single nucleotide (d1), both of which are diagnostic of cleavage by the phasing nuclease Zucchini (Fig 3E–3G, S6 and S7 Tables) [33,34]. In general, ping-pong and phasing are inversely correlated in mutant piRNA pools, because reducing the frequency of one leads to a proportional increase in the other [33,34].
Aub plays a direct role in ping-pong amplification by cleaving piRNA precursors (Fig 3A) [24–26], and spn-E is required for the localization of Aub into the perinuclear nuage, where ping-pong occurs [28]. Mutations in either gene therefore cause a complete collapse of ping-pong amplification (Fig 3B, S7A and S7B Fig, S5 Table) [26,32]. Both D. melanogaster and D. simulans aub and spn-E alleles exhibited a dramatic increase in the ping-pong fraction, indicating a conserved role in ping-pong biogenesis (Fig 3B, S7A and S7B Fig). However in the case of aub, ping-pong fractions associated with the D. simulans transgenic rescue were modestly yet significantly lower than D. melanogaster, and there was a corresponding proportional increase in phased piRNA biogenesis (Fig 3B, 3F and 3G, S8 Fig, S6 and S7 Tables), suggesting reduced efficiency of ping-pong. By contrast, D. simulans spn-E allele did not reduce ping-pong (Fig 3B, S7B Fig, S5 Table), yet there was a modest but significant increase in the d1 proportion with the D. simulans spn-E rescue (Fig 3F, S6 Table), potentially suggesting increased phasing.
Armi promotes the production of phased piRNAs by binding to antisense piRNA intermediates and facilitating their cleavage by the nuclease Zucchini (Fig 3E) [29,33,34]. Both d1 and +1-U are therefore significantly reduced in armi mutants (Fig 3F and 3G, S8 Fig, S6 and S7 Tables). While Armi is not involved in ping-pong, phasing produces Aub-bound antisense piRNAs, which are required for ping-pong biogenesis for some TE families [26,44]. Ping-pong fractions are therefore decreased in armi mutants for some TE families (Fig 3C and 3D, S7C Fig, S5 Table). By contrast, for TE families that do not rely on phased piRNA production for ping-pong, ping-pong-derived piRNAs proportionally increase in armi mutants, owing to the loss of phased piRNAs (Fig 3C and 3D, S7C Fig, S5 Table). Although exhibiting piRNA production similar to the D. melanogaster allele (Fig 2B), the D. simulans armi rescue exhibited modestly but significantly reduced +1-U proportion, indicating reduced phasing (Fig 3G, S8B Fig, S7 Table). However, the more dramatic and statistically significant allelic effect is on ping-pong biogenesis, which is reduced for most TE families by the D. simulans armi rescue when compared to D. melanogaster (Fig 3C and 3D, S7C Fig, S5 Table). Importantly, this reduction occurs regardless of whether armi function enhances or represses ping-pong biogenesis, revealing a global inhibitory effect imposed by D. simulans armi. Indeed, although the differential abundance of TE and repeat-derived piRNAs between transgenic rescues rarely exceeded two-fold, significantly more TE families were more abundant in the presence of the D. melanogaster armi rescue compared to the D. simulans armi rescue (118 out of 131 TE families, Sign-test, P-value < 10−15). Therefore, the modest reductions in ping-pong and phasing biogenesis exhibited by the D. simulans armi allele lead to a similarly modest reduction in the abundance of TE and repeat-derived piRNAs.
Increased off-target effects of D. simulans alleles suggest increased genomic auto-immunity
While effective negative regulation of TE transcripts is a critical function of piRNA pathway proteins, it is equally important that they avoid off-target effects that interfere with the function of host genes. [19,21]. Aub, Spn-E and Armi are all RNA binding proteins that must specifically interact with piRNAs, piRNA precursors, and target transcripts, while avoiding interactions with cytoplasmic mRNAs. We therefore considered whether off-target effects differ between D. melanogaster and D. simulans alleles, predicting that D. simulans alleles may produce more off-target effects as they are not adapted to avoid interactions with D. melanogaster transcripts.
To test this prediction, we first identified protein-coding genes that are negatively regulated by piRNA pathway proteins by comparing their expression levels between mutants and transgenic rescues (S8 Table). Protein-coding genes whose expression is significantly reduced in transgenic rescues (>1.5 fold) are candidates for off-target effects of piRNA-mediated silencing. We observed that for all three proteins, significantly more genes decreased than increased in expression in transgenic rescues compared to mutants (Fig 4A), suggesting that piRNA pathway proteins tend to reduce the expression of protein-coding genes. Furthermore, the majority of protein-coding genes that are negatively regulated by D. melanogaster rescues are also repressed by D. simulans rescues, suggesting a shared impact on the expression of many protein-coding genes (Fig 4B and 4C). Indeed, protein-coding genes that are down-regulated by aub alleles from either species are enriched among mRNAs bound by Aub (Pearson's Chi-squared test, P-value = 0.04) [45].
Consistent with the auto-immunity hypothesis, we observed expanded negative regulation of protein coding genes by D. simulans alleles of both aub and armi. While both D. melanogaster and D. simulans alleles tend to decrease expression of host genes, significantly more genes exhibit reduced expression when the D. simulans transgenic rescue is compared to the mutant (Pearson's Chi-squared test, P-value = 0.01338 for aub; Pearson's Chi-squared test, P-value = 4.519×10−7 for armi) (Fig 4B). Furthermore, among those protein-coding genes down-regulated by either transgene, there is a systematic bias towards lower expression in the presence of the D. simulans alleles (One-sample Sign-Test, P-value = 0.001195 for aub; One-sample Sign-Test, P-value = 1.332×10−15 for armi). However, the majority of these genes are not significantly differentially expressed between transgenic rescues (127 out of 132 genes for aub, 481 out of 487 genes for armi) (Fig 4D, S9 Table), indicating that expanded negative regulation by D. simulans alleles exhibits only a subtle effect on host gene expression.
