#PAGE_PARAMS# #ADS_HEAD_SCRIPTS# #MICRODATA#

Abstracts


Vyšlo v časopise: Cesk Slov Neurol N 2015; 78/111(Supplementum 2): 4-27
Kategorie: Abstrakta

Conference Program

Sunday, November 8

Arrival and check-in

16 : 00–18 : 00

Czech-Norwegian research program meeting

18 : 00

Registration, welcome drink and dinner

Monday, November 9

7 : 00–9 : 00

Breakfast, registration

Morning

Welcome/Introductory comments by organizers

9 : 00–9 : 10

Jan Motlik, Libechov, Czech Republic

Opening lectures

9 : 10–9 : 30

Monika Baxa, Libechov, Czech Republic

Living with Huntington’s disease in the Czech Republic

The Czech Huntington’s Disease Association (CHDA), its activity and cooperation with the Research Center PIGMOD

9 : 30–10 : 30

Douglas Macdonald, CHDI Foundation, USA

A strategy for the identification of translatable HTT lowering biomarkers

Scientific program of the Conference will be realized in the following sessions:

Session I

Neurodegenerative diseases, perspectives from rodent models to clinical

Chair: Zdenka Ellederova

10 : 30–11 : 00

Libo Yu-Taeger, Tubingen, Germany

Transgenic rat models for polyglutamine diseases

11 : 00–11 : 30

Huu Phuc Nguyen, Tubingen, Germany

Olesoxime suppresses calpain activation and mutant huntingtin fragmentation and ameliorates disease phenotypes in the BACHD rat

11 : 30–12 : 00

Coffee break

Session II

Emerging technologies and development of large animal models of disease

Chair: Martin Marsala

12 : 00–12 : 30

Nik Klymiuk, Munich, Germany

Pig models for monogenic diseases –⁠ how to make use of diverse gene targeting approaches for modifying the porcine genome

12 : 30–13 : 00

Pavlina Konstantinova, Amsterdam, Netherlands

Pre-clinical evaluation of AAV5-miHTT gene therapy of Huntington’s disease

13 : 00–14 : 00

Lunch

Afternoon

Session III

Translatable measures: patients to large animal models and back

Chair: Jan Motlik

14 : 00–14 : 30

Martin Marsala, San Diego, USA

Experimental modeling and clinical treatment of amyotrophic lateral sclerosis by spinal grafting of human spinal stem cells

14 : 30–15 : 00

Stefan Juhas, Libechov, Czech Republic

Development and validation of brain and spinal cord vector and cell-delivery techniques in pre-clinical minipig models of neurodegenerative disorders

15 : 00–16 : 00

Marian Hruska-Plochan, Zurich, Switzerland

Modeling ALS on human neurons in vitro

16 : 00–16 : 20

J. Gadher, Life Technologies

Antibody-based investigational approaches in neuro-proteomics and neurodegenerative diseases

16 : 20–16 : 40

Hana Kovarova, Libechov, Czech republic

Reduction of IFNα and IL-10 in central nervous system and increase in peripheral Il-8 in transgenic porcine Huntington’s disease model

16 : 40–17 : 00

Technical News

Jana Fukalova, BioTech

Think possible with Cytation

Milan Kopecek, Accela s.r.o

In vivo instruments for translational neuro-research

Session IV

17 : 00–19 : 00

Poster viewing with coffee

19 : 00–22 : 00

Dinner and wine tasting

Tuesday, November 10

7 : 00–9 : 00

Breakfast

Morning

Session V

Large animal model of HD

Chair: Douglas Macdonald

9 : 00–9 : 40

Emøke Bendixen

Pig Peptide Atlas: a tool for improved farm animal and model organism research

9 : 40–10 : 20

Zdenka Ellederova

Phenotype development of TgHD minipigs

10 : 20–10 : 50

Ralf Reilmann, Muenster, Germany

The TgHD minipig on the road to preclinical studies –⁠ current state of the art in behavioral and MR imaging assessments

10 : 50–11 : 20

Coffee break

11 : 20–11 : 50

Taras Ardan, Libechov, Czech Republic

Investigation of proteolytic enzymes expression in brain tissue and cultivated retinal pigment epithelial cells at transgenic animal model of Huntington´s disease

11 : 50–12 : 20

Tereza Tykalova, Prague, Czech Republic

Grunting in genetically modified minipig animal model for Huntington’s disease –⁠ pilot experiments

12 : 20–12 : 50

Kruft, SCIEX, Germany

Digital quantitative image of any proteomic sample in the MS2 space: advances in data-independent LC/MS/MS acquisition strategies

