Výsledky vyšetření mikrodelecí oblasti AZF(Yq) u mužů s reprodukčními problémy


RESULTS OF EXAMINATION OF MICRODELETIONS IN THE AZF(YQ) REGION IN MEN WITH REPRODUCTIVE DISORDERS

The male factor of infertility is the cause of reproductive disorders in approximately 50 % couples, and there is about 50 % of cases in which the cause of male infertility is unknown.

Microdeletions in the AZF (Yp) regions occur in about 4 – 5 % of men with oligospermia and in about 15 – 18 % of men with azoospermia, in approximately 10 % of men with reproductive disorders.

In couples with reproductive failure, genetic counselling and chromosomal analysis in both partners is recommended. Examination of microdeletions in the AZF regions were performed in men with severe oligo or azoospermia.

Between 2000 and 2006, we performed this analysis in 594 men with pathological sperm count and we found microdeletions in 21 men – 3.54 % (range 1.34 – 5.43 %).

Microdeletion has been mostly found in patients with azoospermia, in only 3 men has been found severe oligospermia with maximal sperm count 1.2 million/ml).

Based on our own experience and on relevant literature, we defined more strict indication criteria for the analysis of microdeletions of AZF regions in men. We found positive results only in men with sperm count of less then 2 milions in ml.

Genetic counselling and genetic analysis are a very important component of assisted reproduction. Information about the risk of transmission of a genetic disorders upon the child should be provided before the methods of assisted reproduction are used.

Key words:
reproductive disorders, male factor, microdeletions AZFa,b,c regions Yq, genetic counselling


Autoři: MUDr. Renata Gaillyová;  Ph.D. RNDr. Iveta Valášková1 1;  MUDr. Rastislav Beharka2;  prof. MUDr. Dalibor Pacík;  CSc.2;  doc. MUDr. Igor Crha;  CSc.3;  prof. MUDr. Pavel Ventruba, DrSc.3
Působiště autorů: ‑Oddělení lékařské genetiky LF MU a FN Brno Černopolní 9, 61 00 Brno e-mail: gaillyova@fnbrno. cz1;  Urologická klinika LF MU a FN Brno2;  ‑Gynekologicko-porodnická klinika LF MU a FN Brno3
Vyšlo v časopise: Urol List 2007; 5(3): 18-21

Souhrn

Mužský faktor infertility nacházíme asi u poloviny párů s reprodukčními problémy a asi u 50 % těchto případů zůstává etiologie reprodukčních potíží zatím neznámá.

Mikrodelece Y chromozomu v oblasti AZF se podle literárních údajů vyskytují asi u 4–5 % mužů s oligospermií a asi u 15–18 % mužů s azoospermií, v průměru asi u 10 % mužů s reprodukčními problémy.

Ke komplexnímu vyšetření párů s poruchami reprodukce by dnes mělo již neodmyslitelně patřit genetické vyšetření obou partnerů, u mužů s těžkou oligospermií a azoospermií je většinou zařazeno i molekulárně genetické vyšetření zaměřené na detekce mikrodelecí oblastí AZF a, b, c.

V letech 2000 až 2006 bylo provedeno toto vyšetření u 594 mužů s patologickým spermiogramem. Mikrodeleci oblasti AZF jsme detegovali u 21, což představuje záchyt 3,54 %. V jednotlivých letech kolísal záchyt onemocnění mezi 1,34 % a 5,43 %.

Mikrodelece byla většinou zachycena u pacientů s azoospermií, pouze u 3 mužů byla uvedena těžká oligospermie s maximálním počtem spermií 1,2 mil/ml.

Z našich zkušeností i z literárních údajů jsme vyvodili přísnější indikační kritéria pro toto molekulárně genetické vyšetření a pozitivní záchyty jsme zaznamenali pouze u mužů s počtem spermií do 2 mil/ml.

Genetické poradenství je velmi důležitá součást procesu asistované reprodukce. Informace o možnosti přenosu genetické poruchy na potomky by měla být předána před použitím metod asistované reprodukce.

Klíčová slova:
reprodukční obtíže, mužský faktor, mikrodelece oblastí AZF a,b,c Yq, genetické poradenství

ÚVOD

Reprodukční genetika je součástí oboru reprodukční medicína. Věnuje se vyšetření infertilních párů, etiologii reprodukčních poruch a prevenci vzniku a opakování genetických vad. Jejím cílem je snaha umožnit rodinám mít nepostižené dítě.