Increased off-target effects of D. simulans alleles could be explained by increased production of antisense genic piRNAs that target host transcripts, or by piRNA-independent interactions between proteins and mRNAs. Recent analyses of off-target interactions between host mRNAs and Piwi (closely related to Aub) or Armi support the latter scenario, suggesting that while the binding of host mRNAs by piRNA proteins reduces mRNA abundance, it does not result from enhanced antisense genic piRNA production [30,46,47]. We therefore compared the abundance of antisense genic piRNAs that target the silencing of sense transcripts between transgenic rescues (S9 Table). Of 132 and 487 protein-coding genes that are negatively regulated by either allele of aub and armi, only 13 and 50 are meaningfully targeted by antisense piRNAs, respectively (i.e. >50 antisense piRNAs on average are observed in at least one genotype, Fig 4E). Furthermore, no significant bias towards increased antisense piRNA production in the D. simulans allele was observed for either gene; indeed D. simulans armi even exhibits decreased, not increased, antisense piRNA abundance when compared to D. melanogaster (One-sample Sign-Test, P-value = 0.09229 for aub; One-sample Sign-Test, P-value = 2.386×10−5 for armi) (Fig 4E). Finally, D. simulans transgenic rescues do not exhibit expanded production of genic piRNAs for any of the three proteins (S9 Fig). Therefore, enhanced negative regulation of host mRNAs by D. simulans Aub and Armi appears to be independent of antisense piRNA production, and may arise through more frequent binding of D. simulans proteins to D. melanogaster transcripts.
If D. simulans Aub and Armi proteins exhibit enhanced binding to D. melanogaster mRNAs independently of antisense piRNAs, they could introduce them into the piRNA pool by treating them as substrates for piRNA maturation. Consistent with this model, we observed that sense piRNAs derived from genic transcripts that are negatively regulated by either transgene are significantly more likely to be more abundant in the presence of D. simulans alleles of aub and armi when compared to D. melanogaster (One-sample Sign-Test, P-value = 6.54×10−7 for aub; One-sample Sign-Test, P-value = 0.0002476 for armi). However, as with host mRNAs, these increases in sense piRNA abundance are subtle and predominantly not significant for individual genes (71 out of 72 genes in aub comparison, and 236 out of 244 genes in armi comparison are not significantly different) (Fig 4E, S9 Table). While these modest increases in sense piRNA abundance are consistent with the use of host mRNAs as substrates for piRNA biogenesis, it is also possible that host mRNAs bound by piRNA proteins may be eliminated by the mRNA degradation machinery [48,49].
Discussion
Despite pervasive adaptive evolution and gene duplication among piRNA pathway proteins in both insect and vertebrate lineages [12–15,50,51], the underlying forces that drive these evolutionary dynamics remain unclear. By performing interspecific complementation on three adaptively evolving piRNA pathway genes, we revealed diverged functions that may have arisen through positive selection. For all three proteins we observed idiosyncratic differences in TE regulation between D. melanogaster and D. simulans alleles, which is consistent with genetic conflict between host and parasite. However, we also revealed more extensive off-target effects and reduced efficiency of piRNA maturation associated with D. simulans alleles of both aub and armi, suggesting that selection acts to maximize biogenesis function while minimizing friendly fire on host transcripts. Taken together, our results suggest that positive selection acts at multiple molecular and functional interfaces within the piRNA pathway.
The simplest explanation for the adaptive evolution of piRNA proteins is that selection acts to maximize host control of TE transposition. At face value, TEs that are differentially expressed between transgenes from the two species seem to support this model (Fig 2A). However, all 5 of these TE families were more robustly silenced by the heterospecific D. simulans proteins. This suggests that rather than conspecific piRNA proteins being well-adapted to silence their genomic TEs, active genomic TEs may be well-adapted to evade silencing by their host regulators. Indeed the tirant element, which is more robustly regulated by D. simulans alleles of both armi and spn-E, is unusually active in D. melanogaster but is being actively lost from D. simulans [52–54]. We propose that the differential evolutionary dynamics of tirant in these two lineages may in part reflect the differences in host-control that we have uncovered.
Genomic auto-immunity was recently proposed as an additional target of positive selection among piRNA proteins [19]. The deliberate non-specificity of piRNA pathway proteins that allows them to target any sequence represented among piRNAs for silencing presents a huge liability for host-gene regulation: how can piRNA proteins avoid deleterious interactions with host transcripts? Furthermore, RNA-immunoprecipitation (RIP) and cross-linking immunoprecipitation (CLIP) of Piwi suggest that piRNA proteins may also negatively regulate host mRNAs by binding them directly in a piRNA-independent manner [46,47]. Similar observations have been made with Armi protein, with the ATP-ase domain being required to disassociate Armi from host mRNAs in the cytoplasm [30]. We observed that D. simulans armi and aub alleles are characterized by expanded negative regulation of host genes (Fig 4A–4C), which is accompanied by reduced efficiency of TE-derived piRNA production (Fig 3). Importantly, this observation is not consistent with a subtle difference in protein abundance between transgenic rescues, since this would reduce both piRNA biogenesis and off-target effects. Rather our observations suggest that D. simulans alleles bind more frequently to host mRNAs (Fig 4), thereby reducing host-gene expression and depleting the pool of protein available to enact piRNA maturation. Nevertheless, we cannot discount an equally intriguing alternative explanation: that D. simulans alleles have decreased affinity for interacting protein partners that mediate piRNA biogenesis, which liberates them to bind more frequently to host mRNAs. Future comparisons of molecular interactions involving D. melanogaster and D. simulans proteins could differentiate between these alternatives.
