Huntingtonova nemoc: zkušenosti s genetickým testováním v letech 1994-2005


Huntington´s Disease: Experience with Genetic Testing within 1994 – 2005

The aim of research is to present clinico-genetic characteristics of Huntington´s disease in a representative sample of Czech population, and to show the benefit of genetic testing and its difficulties.

Huntington´s disease (HD) is an autosomally dominant hereditary neurodegenerative disease with its onset in adulthood conditioned by the expansion of CAG repetition in the coding area of gene IT 15. Since 1994, there have been carried out 629 genetic tests: 567 diagnostic, 61 presymptomatic and one prenatal tests. The diagnostic test confirmed the clinical diagnosis of HD in 72.5 % patients. A new mutation was demonstrated in two cases. With positive familial history, the diagnosis was confirmed in 95 % patients, in the absent familial occurrence the test was positive in 18 % patients, in the case of unclear anamnestic data HD was the problem in 60 %. That has shown the benefit of DNA analysis as a masterful tool in differential diagnostics.

The presymptomatic test was completed by about 1/3 of applicants in the risk of HD development. The result was positive in 40 %. The acceptance of presymptomatic test made 4 % of supposed risky population, prenatal diagnostics was required quite exceptionally. The low utilization of predictive test is caused by the discrepancy between the possibility of precise molecular-genetic diagnostics and non-existence of an effective therapy for HD.

Key-words:
Huntington´s disease, CAG repetition, DNA analysis, diagnostic testing.


Autoři: J. Židovská 1;  J. Klempíř 2;  V. Kebrdlová 1;  T. Uhrová 3;  J. Koblihová 4;  M. Anders 3;  P. Doubek 3;  J. Vevera 3;  J. Roth 2
Působiště autorů: Ústav biologie a lékařské genetiky 1. LF UK a VFN, Praha 1;  Neurologická klinika 1. LF UK a VFN, Praha 2;  Psychiatrická klinika 1. LF UK a VFN, Praha 3;  Ústřední vojenská nemocnice, Praha 4
Vyšlo v časopise: Cesk Slov Neurol N 2007; 70/103(1): 72-77
Kategorie: Krátké sdělení

Práce vznikla za podpory grantu IGA MZ ČR 7623-3 Autoři děkují za spolupráci všem doporučujícím neurologickým, psychiatrickým a genetickým pracovištím a Společnosti pro pomoc při Huntingtonově chorobě (www.huntington.cz).

Souhrn

Cílem práce je seznámit s klinicko-genetickými charakteristikami u Huntingtonovy nemoci v reprezentativním vzorku české populace a poukázat na přínos genetického testování i jeho úskalí.

Huntingtonova nemoc (HN) je autosomálně dominantně dědičné neurodegenerativní onemocnění s nástupem v dospělosti, podmíněné expanzí CAG repetice v kódující oblasti genu IT 15. Od roku 1994 bylo provedeno 629 genetických testů: 567 diagnostických, 61 presymptomatických a jeden prenatální. Diagnostický test potvrdil klinickou diagnózu HN u 72,5 % pacientů. Ve dvou případech byla prokázána nová mutace. Při pozitivní rodinné anamnéze byla diagnóza konfirmována u 95 % pacientů, při absenci familiárního výskytu byl test pozitivní u 18 % pacientů, v případě nejasných anamnestických údajů se jednalo o HN v 60 %. To dokládá přínosnost DNA analýzy jako suverénního nástroje diferenciální diagnostiky.

Presymptomatický test dokončila cca 1/3 žadatelů v riziku onemocnění HN. Ve 40 % byl výsledek pozitivní. Akceptace presymptomatického testu činila 4 % předpokládané rizikové populace, prenatální diagnostika byla žádána zcela výjimečně. K nízkému využití prediktivních testů vede rozpor mezi možností přesné molekulárně genetické diagnostiky a neexistencí efektivní terapie HN.