Reprodukční genetika je dalším novým odvětvím lékařské genetiky, integrovaným s reprodukční medicínou, asistovanou reprodukcí a vývojovou genetikou, která se zaměřuje na preventivní prekoncepční a prenatální genetická vyšetření u párů s poruchou reprodukce. Reprodukční ge­ne­tika je úzce vázána na perikoncepčnía perinatologickou prevenci a prenatální diagnostiku, je založena na systému specializovaného genetického poradenství, klinické cytogenetiky, molekulární cytogenetiky a molekulární genetiky. řešení závažných problémů poruch reprodukce se řadí k prioritám klinické medicíny. Cílem reprodukční medicíny je umožnit partnerům mít dítě. Cílem reprodukční genetiky je umožnit partnerům mít nepostižené dítě – samozřejmě s přihlédnutím ke specifickému i obecnému gene­tickému riziku rodiny [4,8].

Pro genetické poradenství je porucha reprodukce kontroverzní termín. Porucha reprodukce může být zjevná až v případě, že pár usiluje o koncepci. V případě této po­ruchy je však třeba položit si 2 základní otázky:

  1. Je infertilita projevem genetického onemocnění, které může být přenášeno na potomstvo?
  2. Může korekce infertility zvýšit riziko narození postiženého dítěte?

Najít odpověï na obě tyto otázky je cílem reprodukční genetiky a pro obě otázky může být u určitého procenta párů odpověï kladná. Dostupná genetická vyšetření však dnes nemůžeme pokládat za vyčerpávající. Tam, kde jsme příčinu infertility schopni odhalit, jsme často schopni určit i riziko postižení u potomstva a většinou i nabídnout cílenou prenatální diagnostiku. U těch párů, kde dostupná genetická, ale i další vyšetření příčinu poruchy reprodukce neodhalí, může tato příčina zůstat skrytá a neumožní odhad genetického rizika ani cílené sledování a prenatální vyšetření, přičemž riziko narození postiženého potomstva ne­mů­že­me jednoznačně vyloučit [3, 10,11].

Neplodností je postiženo asi 15–20 % párů v reproduktivním věku. Dnes zvažu­jeme stejný podíl příčiny poruchy fertility na straně muže i ženy. Předpokládá se, že andrologický faktor se podílí na infertilitě asi u 1/3 párů samostatně a u 1/3 je společný podíl na straně muže i ženy. Asi 50 % případů mužské infertility zůstává neobjasněno.

Diagram 1. Chromozom Y.
Diagram 1. Chromozom Y.

Výsledek vyšetření mikrodelece AZF a,b,c.
1 - pacient - delece AZF b
2 - pacient - delece AZF c
K+ pozitivní kontrola
K- negativní kontrola
M - marker molekulových hmotností
detekce oblasti AZFa: sY84, sY86,
detekce oblasti AZFb: sY127, sY134
detekce oblasti AZFc: sY254, sY255
Obr. 1. Výsledek vyšetření mikrodelece AZF a,b,c. 1 - pacient - delece AZF b 2 - pacient - delece AZF c K+ pozitivní kontrola K- negativní kontrola M - marker molekulových hmotností detekce oblasti AZFa: sY84, sY86, detekce oblasti AZFb: sY127, sY134 detekce oblasti AZFc: sY254, sY255

K základním genetickým vyšetřením při zjištěné andrologické příčině poruchy fertility by mělo patřit především:

  1. klinickogenetické a genealogické vyšetření obou partnerů - tedy sestavení podrobné anamnézy a minimálně třígeneračního rodokmenu
  2. cytogenetické vyšetření obou partnerů
  3. mutační analýza nejčastěji se vysky­tujících mutací v CFTR genu u muže se zjiš­těným patologickým spermio­gra­mem
  4. detekce mikrodelecí oblastí AZF na Yq chromozomu u mužů s azoospermií nebo těžkou oligozoospermií [1,6,12]