Our observations considerably expand our understanding of the enigmatic forces that drive adaptive evolution across the piRNA pathway. The three proteins we studied here, which are cytoplasmic factors involved in piRNA maturation and post-transcriptional silencing, provide an informative contrast to similar studies of three adaptively evolving nuclear transcriptional silencing factors: Rhino, Deadlock and Cutoff [20,22,55]. In comparison to the modest functional differences we observed between D. melanogaster and D. simulans alleles, nuclear factors are characterized by dramatic interspecific divergence, with D. simulans alleles behaving similarly to loss of function or dominant negative mutations [20,22,55]. Furthermore, adaptive evolution among transcriptional silencers has resulted in interspecific incompatibilities between interacting proteins, as opposed to the divergence in protein-RNA interactions that our data suggest. These observations logically reflect differences in the molecular functions of the two classes of proteins, with transcriptional regulation relying on suites of proteins that modify chromatin or regulate RNA-polymerase, while piRNA maturation and post-transcriptional silencing relies more on interactions between proteins and RNA.
Interestingly, a recent meta-analysis of piRNA protein evolution in insects revealed that while positive selection is pervasive throughout the piRNA pathway, signatures of adaptive evolution are significantly stronger among nuclear transcriptional regulators, as compared to the cytoplasmic factors we studied here [14]. Thus, our functional analysis recapitulates an evolutionary signature in sequence data. Why might nuclear transcriptional regulators diverge more rapidly or dramatically than their cytoplasmic counterparts? Enhanced positive selection on nuclear factors may reflect their greater potential to fully suppress the expression of host genes through disrupted chromatin state, as opposed to depleting host transcripts through non-productive binding [19]. We therefore propose that off-target effects may play an under-appreciated role in the evolution of both nuclear and cytoplasmic piRNA proteins, with the strength and consequences of positive selection depending on the mechanisms of—and costs to—host gene regulation.
Materials and methods
Fly strains and crosses
All Drosophila strains were reared at room temperature on standard cornmeal media.
For the studies of aubergine (aub), the following D. melanogaster strains were used: w; aubN11 bw1/CyO, y w; aubHN bw1/CyO, y w; aubHN bw1/CyO; ΦP{D. melanogaster aub}, and y w; aubHN bw1/CyO; ΦP{D. simulans aub}. w; aubN11 bw1/CyO, was a gift from Paul MacDonald. y w; aubHN bw1/CyO was obtained by extracting y w into aubHN bw1/CyO (Bloomington Drosophila Stock Center #8517). y w; aubHN bw1/CyO; ΦP{D. melanogaster aub} and y w; aubHN bw1/CyO; ΦP{D. simulans aub}, originally generated in Kelleher et al [31], were backcrossed for 6 generations in y w; aubHN bw1/CyO to minimize background effects that could lead to differences between transgenic stocks that are unrelated to the transgenes.
For the studies of spindle-E (spn-E), the following D. melanogaster strains were used: y w; spn-E1/TM6, y w; spn-Ehls-03987/TM6, y w; spn-Ehls-03987/TM6; ΦP{D. melanogaster spn-E}, and y w; spn-Ehls-03987/TM6; ΦP{D. simulans spn-E}. y w; spn-E1/TM6 and y w; spn-Ehls-03987/TM6 were obtained by crossing spn-E1/TM3 and spn-Ehls-03987/TM3 (gifts from Celeste Berg) to y w; TM3/TM6. To generate y w; spn-Ehls-03987/TM6; ΦP{D. melanogaster spn-E} and y w; spn-Ehls-03987/TM6; ΦP{D. simulans spn-E}, w1118; ΦP{D. melanogaster spn-E} and w1118; ΦP{D. simulans spn-E} were first crossed to y w; TM3/TM6. +/TM6; ΦP{D. melanogaster spn-E}/+ and +/TM6; ΦP{D. simulans spn-E}/+ offspring were then crossed to y w; spn-Ehls-03987/TM3. Finally, y w; spn-Ehls-03987/TM6; ΦP{D. melanogaster spn-E}/+ and y w; spn-Ehls-03987/TM6; ΦP{D. simulans spn-E}/+ offspring were backcrossed into y w; spn-Ehls-03987/TM6 for 6 generations, and subsequently homozygosed for the transgene, to minimize background effects.
For the studies of armitage (armi), the following D. melanogaster strains were used: y w; armi1/TM6, w; armi72.1/TM6, w; armi72.1/TM6; ΦP{D. melanogaster armi}, and w; armi72.1/TM6; ΦP{D. simulans armi}. y w; armi1/TM6 was obtained by crossing y w; armi1/TM3 (Bloomington Drosophila Stock Center #8513) to y w; TM3/TM6. w; armi72.1/TM6 was obtained from Bloomington Drosophila Stock Center (#8544). To generate w; armi72.1/TM6; ΦP{D. melanogaster armi} and w; armi72.1/TM6; ΦP{D. simulans armi}, w1118; ΦP{D. melanogaster armi} and w1118; ΦP{D. simulans armi} were first crossed to y w; TM3/TM6. +/TM3; ΦP{D. melanogaster armi}/+ and +/TM3; ΦP{D. simulans armi}/+ offspring were then crossed to w; armi72.1/TM6. Finally, w; armi72.1/TM3; ΦP{D. melanogaster armi}/+ and w; armi72.1/TM3; ΦP{D. simulans armi}/+ were backcrossed into w; armi72.1/TM6 for 6 generations, and subsequently homozygosed for the transgene, to minimize background effects.
Experimental genotypes were obtained from the following crosses. For studies of aub, virgin females w; aubN11 bw1/CyO were crossed to (1) y w; aubHN bw1/CyO, (2) y w; aubHN bw1/CyO; ΦP{D. melanogaster aub} or (3) y w; aubHN bw1/CyO; ΦP{D. simulans aub} males. For studies of spn-E, virgin females y w; spn-E1/TM6 were crossed to (1) y w; spn-Ehls-03987/TM6, (2) y w; spn-Ehls-03987/TM6; ΦP{D. melanogaster spn-E} or (3) y w; spn-Ehls-03987/TM6; ΦP{D. simulans spn-E} males. For studies of armi, virgin females y w; armi1/TM6 were crossed to (1) w; armi72.1/TM6, (2) w; armi72.1/TM6; ΦP{D. melanogaster armi} or (3) w; armi72.1/TM6; ΦP{D. simulans armi} males. Crosses were maintained at 25°C on standard cornmeal media.