Klíčová slova:
Huntingtonova nemoc, CAG repetice, DNA analýza, diagnostické testování, prediktivní testování, psycho-sociální dopady

Úvod

Huntingtonova nemoc (HN) je považována za jednu z nejzávažnějších genetických poruch s nástupem v dospělém věku. Obvykle začíná nenápadnými motorickými symptomy nebo psychickými změnami, následovanými progresivní choreou, psychiatrickými poruchami a kognitivním deficitem. Prevalence v různých populacích evropského původu je nejčastěji uváděna v rozmezí 5-10 na 100 000 obyvatel [1]. Před nálezem genové mutace byla diagnóza HN založena na přítomnosti klasické triády: progresivních choreatických dyskinéz a demence při pozitivní rodinné anamnéze. Huntingtonova nemoc je autosomálně dominantně dědičné onemocnění, způsobené expanzí (CAG)n trinukleotidové repetice v prvním exonu HN genu, původně zvaného IT-15, lokalizovaného na 4. chromozómu v pozici 4p16.3 [2].

HN patří do skupiny tzv. „tripletových onemocnění“, která se stále rozrůstá a zahrnuje další neurodegenerativní onemocnění [3]. Repetice obsahuje 6-26 tripletů CAG u normálních, stabilních alel, 27-35 CAG u dlouhé normální alely, s možností expanze, zvláště při paternálním přenosu, 36-39 CAG opakování u expandované alely s redukovanou penetrancí a 40 a více CAG u plně penetrantní mutované alely. Mutace je nestabilní a zejména při otcovské transmisi může dojít k prodloužení (CAG)n sekvence s postižením potomků v mladším věku - anticipace [4,5,6]. U jedince s 35 a méně opakováními tripletu CAG nebyla dosud nikdy spolehlivě zaznamenána HN. Nehledě na určité těžkosti, spojené s klinickou a prognostickou interpretací nálezu alel, nesoucích 27-39 opakování (intermediární alely, „šedá zóna“), se genetické testování osvědčilo jako cenný diagnostický nástroj neurologů, psychiatrů a genetiků. Specificita a senzitivita testování byla ověřena na rozsáhlém celosvětovém vzorku nemocných [7]. Počet CAG repetic negativně koreluje s věkem nástupu příznaků, avšak odpovídá jen za cca 70 % variance věku nástupu [8].

Objevení genu pro HN v roce 1993 [2] vedlo k rychlému rozvoji molekulárně genetických testů, schopných potvrdit klinickou diagnózu u pacienta a identifikovat nosiče mutované alely mezi jedinci v riziku. Presymptomatické testy jsou spojeny s řadou závažných psycho-sociálních dopadů a etických aspektů a jsou prováděny pouze u zletilých osob na jejich vlastní žádost [9]. Aby byly zajištěny standardní podmínky a předešlo se možné újmě v případě prediktivního testování, došlo k vypracování jednotné strategie předtestových.konzultací, prováděných během několika měsíců před vlastním vyšetřením [10].

Prezentované výsledky odrážejí 11letou systematickou práci pražského multioborového týmu, konstituujícího se od počátku v blízké součinnosti se svépomocnou Společností pro pomoc při Huntingtonově chorobě (SPHCH), založenou roku 1991. Cílem svépomocného hnutí je poskytovat všestrannou podporu a pomoc pacientům a jejich rodinám, zlepšovat informovanost rodin i veřejnosti o všech aspektech HN a přispívat ke zkvalitňování komplexní péče. SPHCH vydává řadu informačních materiálů včetně periodického zpravodaje, 2krát ročně pořádá víkendové edukačně rekondiční setkání členů rodin a provozuje půjčovnu zdravotních pomůcek. Kooperace odborníků s SPHCH jim zajišťuje velmi přínosnou zpětnou vazbu, kterou mohou reflektovat ve své práci.