Mikrodelece AZF (azoospermia factor) oblastí na dlouhém ramenu chromozomu Y (Yq11.3) jsou považovány za nejčastější příčinu těžké oligospermie nebo azoospermie, kterou můžeme detegovat moleku­lárně genetickým vyšetřením - DNA analýzou. V AZF oblasti se vyskytuje tzv. genová rodina DAZ - z anglického označení dele­ted in azoospermia. Frekvence výskytu mikrodelecí AZF oblastí se odhaduje asi na 1/10 000 živě narozených chlapců. Literární údaje hovoří o výskytu mikro­delece AZF oblasti asi u 4–5 % mužů s oligospermií a asi u 15–18 % mužů s azoospermií, v průměru asi u 10 % mužů s reprodukčními problémy. Oblast AZF je rozdělena do 3 podoblastí AZFa, AZFb a AZFc (dříve byly označovány také jako AZF 1 a AZF 2). Geny vyskytující se v tomto úseku se účastní procesu spermatogeneze a jsou nezbytné pro mužskou reprodukci. Předpokládá se, že každá podoblast je aktivní v jiné fázi spermatogeneze. Mezi genotypem a fenotypem byla vypozorována určitá korelace závažnosti postižení. Mikrodelece v podoblasti AZFb a AZFc se projeví ve fenotypu většinou pod obrazem oligozoospermie až azoospermie. Mikrodelece v oblasti AZFa má závažnější projev a ve většině případů zjišujeme azoospermii [2,5,9].

Screening mikrodelecí Yq chromozomu se stal rutinním diagnostickým testem, který může objasnit etiologii poruchy spermatogeneze a může upřesnit prognózu pro možnost získání spermií v případě využití mikrochirurgických technik a asistované reprodukce. Metody asistované reproduk­ce nyní představují účinnou symptomatic­kou terapii pro muže nesoucí mikro­deleci Yq, ale je třeba si uvědomit, že delece AZF oblastí je těmito technikami přenášena na mužské potomky, u kterých následně musíme očekávat poruchu ferti­lity [7,13]. V budoucnu lze pravděpodobně očekávat vývoj terapie založené na znalosti biolo­gické funkce genů AZF oblastí.

METODIKA

Mikrodeleci oblasti AZF Yq jsme na OLG FN Brno začali vyšetřovat u mužů s poruchou reprodukce a s těžkou oligozoospermií až azoospermií v roce 1997. Postupně se toto vyšetření stalo rutinním. Pro zjištění efektivity této analýzy jsme vyhodnotili výsledky za posledních 7 let. Na zá­kladě zhodnocení nízkého záchytu mikro­delece a v souladu s doporučeními v odborné literatuře jsme postupně zpřísnili diagnostická kritéria. Vyšetření jsme původně doporučovali u mužů s počtem spermií 10 milionů/ml a nižším, dnes je toto vyšetření indikováno pouze u hodnot pod 5 milionů spermií v ml, přičemž z našich výsledků za posledních 7 let vyplývá, že pozitivní záchyt jsme zaznamenali pouze u mužů s počtem spermií pod 2 miliony v ml.

MOLEKULÁRNĚ GENETICKÉ VYŠETŘENÍ

Vstupním materiálem pro vyšetření je DNA izolovaná z lymfocytů periferní krve pa­cienta (automatický izolátor Biorobot EZ1).

Při vyšetření používáme modifikovanou metodu PCR, tzv. multiplex PCR s více dvojicemi primerů. Ve 2 multiplex PCR reakcích syntetizujeme pomocí kitu TaqPCRMaster Mix Kit (QIAGEN) vždy 6 oblastí azoospermatických faktorů AZFa, AZFb, AZFc:

  1. multiplex PCR: oblast AZFa (primery sY86F/ sY86FR), AZFb (primery sY127F/ sY127R), AZFc (primery sY254F/ sY254R), kontrolu přítomnosti chromozomu Y gen SRY (F/R), a kontrolu reakce F508del (Q1,Q2)
  2. multiplex PCR: oblast AZFa (primery sY84F/ sY84R), AZFb (primery sY134F/ sY134R), AZFc (primery sY255F/ sY255R) a kontrolně SRY (F/R ), ZFY(F/R).