Generation of transgenic lines
To introduce D. melanogaster and D. simulans alleles into D. melanogaster, we used ΦC31 integrase-mediated transgenesis system [41], which allows for site-specific integration. To generate transgenes, the gene and flanking regulatory regions of spn-E (~9.7Kb, D. melanogaster Release 6, 3R:15835349..15845065; D. simulans Release 2, 3R:9575537..9585081) [56,57] and armi (~6Kb, D. melanogaster Release 6, 3L:3460305..3466368; D. simulans Release 2, 3L:3357002..3363099) [56,57] were PCR-amplified by using corresponding primers (below) and iProof high-fidelity taq DNA polymerase (Bio-Rad).
D.mel/D.sim-spn-E forward primer: ATTGAACGCCGTCTATGCCAAGC
D.mel/D.sim-spn-E reverse primer: ACTGTTCGCCATTGCCACAGATTG
D.mel/D.sim-armi forward primer: CACCGCTGAAAGATACGCACACG
D.mel-armi reverse primer: GCTAGCCTGCGCTTGGGAGTGTTACCATTCG
D.sim-armi reverse primer: GCTAGCCTGACCTCGGGAGTGTTACCACTTC
The PCR products were cloned into pCR-Blunt-II-Topo according to manufacturer instructions (Invitrogen). Mutation-free clones were verified by sequencing.
attB-containing constructs used for site-specific integration were generated by subcloning the NotI/BamHI fragment of each spn-E TOPO plasmid, and the NotI/NheI fragment of each armi TOPO plasmid into NotI/BamHI and NotI/XbaI-linearized pCasper4/attB [58], respectively. spn-E and armi transgenic constructs were introduced into D. melanogaster at the P{CaryP}attP40 site, and site-specific integration of transgenes was confirmed by PCR [59]. The resulting transgenes were made homozygous in D. melanogaster w1118. Transgenes are indicated as ΦP{} in genotypes.
Female fertility
25–35 individual virgin females of each experimental genotype were crossed to two y w males on standard cornmeal media at 25°C. Fresh media and new males were provided every 5 days. The number of progeny from each 5-day period was quantified.
Small RNA-seq
3-6-day old female ovaries were dissected from each experimental genotype and placed directly in Trizol reagent (Invitrogen), and homogenized. For aub genotypes, Illumina small RNA libraries were prepared by Fasteris according to a proprietary protocol that depletes for 2S-RNA. Because the two biological replicates were prepared at different time points (5/13 and 7/13), they were analyzed separately. Small RNA libraries for spn-E and armi genotypes were prepared as described in [60]. In brief, total RNAs were extracted according to the manufacturer’s instructions, and size fractionated on a 12% polyacrylamide/urea gel to select for 18–30 nt small RNAs. Small RNAs were treated with 2S Block oligo (5’-TAC AAC CCT CAA CCA TAT GTA GTC CAA GCA/3SpC3/-3’), and were subsequently ligated to 3’ and 5’ adaptors, reverse transcribed and PCR amplified using NEBNext Multiplex Small RNA Library Prep Set for Illumina. Small RNA libraries were further purified from a 2% agarose gel and sequenced on a Illumina NextSeq 500 at the University of Houston Seq-N-Edit Core.
RNA-seq
RNA-seq libraries for the studies of aub were generated by Weill Cornell Epigenomics Core according to the protocol of [61]. Briefly, total RNA was extracted from the same ovaries as above, and mRNAs were isolated using poly-T Dynabeads (Invitrogen) according to the manufacturer’s instructions. Isolated mRNAs were further fragmented using fragmentation buffer (Ambion), ethanol precipitated, and reverse transcribed using Superscript II (Invitrogen) and random hexamer primers. Second-strand synthesis was performed using DNA polymerase I (Promega). cDNA was purified on a MinElute column (Qiagen), repaired with End-IT DNA repair kit (Epicentre), A-tailed with Klenow enzyme (New England Biolabs), and ligated to Illumina adaptors. Ligated cDNA was gel purified with the MinElute gel purification kit (Qiagen), PCR amplified, and gel purified again to make libraries.
RNA-seq libraries for the studies of spn-E and armi were prepared by using TruSeq Stranded Total RNA Library Preparation Kit for Illumina. 50 bp reads from each library were sequenced on a HiSeq 2000 (Aub and Spn-E) and a HiSeq 2500 (Armi) by the Weill-Cornell Epigenomics Core. RNA-seq and small RNA-seq data sets are deposited under PRJNA494103.
Bioinformatic analysis of small RNA-seq libraries
3’ Illumina adaptors were removed from sequencing reads by Cutadapt [62]. Sequence alignments were made by Bowtie [63]. Contaminating ribosomal RNAs were identified and removed by mapping sequencing reads to annotated ribosomal RNAs from flybase [64]. TE-derived piRNAs and genic piRNAs were identified by aligning sequencing reads ranging from 23–30 nucleotides (nt) to Repbase [65] or protein-coding gene reference sequence from Flybase [64], respectively, allowing for up to 2 mismatches. The number of reads mapped to each TE family or gene were counted using a Linux shell script. Redundant TE families in Repbase were identified by checking sequence identity (those consensus sequences that were >90% identical across >90% of their length were categorized as the same TE family), and reads mapped to multiple redundant TE families were counted only once. Reads mapped to multiple non-redundant TE families were discarded. To identify miRNAs sequencing reads ranging from 18–22 nt were aligned to a miRNA reference sequence from Flybase [64]. TE families or genes with low read count (< 50 on average) in every genotype library were discarded. piRNA counts for each TE family or gene were normalized to the total number of sequenced miRNAs from each library. Normalized values were used for comparisons of the abundance of piRNAs between libraries.