Cílem práce je popsat distribuci (CAG)n v souboru pacientů se susp. HN, seznámit s výsledky diagnostických testů, korelovat klinické a genetické charakteristiky u pacientů s konfirmovanou diagnózou HN a zjistit akceptaci prediktivního testování.

Soubor a metodika

Od roku 1991 byl ve spolupráci se svépomocnou organizací založen registr čítající cca 500 rodin s HN. Zajišťujeme genetické testování HN metodou přímé mutační analýzy od roku 1994 prakticky pro celou Českou republiku s výjimkou olomouckého regionu. Celkem bylo provedeno 629 molekulárně genetických testů, z toho 561 diagnostických a 62 prediktivních. Doporučujícím lékařem byl nejčastěji neurolog (42,1 %), dále genetik (23,1 %) a psychiatr (23,9 %). V 10,9 % se buď výjimečně jednalo o jiného lékaře, avšak převážně šlo o presymptomatický test na vlastní žádost osoby v riziku.

Testovaný soubor tvořilo 43 % mužů a 57 % žen. Věk nástupu prvních příznaků se pohyboval od 8 do 74 let (průměr 43,1 ± 13,4), přičemž většina spadala do období 23 až 59 let. Průměrný věk při diagnóze HN byl 49,7 ± 12,1 roku.

Genomová DNA byla extrahována z lymfocytů periferní krve, event. amniocytů standardní vysolovací technikou [10].Oblast CAG(n) repetice byla amplifikována modifikovanou PCR metodou podle Warnera [11]. Byly použity primery pro CAG a CCG polymorfizmus.

Primery pro CAG polymorfizmus:

HD1 FAM 5´- ATGAAGGCCTTCGAGTCCCTCAAGTCCTTC - 3´
HD3 5´ - GGCGGTGGCGGCTGTTGCTGCTGCTGCTGC - 3´

Primery pro CCG polymorfizmus:

HDA HEX 5. Byly použity primery ´ - GCAGCAGCAGCAGCAACAGCCGCCA - 3´
HDB 5´ - GCGGCGGCTGAGGAAGCTGAGGAGG - 3´

PCR probíhala v 25 µl reakční směsi : 50-500ng DNA, 2.4 pmol každého primeru, 1x MBI Fermentas pufr, 3mM MgCl2,16uM dNTP, 0,6 % glycerolu a 3U Taq DNA Polymerázy. Po zahřátí na 96 °C 4 minuty následovalo 34 cyklů 30 sec 940C, 30 sec 700C, 30 sec 720C, na závěr 10 minut 72 °C. PCR produkty byly zpracovány na sekvenátoru ABI PRISM 310 pomocí fragmentační analýzy s použitím polymeru POP-4. Vzorek byl smíchán se směsí deonizovaného formamidu a interního standardu (2:12). Následně po elektrokinetickém nasátí vzorku probíhala kapilární elektroforéza s konečnou fluorescenční detekcí. Jako interní standard byl použit Tamra 500 s korekcí na externí kontrolní vzorek o známém počtu repeticí.

Povolená odchylka výsledku je do 1 repetice při alele do 40 repetic a do 3 repetic při expandované alele o více než 40 repeticích. Molekulárně genetická laboratoř prochází externí kontrolou kvality, každoročně organizovanou EMQN – The European Molecular Genetics Quality Network [13].

Molekulární testy byly prováděny buď diagnostické (u symptomatických jedinců) nebo prediktivní: presymptomatické (u osob v riziku) a prenatální (u plodu v riziku). Testování probíhalo v souladu s mezinárodními doporučeními [14,15] na základě písemného informovaného souhlasu.

U každého pacienta bylo zaznamenáno pohlaví, věk nástupu, charakter iniciálních příznaků a rodinná anamnéza a velikost repetice. Data byla obvykle získána ze zdravotní dokumentace nebo pomocí cíleně vypracované průvodky k zasílanému materiálu (krev nebo izolovaná DNA), méně často přímým interview s pacientem nebo jeho rodinnými příslušníky.