Sekvence primerů:

sY86-F: gtgacacacagactatgcttc

sY86-R: acacacagagggacaaccct

sY127-F: ggctcacaaacgaaaagaaa

sY127-R: ctgcaggcagtaataaggga

sY254-F: gggtgttaccagaaggcaaa

sY254-R: gaaccgtatctaccaaagcagc

SRY-F: gaatattcccgctctccgga

SRY-R: gctggtgctccattcttgag

Q1: gttttcctggattatgcctggcac

Q2: gttggcatgctttgatgacgcttc

sY84-F: agaagggtctgaaagcaggt

sY84-R: gcctactacctggaggcttc

sY134-F: gtctgcctcaccataaaacg

sY134-R: accactgccaaaactttcaa

sY255-F: gttacaggattcggcgtgat

sY255-R: ctcgtcatgtgcagccac

ZFY-F: accrctgtactgactgtgattacac

ZFY-R: gcacytctttggtatcygagaaagt

Program amplifikace:

94 °C/15 min

94 °C/30 s, 55° C/30 s,

65 °C/4 min 25x

72 °C/5 min

4 °C

Detekci přítomnosti všech syntetizovaných oblastí genu pro azoospermatický faktor provádíme pomocí elektroforézy v polyakrylamidovém gelu barveném AgNO3. Délky syntetizovaných oblastí: SRY- 472bp, ZFY- 495bp, F508del- 98bp, sY84- 326bp, sY86- 320bp, sY127- 274bp, sY134- 301bp, sY254- 400bp, sY255- 126bp.

VYŠETŘOVANÝ SOUBOR A VÝSLEDKY

V letech 2000 až 2006 byla na OLG FN Brno analyzována oblast AZF Yq u 594 mu­žů s patologickým spermiogramem. Jed­nalo se většinou o pacienty vyšetřované ve spolupráci s Urologickou klinikou LF MU a FN Brno a Centrem asistované reprodukce LF MU a FN Brno; část pacientů byla doporučena ke genetickému vyšetření jiným ošetřujícím lékařem.

Mikrodelece AZF oblastí byla po­tvrzena celkem u 21 mužů, což představuje záchyt 3,54 %. V jednotlivých letech se záchyt pohyboval mezi 1,34 až 5,43 %. Výsledky vyšetření v jednotlivých letech jsou přehledně uvedeny v tab. 1.

Tab. 1. Záchyt mikrocelece AZF v laboratoři DNA diagnostiky FN Brno v letech 2000 až 2006.
Záchyt mikrocelece AZF v laboratoři DNA diagnostiky FN Brno v letech 2000 až 2006.

V tab. 2 je uveden rozsah mikrodelecí Yq u pozitivně testovaných mužů.

Tab. 2. Záchyt jednotlivých typů mikrodelece AZF.
Záchyt jednotlivých typů mikrodelece AZF.

Z korelace našich nálezů mikrodelece Yq s výsledky spermiogramu vyšetřovaných mužů jsme zjistili, že se ve většině případů jednalo o pacienty s azoospermií. Maximální počet spermií u muže se zjištěnou mikrodelecí na Yq chromozomu v našem souboru byl 1,2 milionu/ml. Nálezy SPG jsou uvedeny v tab. 3.

Tab. 3. Výsledky spermiogramu u pacientů se záchytem mikrodelece oblasti AZF Yq na OLG FN Brno v letech 2000–2006.
Výsledky spermiogramu u pacientů se záchytem mikrodelece oblasti AZF Yq na OLG FN Brno v letech 2000–2006.

ZÁVĚR

Vyšetření mikrodelecí v oblasti AZF Yq u mužů s patologickým spermiogramem se stalo rutinním screeningovým testem při vyšetřování párů s reprodukčními problémy. Mělo by být indikováno v rámci komplexního genetického vyšetření, které je provázeno genetickým poradenstvím a cytogenetickým vyšetřením, případně dalším specializovaným vyšetřením na úrovni DNA diagnostiky (mutační analýza CFTR genu). Vyšetření mikrodelecí AZF oblastí Yq doporučujeme v souladu s lite­rárními údaji pouze u mužů s těžkou oligozoospermií nebo s azoospermií, která je zjištěna opakovaným vyšetřením spermio­gramu. Molekulárně genetické analýze by mělo předcházet specializované urologic­ko-andrologické vyšetření. Z našich výsledků usuzujeme, že indikace je možno zpřísnit a vyšetření provádět pouze při hodnotách pod 2 miliony spermií v 1 ml. Vyšetřování mužů s patologickým výsledkem spermiogramu by se mělo vždy provádět ve spolupráci s andrologií a urologií a v návaznosti na specializovaná centra asistované reprodukce. V diagnostickém protokolu doporučujeme zařazení genetického vyšetření neplodného páru před první cyklus umělého oplodnění. Součástí genetického vyšetření by měla být i následná konzultace výsledků gene­tického vyšetření včetně výsledků DNA analýzy. V případě potvrzení mikrodelece oblastí AZF Yq je nezbytná nejen konzultace o dalších možnostech využití technik asistované reprodukce, ale i konzultace zaměřená na 100% riziko transferu mikrodelece a souvisejících reprodukčních potíží na všechny mužské potomky, na možnosti prenatální případně preimplantační genetické diagnostiky.