12 : 50–14 : 00

Lunch

Session VI

Comparative studies of Huntington’s disease

Chair: Lars Eide

14 : 00–14 : 30

Georgina Askeland, Oslo, Norway

Assessment of mitochondrial DNA damage in affected and peripheral tissue in Huntington´s disease and exploring the role of stem cell origin

14 : 30–15 : 00

Hana Hansikova, Prague, Czech Republic

Mitochondrial alterations in tissues with high energetic demand in minipig model transgenic for N -⁠ terminal part of human mutated huntingtin

Session VII

DNA repair in Huntington’s disease models

Chair: Marian Hruska-Plochan

15 : 00–15 : 30

Arne Klungland, Oslo, Norway

DNA stability and Huntington’s disease

15 : 30–16 : 00

Petr Solc, Libechov, Czech Republic

Double strand DNA breaks response in Huntington´s disease

16 : 00–17 : 00

Discussion Forum

Discussion leaders: Douglas Macdonald and Ralf Reilmann

Closing remarks: Jan Motlik

Coffee break

A01 Liv­ing with Huntington’s disease in the Czech Republic

Baxa M

Laboratory of Cel­l Regeneration and Plasticity, Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

Key words: Czech Huntington As­sociation –⁠ life with Huntington’s disease

It is estimated that 700 –⁠ 1,000 patients with Huntington’s disease (HD) and 4 –⁠ 5 times more people at risk live in the Czech Republic. As a rare disease in our country, HD is “unknown” for general public. Unfamiliarity and lack of understand­ing of HD, together with the hunger for help to HD families, lead to the foundation of the Czech Huntington As­sociation (CzHA). CzHA provides support for patients with HD, people at risk and also for caregivers. Patients, their family relatives and friends welcome the recondition ‑⁠ educational weekend stays. These stays of­fer the pos­sibility of tutorial discus­sions with neurologists, psychologists, psychiatrists, physiotherapists, ergotherapists and genetics specialized for HD. Persons at risk solve the question of genetic test­ing and preimplantation genetic dia­gnosis. Caregivers, who mainly are the family members of HD patient/ s and often bear burdensomenes­s of HD aspects for several years, need not only educational lectures about the care for HD patients, but also welcome the psychological support and practic­ing of relaxation techniques. Periodical bul­letin Archa brings the information about social and health care, and also about news in HD research field. Moreover, CzHA have published several brochures about liv­ing with HD. CzHA in col­laboration with HD medical specialists train the person­nel of residential facilities in specific aspects of car­ing for HD patients. CzHA presents a case of HD patients on meetings with health insurance companies and Ministry of Health of the Czech Republic. CzHA solves also problems of individuals eg. pos­sibilities to obtain financial support for provid­ing of health facilities and rehabilitations or problems with homeles­snes­s of HD patients. CzHA is member of international HD as­sociations (International Huntington As­sociation, European Huntington As­sociation, European Huntington’s Disease Network), EURODIS –⁠ Rare Diseases Europe and also Czech as­sociations focused on support­ing of disabled people. Since 2008, CzHA col­laborates with Institute of Animal Physiology and Genetics (IAPG) in Libechov, Czech Republic. IAPG informs patients and their families about news in HD research field in plain language either on meetings or in bul­letin Archa. CzHA aims to participate on generation of residential facility specialized for HD patients, fights against discrimination of the people at risk and aims to participate on HD research in col­laboration with European Huntington’s Disease Network. Despite of a huge CzHA’s support, situation of HD com­munity in Czech Republic –⁠ would stil­l need a change. Exclud­ing the ef­forts to improve the quality of life of HD patients and their families, CzHA would like to improve also awarenes­s and knowledge about HD in Czech society.

A02 A strategy for the identification of translatable HTT lower­ing bio­markers

Macdonald D

CHDI Management/CHDI Foundation, Los Angeles, USA

Key words: Huntington’s disease –⁠ bio­marker –⁠ cerebrospinal fluid (CSF) –⁠ HTT lowering –⁠ HTT quantification –⁠ PET imaging

Huntington protein (HTT) lower­ing is a key therapeutic strategy for Huntington’s disease (HD). Reduc­ing the amount of the disease ‑⁠ caus­ing expanded HTT protein in the brain of patients is predicted to slow the progres­sion of the disease. Several approaches are be­ing employed to lower HTT includ­ing antisense oligonucleotides and siRNAs, as wel­l as gene therapy approaches us­ing viral delivery of miRNAs, shRNAs, and zinc ‑⁠ finger repres­sor proteins. To enable the advancement of such therapeutics to the clinic, translatable proteomic, imaging, and physiological HTT lower­ing pharmacodynamic bio­markers are be­ing explored us­ing preclinical models of HD. We seek to identify and validate outcome measures that indicate that the delivery of a HTT lower­ing therapy does, in fact, lower the amount of HTT protein in the brains of HD patients.