Při statistickém zpracování dat bylo pro srovnání distribuce ve skupinách použito Mannova-Whitneyova dvouvýběrového pořadového testu, χ2 testu, dále byla provedena lineární regresní analýza a výpočet korelačního koeficientu determinace.

Výsledky

Diagnostické testování

Celkem bylo přímou DNA analýzou vyšetřeno 567 pacientů s podezřením na HN, 61 osob v riziku a 1 plod. Klinická diagnóza byla potvrzena u 411 nemocných (72,5 %). Z toho celkem 402 osob (97,8 %) neslo plně mutovanou alelu, 9 pacientů mělo expandovanou alelu v rozmezí redukované penetrance (36-39 repeticí). V souboru pozitivně testovaných pacientů bylo 40 dvojic příbuzných 1. stupně (rodič – dítě, sourozenci), 7 trojic a 1 pětice příbuzných 1. stupně. Huntingtonovu chorobu bylo možno pokládat za vyloučenou celkem u 156 osob, přičemž 138 (88,5 %) z nich mělo obě alely s méně než 27 repeticemi a 18 osob (11,5 %) mělo 1 z normálních alel v mutabilním rozmezí. Ve 2 případech byla u pacienta zjištěna nová mutace paternálního původu, kdy zdravý otec nesl jednu alelu v mutabilním pásmu (28 repeticí) (obr. 1) nebo v pásmu redukované penetrance (38 repeticí). Otcové byli ještě ve věku 93 a 68 let bez příznaků onemocnění, paternita byla potvrzena.

Schéma 1. Rodokmen s novou mutací paternálního původu. Šipkou je označena nemocná probandka s novou mutací.
Schéma 1. Rodokmen s novou mutací paternálního původu. Šipkou je označena nemocná probandka s novou mutací.

Plná mutace se pohybovala od 40 do 81 opakování tripletu CAG s mediánem 45. Neexpandovaná alela čítala od 8 do 26 repeticí s mediánem 18. 27 pacientů s 1 alelou v pásmu kompletní penetrance mutace (36 a více) mělo druhou normální alelu v mutabilním pásmu nebo v oblasti redukované penetrance mutace, přičemž horní mez byla 37 repeticí (alelická kompozice pacienta 37/43). V dostupné dokumentaci pacienta nebyly shledány žádné fenotypové nápadnosti oproti klasickému obrazu nemoci ani výskyt HN v obou parentálních liniích. V souboru nebyl zjištěn žádný nositel dvou plně mutovaných alel.

Distribuce normálních a mutovaných alel s vyznačením přechodné „šedé zóny“ je demonstrována na obr. 2.

Distribuce CAG repeticí u pacientů s potvrzenou a vyloučenou HN.
Graf 1. Distribuce CAG repeticí u pacientů s potvrzenou a vyloučenou HN.

CAG a věk nástupu

Byla prokázána významná inverzní korelace mezi počtem repeticí expandované alely a věkem nástupu prvních příznaků (p<0,001, r = -0,61). Dvanáct pacientů onemocnělo před 20. rokem života (juvenilní forma) a reprezentovali 3,3 % všech pacientů s expanzí. Repetice trinukleotidu CAG se u nich pohybovala od 44 do 81 opakování s mediánem 56. Celkem 10,5 % nemocných mělo pozdní formu Huntingtonovy choroby (nad 60 let), přičemž expanze byla v rozmezí 40-55 repeticí, s mediánem 41.