Bioinformatic analysis of RNA-seq libraries
Removal of ribosomal RNAs, and identification of TE-derived reads was performed as for small RNA libraries (above) except that 3 mismatches were permitted between sequencing reads and TE consensus sequences. Non TE-derived reads were aligned to flybase annotated transcripts in the D. melanogaster reference genome (D. melanogaster Release 6) [56,64] by TopHat [66], requiring unique mapping. The number of reads from each protein-coding gene were counted using HTseq-count [67]. TE families or genes with low read count (< 50 on average) in every genotype were discarded. Differential expression was estimated concurrently for TEs and protein-coding genes by DESeq for aub [68] and DESeq2 for spn-E and armi [43]. TEs or protein-coding genes were considered differentially expressed if they exhibited an adjusted P-value < 0.05 and a fold-change > 2 for TEs and > 1.5 for protein-coding genes.
Ping-pong fraction
Ping-pong fraction was calculated as described in [69]. In brief, small RNA sequencing reads ranging from 23–30 nt were aligned to TE consensus sequences from Repbase [65], and redundant TE families in Repbase were identified as described above. For each piRNA, the proportion of overlapping antisense binding partners whose 5’ end occurs on the 10th nucleotide was determined. This fraction was subsequently summed across all piRNAs from a given TE family, while incorporating the difference in sampling frequency between individual piRNAs. Finally, this sum was divided by the total number of piRNAs aligned to the TE family of interest. For multi-mappers, reads were apportioned by the number of times they can be aligned to the reference.
Phasing analysis
Small RNA sequencing reads ranging from 23–30 nt were aligned to the Repbase [65], and redundant TE families in Repbase were identified as described above. To calculate the d1 proportion [34], the number of piRNAs whose 5’ end was 1–22 nt downstream piRNA was determined for every TE-derived piRNA. The fraction of distances corresponding to 1 nt was then calculated. To calculate the +1-U proportion [34], the nucleotide after the 3’ end of each piRNA was determined based on alignment to the Repbase [65]. The frequency of each nucleotide at the +1 position was subsequently summed across all piRNAs from a given TE family, and the proportion of uridine was calculated. For both analyses, multiply-mapping reads were apportioned by the number of times they aligned to the reference.
Supporting information
S1 Fig [tif]
genotypes and crossing scheme.
S2 Fig [tif]
Similar expression level of , and transgenes, as well as germline and soma specific genes between . transgenic rescue and . transgenic rescue.
S3 Fig [tif]
Size distribution and composition of the small RNA pool for each genotype.
S4 Fig [a]
transgenes exhibit similar profiles of piRNA biogenesis to heterozygotes.
S5 Fig [tif]
Decoupling between changes in TE transcript abundance and changes in TE-derived piRNA abundance.
S6 Fig [tif]
Minimal differences in sense piRNA production between alleles.
S7 Fig [a]
Ping-pong fraction heat map for each protein studied.
S9 Fig [a]
Auto-immunity analysis for the genic piRNA profile.
S1 Table [xls]
Offspring count from the female fertility test.
S2 Table [xls]
RNA-seq and small RNA-seq library statistics.
S3 Table [xls]
Normalized abundance and differential expression of TE transcripts.
S4 Table [xls]
Normalized abundance and differential expression of TE-derived piRNAs.
S5 Table [xls]
piRNA ping-pong biogenesis signature for TE-derived piRNAs.
S6 Table [xls]
piRNA phasing biogenesis signature (d1 proportion) for TE-derived piRNAs.
S7 Table [xls]
piRNA phasing biogenesis signature (+1-U proportion) for TE-derived piRNAs.
S8 Table [xls]
Protein-coding genes that are differentially regulated by transgenes as compared to the mutant.
S9 Table [xls]
Log2 fold-change of transcript/piRNA abundance between . and . , for protein-coding genes whose expression levels are down-regulated by alleles from either . or . .
Zdroje
1. Chalitchagorn K, Shuangshoti S, Hourpai N, Kongruttanachok N, Tangkijvanich P, Thong-ngam D, et al. Distinctive pattern of LINE-1 methylation level in normal tissues and the association with carcinogenesis. Oncogene. 2004;23: 8841–8846. doi: 10.1038/sj.onc.1208137 15480421
2. Howard G, Eiges R, Gaudet F, Jaenisch R, Eden A. Activation and transposition of endogenous retroviral elements in hypomethylation induced tumors in mice. Oncogene. 2008;27: 404–408. doi: 10.1038/sj.onc.1210631 17621273
3. Kidwell MG, Novy JB. Hybrid Dysgenesis in DROSOPHILA MELANOGASTER: Sterility Resulting from Gonadal Dysgenesis in the P-M System. Genetics. 1979;92: 1127–1140. 17248943
4. Vilà MR, Gelpí C, Nicolás A, Morote J, Schwartz S, Schwartz S, et al. Higher processing rates of Alu-containing sequences in kidney tumors and cell lines with overexpressed Alu-mRNAs. Oncol Rep. 2003;10: 1903–1909. 14534716
5. Czech B, Hannon GJ. One Loop to Rule Them All: The Ping-Pong Cycle and piRNA-Guided Silencing. Trends Biochem Sci. 2016;41: 324–337. doi: 10.1016/j.tibs.2015.12.008 26810602