Tab. 4. Další postup navržený páru s poruchou reprodukce, u muže zjištěna mikrodelece AZF oblasti Yq.
Další postup navržený páru s poruchou reprodukce, u muže zjištěna mikrodelece AZF oblasti Yq.

MUDr. Renata Gaillyová, Ph.D.1RNDr. Iveta Valášková1

MUDr. Rastislav Beharka2

prof. MUDr. Dalibor Pacík, CSc.2

doc. MUDr. Igor Crha, CSc.3

prof. MUDr. Pavel Ventruba, DrSc.3

1Oddělení lékařské genetiky LF MU a FN Brno Černopolní 9, 613 00 Brno e-mail: gaillyova@fnbrno.cz

2Urologická klinika LF MU a FN Brno

3Gynekologicko-porodnická klinika LF MU a FN Brno


Zdroje

1. Dohle GR et al. Genetic risk factors in infertile men with severe oligozoospermia and azoospermia. Hum Reprod 2002; 17(1): 13-16.

2. Friel A et al. Molecular detection of Y chromosome microdeletions: an Irish study. Int J Androl 2001; 24(1): 31-36.

3. Harper PS. Practical Genetic Counselling. 6. ed. London: Arnold 2004.

4. Havlovicová M, Semanová E. Genetické poradenství. Neonatol List 2004; 10: 14-15.

5. Hopps CV et al. Detection of sperm in men with Y chromosome microdeletions of the AZFa, AZF b and AZFc regions. Hum Reprod 2003; 18(8): 1660-1665.

6. Kleiman et al. Genetic evaluation of infertile men. Hum Reprod 1999; 14(1): 33-38.

7. Kremer JAM et al. Microdeletions of the Y chromosome and intracytoplasmatic sperm injection: from gene to clinic. Hum Reprod 1997; 14(4): 687-691.

8. Macek M, Vilímová Š, Potužníková Š et al. Využití lékařské genetiky v reprodukční medicíně. čas Lék čes 2002; 141: 28-34.

9. Maurer B, Simoni M. Y chromosome microdeletion screening in infertile men. J Endocrinol Inve 2000; 23(10): 664-670.

10. Nussbaum RI, McIllnes RR, Willard HF. Klinická genetika. 6. ed. Praha: Triton 2001.

11. řeřábek K. Sterilita a opakované potrácení. Mod Gynek Porod 2002; 11(4): 512-524.

12. Sertič J et al. Genetic Markers of Male Infertility: Y Chromosome Microdeletions and Cystic Fibrosis Transmembrane Conductance Gene Mutations. Croat Med J 2001; 42(4): 416-420.

13. van der Ven K et al. Combined cytogenetic and Y chromosome microdeletion screening in males undergiong intracytoplasmatic sperm injection. Mol Hum Reprod 1997; 3(8): 699-704.

Štítky
Dětská urologie Urologie

Článek vyšel v časopise

Urologické listy

Číslo 3

2007 Číslo 3

Nejčtenější v tomto čísle

Tomuto tématu se dále věnují…


Kurzy

Zvyšte si kvalifikaci online z pohodlí domova

Doporučení, indikace a dávkování LMWH
nový kurz
Autoři: doc. MUDr. Tomáš Kvasnička, CSc.

Pacient s neuropatickou bolestí v ordinaci praktického lékaře
Autoři: doc. MUDr. Ladislav Slováček, Ph.D., MUDr. Birgita Slováčková, Ph.D.

Imunoterapie urotelového karcinomu močového měchýře
Autoři:

Neutropenie
Autoři: MUDr. Michal Kouba

Průlomová bolest a možnosti její léčby
Autoři: MUDr. Pavlína Nosková, Ph.D.

Všechny kurzy
Kurzy Doporučená témata Časopisy
Přihlášení
Zapomenuté heslo

Nemáte účet?  Registrujte se

Zapomenuté heslo

Zadejte e-mailovou adresu se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.

Přihlášení

Nemáte účet?  Registrujte se