Familiární výskyt HN

U 80,8 % pacientů byly získány údaje rodinné anamnézy (RA) ve smyslu potvrzení nebo vyloučení parentálního přenosu. U zbývajících pacientů byla RA nejasná (neznalost zdravotního stavu rodičů nebo jejich předčasné úmrtí, atypická symptomatika rodičovského onemocnění event. uvedení jiné diagnózy, která mohla být falešná). V případě jasného familiárního výskytu HN byla diagnóza potvrzena u 94,7 %, u nejasné RA se jednalo o HN v 60,5 % a při negativní RA v 18,1 % případů. Ve skupině pacientů s konfirmovanou diagnózou HN mělo 78,8 % jedinců pozitivní RA, 5,1 % vykazovalo absenci familiárního výskytu a 16,1 % osob mělo nejasnou RA (tab.1).

Tab. 1. Přehled konfirmace diagnózy HN ve vztahu k familiárnímu výskytu.
Přehled konfirmace diagnózy HN ve vztahu k familiárnímu výskytu.

Typ přenosu

Přenos HN od matky se u souboru pozitivně testovaných pacientů vyskytl stejně často jako přenos od otce. Při paternální transmisi se průměrný věk nástupu (40,1±11,7) významně nelišil od věku nástupu v případě maternálního přenosu (42,3 ± 11,1), avšak u mutací s více než 45 repeticemi byla shledána převaha paternální transmise. Průměrný věk nástupu nebyl při paternálním přenosu významně nižší, nicméně tato tendence byla naznačena.

Iniciální příznaky

Retrospektivní hodnocení iniciálních příznaků má často spornou spolehlivost, a při různosti zdrojů informaci se údaje často značně liší. Iniciální příznaky byly u 20 % pacientů psychiatrické, v 8 % nebylo možno zjistit, u zbytku nemocných (72 %) převládaly příznaky motorické event. smíšené povahy. Nebyl prokázán signifikantní vztah mezi charakterem příznaků a délkou repetice.

Prediktivní testování

Presymptomatický test žádalo 190 osob v riziku HN, avšak celý proces dokončilo jen 32,1 %. Schéma protokolárního postupu, který je flexibilní a trvá obvykle 3 měsíce, a výsledky testování jsou znázorněny na obr.3.

Schéma 2. Akceptace presymptomatického testování – schéma protokolu.
Schéma 2. Akceptace presymptomatického testování – schéma protokolu.

Průměrný věk žadatelů činil 34,8 let (19-60 let), přičemž většina byla ve věku 23-33 let s převahou žen (poměr 1,37, p<0,01). O prenatální diagnostiku projevilo zájem pět párů. Uskutečněn byl jediný test u plodu pozitivně testované zdravé osoby, s donošením pozitivně testovaného plodu. V další graviditě již pár prenatální diagnostiku nežádal.

Diskuse

Bylo otestováno minimálně 40 % z očekávané HN populace v ČR, pokud připustíme nejvyšší uváděnou prevalenci 1:10 000 obyvatel, lze však spíše očekávat prevalenci nižší (1.15 000 - 20 000 obyvatel). Vyšetřováni zahrnovalo rovněž osoby, u nichž suspekce na HN nestála na prvním místě diagnostické rozvahy, ale bylo třeba HN vyloučit. Celkem 94,7 % pacientů s jasným familiárním výskytem mělo HN potvrzenu, při nejasných anamnestických údajích to bylo 60,5 %. Při negativní rodinné anamnéze byla diagnóza HN stanovena u 18,1 % pacientů. Tyto výsledky dobře odpovídají zahraničním údajům [16] a dokládají zásadní význam testu při absenci familiárního výskytu. V těchto případech se může jednat o falešnou paternitu, která v rozvinutých zemích činí až 10 %, úmrtí rodiče před manifestací choroby, nedostatek údajů, případně o novou mutaci [17]. Alely v intermediární zóně mohou zvláště při paternální transmisi během meiózy expandovat do oblasti plně penetrující mutace. U pacientů s vyloučenou HN byla často doporučujícím lékařem uvedena další možná diagnóza (Alzheimerova nemoc, dystonie, familiární tremor, Parkinsonova nemoc, psychotická porucha, spinocerebellární ataxie, Wilsonova nemoc), nicméně v těchto případech bude vhodné posílit zpětnou vazbu od doporučujících lékařů.