6. Anxolabéhère D, Kidwell MG, Periquet G. Molecular characteristics of diverse populations are consistent with the hypothesis of a recent invasion of Drosophila melanogaster by mobile P elements. Mol Biol Evol. 1988;5: 252–269. doi: 10.1093/oxfordjournals.molbev.a040491 2838720
7. Yang H-P, Barbash DA. Abundant and species-specific DINE-1 transposable elements in 12 Drosophila genomes. Genome Biol. 2008;9: R39. doi: 10.1186/gb-2008-9-2-r39 18291035
8. de la Chaux N, Wagner A. BEL/Pao retrotransposons in metazoan genomes. BMC Evol Biol. 2011;11: 154. doi: 10.1186/1471-2148-11-154 21639932
9. Lu C, Chen J, Zhang Y, Hu Q, Su W, Kuang H. Miniature inverted-repeat transposable elements (MITEs) have been accumulated through amplification bursts and play important roles in gene expression and species diversity in Oryza sativa. Mol Biol Evol. 2012;29: 1005–1017. doi: 10.1093/molbev/msr282 22096216
10. Lu J, Clark AG. Population dynamics of PIWI-interacting RNAs (piRNAs) and their targets in Drosophila. Genome Res. 2010;20: 212–227. doi: 10.1101/gr.095406.109 19948818
11. Malone CD, Hannon GJ. Molecular evolution of piRNA and transposon control pathways in Drosophila. Cold Spring Harb Symp Quant Biol. 2009;74: 225–234. doi: 10.1101/sqb.2009.74.052 20453205
12. Kolaczkowski B, Hupalo DN, Kern AD. Recurrent adaptation in RNA interference genes across the Drosophila phylogeny. Mol Biol Evol. 2011;28: 1033–1042. doi: 10.1093/molbev/msq284 20971974
13. Obbard DJ, Gordon KHJ, Buck AH, Jiggins FM. The evolution of RNAi as a defence against viruses and transposable elements. Philos Trans R Soc Lond B Biol Sci. 2009;364: 99–115. doi: 10.1098/rstb.2008.0168 18926973
14. Palmer WH, Hadfield JD, Obbard DJ. RNA-Interference Pathways Display High Rates of Adaptive Protein Evolution in Multiple Invertebrates. Genetics. 2018;208: 1585–1599. doi: 10.1534/genetics.117.300567 29437826
15. Simkin A, Wong A, Poh Y-P, Theurkauf WE, Jensen JD. Recurrent and recent selective sweeps in the piRNA pathway. Evolution. 2013;67: 1081–1090. doi: 10.1111/evo.12011 23550757
16. Yi M, Chen F, Luo M, Cheng Y, Zhao H, Cheng H, et al. Rapid evolution of piRNA pathway in the teleost fish: implication for an adaptation to transposon diversity. Genome Biol Evol. 2014;6: 1393–1407. doi: 10.1093/gbe/evu105 24846630
17. Vermaak D, Henikoff S, Malik HS. Positive selection drives the evolution of rhino, a member of the heterochromatin protein 1 family in Drosophila. PLoS Genet. 2005;1: 96–108. doi: 10.1371/journal.pgen.0010009 16103923
18. Senti K-A, Brennecke J. The piRNA pathway: a fly’s perspective on the guardian of the genome. Trends Genet. 2010;26: 499–509. doi: 10.1016/j.tig.2010.08.007 20934772
19. Blumenstiel JP, Erwin AA, Hemmer LW. What Drives Positive Selection in the Drosophila piRNA Machinery? The Genomic Autoimmunity Hypothesis. Yale J Biol Med. 2016;89: 499–512. 28018141
20. Parhad SS, Tu S, Weng Z, Theurkauf WE. Adaptive Evolution Leads to Cross-Species Incompatibility in the piRNA Transposon Silencing Machinery. Dev Cell. 2017;43: 60–70.e5. doi: 10.1016/j.devcel.2017.08.012 28919205
21. Castillo DM, Mell JC, Box KS, Blumenstiel JP. Molecular evolution under increasing transposable element burden in Drosophila: a speed limit on the evolutionary arms race. BMC Evol Biol. 2011;11: 258. doi: 10.1186/1471-2148-11-258 21917173
22. Yu B, Lin YA, Parhad SS, Jin Z, Ma J, Theurkauf WE, et al. Structural insights into Rhino-Deadlock complex for germline piRNA cluster specification. EMBO Rep. 2018;19. doi: 10.15252/embr.201745418 29858487
23. Parhad SS, Yu T, Zhang G, Rice NP, Weng Z, Theurkauf WE. Adaptive evolution targets a piRNA precursor transcription network. bioRxiv. 2019. p. 678227. doi: 10.1101/678227
24. Gunawardane LS, Saito K, Nishida KM, Miyoshi K, Kawamura Y, Nagami T, et al. A slicer-mediated mechanism for repeat-associated siRNA 5’ end formation in Drosophila. Science. 2007;315: 1587–1590. doi: 10.1126/science.1140494 17322028
25. Brennecke J, Aravin AA, Stark A, Dus M, Kellis M, Sachidanandam R, et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 2007;128: 1089–1103. doi: 10.1016/j.cell.2007.01.043 17346786
26. Malone CD, Brennecke J, Dus M, Stark A, McCombie WR, Sachidanandam R, et al. Specialized piRNA pathways act in germline and somatic tissues of the Drosophila ovary. Cell. 2009;137: 522–535. doi: 10.1016/j.cell.2009.03.040 19395010
27. Haase AD, Fenoglio S, Muerdter F, Guzzardo PM, Czech B, Pappin DJ, et al. Probing the initiation and effector phases of the somatic piRNA pathway in Drosophila. Genes Dev. 2010;24: 2499–2504. doi: 10.1101/gad.1968110 20966049
28. Andress A, Bei Y, Fonslow BR, Giri R, Wu Y, Yates JR 3rd, et al. Spindle-E cycling between nuage and cytoplasm is controlled by Qin and PIWI proteins. J Cell Biol. 2016;213: 201–211. doi: 10.1083/jcb.201411076 27091448
29. Pandey RR, Homolka D, Chen K-M, Sachidanandam R, Fauvarque M-O, Pillai RS. Recruitment of Armitage and Yb to a transcript triggers its phased processing into primary piRNAs in Drosophila ovaries. PLoS Genet. 2017;13: e1006956. doi: 10.1371/journal.pgen.1006956 28827804
30. Ge DT, Wang W, Tipping C, Gainetdinov I, Weng Z, Zamore PD. The RNA-Binding ATPase, Armitage, Couples piRNA Amplification in Nuage to Phased piRNA Production on Mitochondria. Mol Cell. 2019;74: 982–995.e6. doi: 10.1016/j.molcel.2019.04.006 31076285