V případě vyloučení HN u osob s udaným familiárním výskytem onemocnění (5,3 %) se několikrát jednalo o psychotickou poruchu s polékovými tardivními dyskinezami u potomka geneticky konfirmovaného pacienta. Déle se jednalo o zpětné přehodnocení diagnózy rodiče (u potomka zjištěna Creutzfeldtova-Jakobova nemoc, spinocerebelární ataxie, benigní familiární chorea, neuroakantocytóza). Nesporně je však třeba ve výjimečných případech připustit možnost fenokopie, které podle literárních údajů činí cca 1 % populace pacientů s obrazem HN [18].

Průkaz inverzní korelace mezi velikostí expanze (CAG)n repetice a věkem nástupu prvních příznaků je konzistentní s literárními údaji [19-22], stejně jako převaha otcovského přenosu u delší expanze.

Požadavek na presymptomatické testování je nízký (12-16 %), pokud jej vztahujeme k celé předpokládané populaci rizikových osob v registrovaných rodinách (předpokládá se 3-4krát více osob v riziku nežli nemocných, což je cca 1 200-1 600 osob). Skutečná akceptace testu je pak ještě nižší a činí cca 1/3 z původních žadatelů, tedy 4-5 % výchozí populace.

V budoucnu zřejmě nelze očekávat dramatický nárůst, pokud nedojde k objevu léčby zamezující nebo oddalující nástup nemoci. Ženy jsou obecně více motivované, zvláště ve věku 23-33 let, kdy většina z nich činí rozhodnutí o reprodukci [16]. U 41 % osob v riziku byla zjištěna expandovaná alela. Tento podíl se liší od očekávaných 50 %, což může být způsobeno přítomností osob s 25% nebo určitou self-selekcí, kdy osoby v riziku, u nich již nastupují mírné symptomy, test spíše nežádají [23]. Zájem o prenatální diagnostiku je zcela zanedbatelný, nejen kvůli pozdnímu nástupu nemoci, dovolujícímu řadu let kvalitního života, ale také vzhledem k vysoké pravděpodobnosti, že se v příští graviditě bude dilema opakovat. V tomto ohledu může být řešením preimplantační diagnostika [24].

Rozpor mezi možností přesné molekulárně genetické diagnostiky a neexistencí efektivní terapie HN vede celosvětově k nízkému využití prediktivních testů. Zahraniční zkušenosti svědčí pro akceptaci testů u 5-25 % rizikové populace, žádost o prenatální diagnostiku je ještě daleko nižší – do 5 % [25-27]. Naše výsledky jsou s těmito zkušenostmi konzistentní.

Postoje rizikové populace k prediktivním testům může zásadně změnit objev léčby. Do té doby má klíčový význam protokolární postup sloužící pro zdravé žadatele jako určité síto, kterým projdou jen ti skutečně motivovaní. Tzv. katastrofické dopady pozitivního výsledku presymptomatického testu, zahrnující psychotraumatizaci až suicidální jednání, byly ve velké multicentrické studii [28] zjištěny pouze u 1 % pozitivně testovaných. V našem souboru měli z 36 nosičů mutace výraznější obtíže 3 osoby. Domníváme se, že nelze možné komplikace podceňovat, vzhledem k tomu, že nejzávažnější dopady znalosti genetického statutu lze očekávat především v době nástupu prvních příznaků [29].

Závěr

Molekulárně genetické testování je vysoce přínosným a suverénním nástrojem diferenciální diagnostiky u klinicky suspektní HN. Umožnilo v průběhu 12 let zmapovat podstatnou část české HN populace.

Požadavky na prediktivní testování rizikových jedinců jsou dosud velmi řídké. Vzhledem k etickým dilematům a psychosociálním rizikům je prediktivní test ošetřen obligatorním protokolárním postupem, který minimalizuje riziko nežádoucích dopadů výsledku. Naše zkušenosti potvrzují jeho přínosnost stejně jako význam úzké kooperace se svépomocnou organizací.

MUDr. Jana Židovská, CSc.

odd.lékařské genetiky ÚBLG 1.LF UK a VFN

Ke Karlovu 2, 128 08 Praha 2

e-mail: jana.zidovska@seznam.cz

Přijato k recenzi: 9. 2. 2006

Přijato do tisku: 20. 4. 2006


Zdroje

1. Harper PS. The epidemiology of Huntington´s disease. J Med Genet 1992; 89: 365-72.

2. The Huntington´s Disease Colaborative Research Group. A novel gene containing a trinucleotide repeat that is expanded and unstable on Huntington´s disease chromosomes. Cell 1993; 72: 971-83.

3. Koeppen AH. The hereditary ataxias. J Neuropathol Exp Neurol 1998; 57: 531-43.

4. Kremer B, Almquist E, Theilmann J et al. A world-wide study of the Huntington´s disease mutation. N Engl J Med 1994; 30: 1401-6.

5. Rubinsztein DC, Leggo J, Voles R et al. Phenotypic characterization of individuals with 30-40 CAG repeats in the Huntingtion disease (HD) gene reveals HD cases with 36 repeats and apparently normal eldery individuals with 36-39 repeats. Am J Hum Genet 1996; 59: 16-22.

6. McNeil SM, Novelletto A, Srindhi J et al. Reduced penetrance of the Huntington´s disease mutation. Hum Mol Genet 1997; 6: 775-9.

7. Nance MA. Huntington disease – another chapter rewritten. Am J Hum Genet 1996; 59: 1-8.

8. Brinkman RR, Mezei MM, Theilmann J et al. The likelihood of beening affected with Huntington disease by a particular age, for a specific CAG size, Am J Hum Genet 1997; 60: 1202-10.

9. Soebel SK, Brokes Cowan D. Impact of genetic testing for Huntington disease on the familysystem. Am J Med Genet 2000; 90: 49-59.

10. International Huntington Association (IHA) and the World Federation of Neurology (WFN) Research Group on Huntington´s Chorea. Guidelines for the molecular genetics predictive test in Huntington´s disease. Neurology 1994; 44: 1533-6.

11. Mullenbach R. An efficient salt-chloroform extraction of DNA from blood and tissues. Trends Genet 1998; 5: 391.

12. Warner JP, Barron L H, Brock DJ. A new polymerase chain reaction (PCR) assay for the trinucleotide repeat that is unstable and expanded on Huntington´s disease chromosomes. Mol Cell Probes 1993; 235-9.

13. Losekoot M, Bakker B, Laconne F et al. A European pilot quality assessment scheme for molecular diagnosis of Huntington´s disease. Eur J Hum Genet 1999; 7: 217-22.

14. Potter NT, Spector EB, Prior TW. Technical standards and guidelines for Huntington disease testing. Genet Med 2004; 6: 61-5.

15. ACMG/ASHG statement. Laboratory guidelines for Huntington disease genetic testing. Am J Hum Genet 1998; 62: 1243-7.

16. Laccone F, Engel U, Holinski-Feder E et al. DNA analysis of Huntington´s disease: Five years of experience in Germany, Austria, and Switzerland. Neurology 1999; 53: 801-6.

17. Falush D, Almquist EW, Brinkman RR et al. Measurement od Mutation flow implies both a high new-mutation rate for Huntington disease and substantial underascertainment of late-onset cases. Am J Med Genet 2000; 68: 373-85.

18. Xiang F, Almquist W, Huq M et al. A Huntington disease-like neurodegenerative disorder maps to chromosome 20. Am J Med Genet 1998; 1431-8.