31. Kelleher ES, Edelman NB, Barbash DA. Drosophila Interspecific Hybrids Phenocopy piRNA-Pathway Mutants. PLoS Biol. 2012;10. doi: 10.1371/journal.pbio.1001428 23189033
32. Li C, Vagin VV, Lee S, Xu J, Ma S, Xi H, et al. Collapse of germline piRNAs in the absence of Argonaute3 reveals somatic piRNAs in flies. Cell. 2009;137: 509–521. doi: 10.1016/j.cell.2009.04.027 19395009
33. Mohn F, Handler D, Brennecke J. piRNA-guided slicing specifies transcripts for Zucchini-dependent, phased piRNA biogenesis. Science. 2015;348: 812–817. doi: 10.1126/science.aaa1039 25977553
34. Han BW, Wang W, Li C, Weng Z, Zamore PD. Noncoding RNA. piRNA-guided transposon cleavage initiates Zucchini-dependent, phased piRNA production. Science. 2015;348: 817–821. doi: 10.1126/science.aaa1264 25977554
35. Wang W, Han BW, Tipping C, Ge DT, Zhang Z, Weng Z, et al. Slicing and Binding by Ago3 or Aub Trigger Piwi-Bound piRNA Production by Distinct Mechanisms. Mol Cell. 2015;59: 819–830. doi: 10.1016/j.molcel.2015.08.007 26340424
36. Vourekas A, Zheng K, Fu Q, Maragkakis M, Alexiou P, Ma J, et al. The RNA helicase MOV10L1 binds piRNA precursors to initiate piRNA processing. Genes Dev. 2015;29: 617–629. doi: 10.1101/gad.254631.114 25762440
37. Ishizu H, Kinoshita T, Hirakata S, Komatsuzaki C, Siomi MC. Distinct and Collaborative Functions of Yb and Armitage in Transposon-Targeting piRNA Biogenesis. Cell Rep. 2019;27: 1822–1835.e8. doi: 10.1016/j.celrep.2019.04.029 31067466
38. Adams MD, Celniker SE, Holt RA, Evans CA, Gocayne JD, Amanatides PG, et al. The genome sequence of Drosophila melanogaster. Science. 2000;287: 2185–2195. doi: 10.1126/science.287.5461.2185 10731132
39. Clark AG, Eisen MB, Smith DR, Bergman CM, Oliver B, Markow TA, et al. Evolution of genes and genomes on the Drosophila phylogeny. Nature. 2007;450: 203–218. doi: 10.1038/nature06341 17994087
40. Mitchell AL, Attwood TK, Babbitt PC, Blum M, Bork P, Bridge A, et al. InterPro in 2019: improving coverage, classification and access to protein sequence annotations. Nucleic Acids Res. 2019;47: D351–D360. doi: 10.1093/nar/gky1100 30398656
41. Groth AC, Fish M, Nusse R, Calos MP. Construction of transgenic Drosophila by using the site-specific integrase from phage phiC31. Genetics. 2004;166: 1775–1782. doi: 10.1534/genetics.166.4.1775 15126397
42. Schüpbach T, Wieschaus E. Female sterile mutations on the second chromosome of Drosophila melanogaster. II. Mutations blocking oogenesis or altering egg morphology. Genetics. 1991;129: 1119–1136. 1783295
43. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15: 550. doi: 10.1186/s13059-014-0550-8 25516281
44. Olivieri D, Senti K-A, Subramanian S, Sachidanandam R, Brennecke J. The Cochaperone Shutdown Defines a Group of Biogenesis Factors Essential for All piRNA Populations in Drosophila. Mol Cell. 2012. doi: 10.1016/j.molcel.2012.07.021 22902557
45. Barckmann B, Pierson S, Dufourt J, Papin C, Armenise C, Port F, et al. Aubergine iCLIP Reveals piRNA-Dependent Decay of mRNAs Involved in Germ Cell Development in the Early Embryo. Cell Rep. 2015;12: 1205–1216. doi: 10.1016/j.celrep.2015.07.030 26257181
46. Post C, Clark JP, Sytnikova YA, Chirn G-W, Lau NC. The capacity of target silencing byDrosophilaPIWI and piRNAs. RNA. 2014. pp. 1977–1986. doi: 10.1261/rna.046300.114 25336588
47. Sytnikova YA, Rahman R, Chirn G-W, Clark JP, Lau NC. Transposable element dynamics and PIWI regulation impacts lncRNA and gene expression diversity in Drosophila ovarian cell cultures. Genome Res. 2014;24: 1977–1990. doi: 10.1101/gr.178129.114 25267525
48. Lim AK, Tao L, Kai T. piRNAs mediate posttranscriptional retroelement silencing and localization to pi-bodies in the Drosophila germline. J Cell Biol. 2009;186: 333–342. doi: 10.1083/jcb.200904063 19651888
49. Rouget C, Papin C, Boureux A, Meunier A-C, Franco B, Robine N, et al. Maternal mRNA deadenylation and decay by the piRNA pathway in the early Drosophila embryo. Nature. 2010;467: 1128–1132. doi: 10.1038/nature09465 20953170
50. Levine MT, McCoy C, Vermaak D, Lee YCG, Hiatt MA, Matsen FA, et al. Phylogenomic analysis reveals dynamic evolutionary history of the Drosophila heterochromatin protein 1 (HP1) gene family. PLoS Genet. 2012;8: e1002729. doi: 10.1371/journal.pgen.1002729 22737079
51. Levine MT, Vander Wende HM, Hsieh E, Baker EP, Malik HS. Recurrent Gene Duplication Diversifies Genome Defense Repertoire in Drosophila. Mol Biol Evol. 2016;33: 1641–1653. doi: 10.1093/molbev/msw053 26979388
52. Cañizares J, Grau M, Paricio N, Moltó MD. Tirant is a new member of the gypsy family of retrotransposons in Drosophila melanogaster. Genome. 2000;43: 9–14. doi: 10.1139/g99-082 10701107
53. Fablet M, McDonald JF, Biémont C, Vieira C. Ongoing loss of the tirant transposable element in natural populations of Drosophila simulans. Gene. 2006;375: 54–62. doi: 10.1016/j.gene.2006.02.008 16626897
54. Kofler R, Nolte V, Schlötterer C. Tempo and Mode of Transposable Element Activity in Drosophila. PLoS Genet. 2015;11: e1005406. doi: 10.1371/journal.pgen.1005406 26186437
55. Parhad SS, Yu T, Zhang G, Rice NP, Weng Z, Theurkauf WE. Adaptive Evolution Targets a piRNA Precursor Transcription Network. Cell Rep. 2020;30: 2672–2685.e5.