19. Ramos-Arroyo MA, Moreno S, Valiente A. Incidence and mutation rates of Huntington´s disease in Spain: experience of 9 years of direct genetic testing. J Neurol Neurosurg Psychiatry 2005; 76: 337-42.

20. Do Carmo Costa M, Magalhaes P, Ferreirinha F et al. Molecular diagnosis of Huntington disease in Portugal: implications for genetic counselling and clinical practice. Eur J Hum Genet 2003;11: 872-8.

21. Akbas F, Erginhel-Unaltun N. DNA testing for Huntington disease in the Turkish population. Eur Neurol 2003; 50: 20-4.

22. Jakab K, Gárdián G, Endreffy E et al. Analysis of CAG repeat expansion in Huntington´s disease gene (IT 15) in a Hungarian population. Eur Neurol 1999; 41: 107-10

23. Codori AM, Hanson R, Brandt J. Self-selection in predictive testing for Huntington´s disease. Am J Med Genet, 1994; 54: 167-73.

24. Stern HJ, Harton GL, Sisson ME et al. Non-disclosing preimplantation genetic diagnosis for Huntington´s disease. Prenat Diagn 20002; 22: 503-7.

25. Mandich P, Jacopini G, Di Maria E et al. Predictive testing for Huntington´s disease: ten years´experience in two Italian centres. Ital J Neurol Sci 1998; 9: 68-74.

26. Harper P S, Lim C, Craufurd D. Ten years of presymptomatic testing for Huntington´s disease: the experience of the UK Huntington´s Disease Predictive Consortium. J Med Genet 2000; 37: 567-71.

27. Maat-Kievit A, Vegter-van der Vlis M, Zoeteweij M et al. Experience in prenatal testing for Huntington´s disease in The Netherlands: procedures, results and guidelines (1987-1997). Prenat Diagn 1999; 19: 450-7.

28. Almquist EW, Bloch M, Brinkman R et al. A Worldwide Assessment od the frequency of suicide, suicide attempts, or psychiatric hospitalization after predictive testing for Huntinton disease. Am J Hum Genet 1999; 64: 1293-304.

29. Timman R, Roos R, Maat-Kievit A. Adverse effects of predictive testing for Huntington disease underestimated: long-term effects 7-10 years after the test. Health Psychol 2004; 23: 189-97.

Štítky
Dětská neurologie Neurochirurgie Neurologie
Článek Úvodník

Článek vyšel v časopise

Česká a slovenská neurologie a neurochirurgie

Číslo 1

2007 Číslo 1

Nejčtenější v tomto čísle

Tomuto tématu se dále věnují…


Kurzy

Zvyšte si kvalifikaci online z pohodlí domova

Léčba bolesti v ordinaci praktického lékaře
nový kurz
Autoři: MUDr. PhDr. Zdeňka Nováková, Ph.D.

Revmatoidní artritida: včas a k cíli
Autoři: MUDr. Heřman Mann

Jistoty a nástrahy antikoagulační léčby aneb kardiolog - neurolog - farmakolog - nefrolog - právník diskutují
Autoři: doc. MUDr. Štěpán Havránek, Ph.D., prof. MUDr. Roman Herzig, Ph.D., doc. MUDr. Karel Urbánek, Ph.D., prim. MUDr. Jan Vachek, MUDr. et Mgr. Jolana Těšínová, Ph.D.

Léčba akutní pooperační bolesti
Autoři: doc. MUDr. Jiří Málek, CSc.

Nové antipsychotikum kariprazin v léčbě schizofrenie
Autoři: prof. MUDr. Cyril Höschl, DrSc., FRCPsych.

Všechny kurzy
Kurzy Doporučená témata Časopisy
Přihlášení
Zapomenuté heslo

Nemáte účet?  Registrujte se

Zapomenuté heslo

Zadejte e-mailovou adresu se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.

Přihlášení

Nemáte účet?  Registrujte se