56. Hoskins RA, Carlson JW, Wan KH, Park S, Mendez I, Galle SE, et al. The Release 6 reference sequence of the Drosophila melanogaster genome. Genome Res. 2015;25: 445–458. doi: 10.1101/gr.185579.114 25589440
57. Hu TT, Eisen MB, Thornton KR, Andolfatto P. A second-generation assembly of the Drosophila simulans genome provides new insights into patterns of lineage-specific divergence. Genome Res. 2013;23: 89–98. doi: 10.1101/gr.141689.112 22936249
58. Maheshwari S, Barbash DA. Cis-by-Trans regulatory divergence causes the asymmetric lethal effects of an ancestral hybrid incompatibility gene. PLoS Genet. 2012;8: e1002597. doi: 10.1371/journal.pgen.1002597 22457639
59. Venken KJT, He Y, Hoskins RA, Bellen HJ. P[acman]: a BAC transgenic platform for targeted insertion of large DNA fragments in D. melanogaster. Science. 2006;314: 1747–1751. doi: 10.1126/science.1134426 17138868
60. Wickersheim ML, Blumenstiel JP. Terminator oligo blocking efficiently eliminates rRNA from Drosophila small RNA sequencing libraries. Biotechniques. 2013;55: 269–272. doi: 10.2144/000114102 24215643
61. Marioni JC, Mason CE, Mane SM, Stephens M, Gilad Y. RNA-seq: an assessment of technical reproducibility and comparison with gene expression arrays. Genome Res. 2008;18: 1509–1517. doi: 10.1101/gr.079558.108 18550803
62. Martin M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.journal. 2011;17: 10–12.
63. Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009;10: R25. doi: 10.1186/gb-2009-10-3-r25 19261174
64. Gramates LS, Marygold SJ, Santos G dos, Urbano J-M, Antonazzo G, Matthews BB, et al. FlyBase at 25: looking to the future. Nucleic Acids Res. 2017;45: D663–D671. doi: 10.1093/nar/gkw1016 27799470
65. Bao W, Kojima KK, Kohany O. Repbase Update, a database of repetitive elements in eukaryotic genomes. Mob DNA. 2015;6: 11. doi: 10.1186/s13100-015-0041-9 26045719
66. Trapnell C, Pachter L, Salzberg SL. TopHat: discovering splice junctions with RNA-Seq. Bioinformatics. 2009;25: 1105–1111. doi: 10.1093/bioinformatics/btp120 19289445
67. Anders S, Pyl PT, Huber W. HTSeq—A Python framework to work with high-throughput sequencing data. bioRxiv. 2014. p. 002824. doi: 10.1101/002824
68. Anders S, Huber W. Differential expression analysis for sequence count data. Genome Biol. 2010;11: R106. doi: 10.1186/gb-2010-11-10-r106 20979621
69. Brennecke J, Malone CD, Aravin AA, Sachidanandam R, Stark A, Hannon GJ. An epigenetic role for maternally inherited piRNAs in transposon silencing. Science. 2008;322: 1387–1392. doi: 10.1126/science.1165171 19039138
70. Teixeira FK, Okuniewska M, Malone CD, Coux R-X, Rio DC, Lehmann R. piRNA-mediated regulation of transposon alternative splicing in the soma and germ line. Nature. 2017;552: 268–272. doi: 10.1038/nature25018 29211718
71. Malone CD, Hannon GJ. Molecular evolution of piRNA and transposon control pathways in Drosophila. Cold Spring Harb Symp Quant Biol. 2009;74: 225–234. doi: 10.1101/sqb.2009.74.052 20453205
Článek vyšel v časopise
PLOS Genetics
2020 Číslo 6
- Proč se v Česku šíří několik „vymýcených“ infekcí najednou? Ptáme se odborníků
- ADHD jako evoluční výhoda? Výzkum se zaměřil na lovce a sběrače
- Případ Bulovka: Jak postupují jiné nemocnice, aby podobným tragédiím zabránily?
- Metamizol jako analgetikum první volby: kdy, pro koho, jak a proč?
- Jak často se u masových střelců vyskytují duševní choroby?
Nejčtenější v tomto čísle
- AXR1 affects DNA methylation independently of its role in regulating meiotic crossover localization
- Super-resolution imaging of RAD51 and DMC1 in DNA repair foci reveals dynamic distribution patterns in meiotic prophase
- Reciprocal regulation between nicotinamide adenine dinucleotide metabolism and abscisic acid and stress response pathways in Arabidopsis
- Osteocalcin promotes bone mineralization but is not a hormone