A03 Olesoxime inhibits the formation of mutant huntingtin fragments through suppres­sion of calpain activation and improves behavior and neuropathology in the BACHD rat

Nguyen HP1, Clemens LE1 –⁠ 3, Weber JJ1,2, Wlodkowski TT1,2,4, Yu ‑⁠ Taeger L1,2, Michaud M5, Calaminus C6, Eckert SH7 , Gaca J7,8, Weis­s A9,10, Magg JC1,2, Jans­son EK1,2, Eckert GP7, Pichler BJ6, Bordet T5,11, Prus­s RM5, Ries­s O1,2

1Institute of Medical Genetics and Applied Genomics, Centre for Rare Diseases, University of Tuebingen, Germany

2Centre for Rare Diseases, University of Tuebingen, Germany

3QPS Austria, Research and Development, Austria

4Pediatric Nephrology Division, Heidelberg University Hospital, Heidelberg, Germany

5Trophos SA, Marseil­le Cedex, France

6Werner Siemens Imag­ing Center, Department of Preclinical Imag­ing and Radiopharmacy, University of Tuebingen, Germany

7Department of Pharmacology, Goethe University Frankfurt am Main, Germany

8Merz Pharmaceuticals, Frankfurt am Main, Germany

9Novartis Institutes for BioMedical Research, Basel, Switzerland

10Evotec AG, Hamburg, Germany

11Biotherapies Institute for Rare Diseases, AFM Téléthon, Evry, France

Huntington’s disease is a fatal human neurodegenerative disorder caused by a CAG repeat expansion in the HTT gene, which translates into a mutant huntingtin protein. A key event in the molecular pathogenesis of Huntington’s disease is the proteolytic cleavage of mutant huntingtin, lead­ing to the accumulation of toxic protein fragments. Mutant huntingtin cleavage has been linked to the overactivation of proteases due to mitochondrial dysfunction and calcium derangements. Here, we investigated the therapeutic potential of olesoxime, a mitochondria ‑⁠ targeting, neuroprotective compound, in the BACHD rat model of Huntington’s disease. BACHD rats were treated with olesoxime via the food for 12 months. In vivo analysis covered motor impairments, cognitive deficits, mood disturbances and brain atrophy. Ex vivo analyses addres­sed olesoxime’s ef­fect on mutant huntingtin aggregation and cleavage, as wel­l as brain mitochondria function. Olesoxime improved cognitive and psychiatric phenotypes, and ameliorated cortical thin­n­ing in the BACHD rat. The treatment reduced cerebral mutant huntingtin aggregates and nuclear accumulation. Further analysis revealed a cortex ‑⁠ specific overactivation of calpain in untreated BACHD rats. Treated BACHD rats instead showed significantly reduced levels of mutant huntingtin fragments due to the suppres­sion of calpain‑mediated cleavage. In addition, olesoxime reduced the amount of mutant huntingtin fragments as­sociated with mitochondria, restored a respiration deficit, and enhanced the expres­sion of fusion and outer ‑⁠ membrane transport proteins. In conclusion, we discovered the calpain proteolytic system, a key player in Huntington’s disease and other neurodegenerative disorders, as a target of olesoxime. Our findings suggest that olesoxime exerts its beneficial ef­fects by improv­ing mitochondrial function, which results in reduced calpain activation. The observed al­leviation of behavioral and neuropathological phenotypes encourages further investigations on the use of olesoxime as a therapeutic for Huntington’s disease.

A04 Transgenic rat models for polyglutamine diseases

YuTaeger L, Kelp A, Ries­s O, Nguyen HP

Institute of Medical Genetics and Applied Genomics, Centre for Rare Diseases, University of Tuebingen, Germany

Centre for Rare Diseases, University of Tuebingen, Germany

Key words: polyglutamine diseases –⁠ huntingtin –⁠ CAG repeats –⁠ transgenic rat model

Polyglutamine (polyQ) diseases are a group of genetic neurodegenerative disorders caused by a trinucleotide CAG repeat expansion in protein‑cod­ing regions of specific genes. To date, nine polyQ disorders have been described: Huntington’s disease (HD), spinocerebel­lar ataxia (SCA) type 1, 2, 3, 6, 7 and 17, dentatorubropal­lidoluysian atrophy, and spinobulbar muscular atrophy. Know­ing the single genetic cause of each disorder al­lows us to develop models that recapitulate many aspects of human disease. Rat models have made substantial contributions to our understand­ing of bio­logical function and behavior, due to excel­lent learn­ing abilities and relatively larger brain size compared to other smal­l animal models. In our laboratory, we generated transgenic rats for HD (BACHD rats) and SCA17 (TBPQ64 rats).

HD is caused by an expansion of CAG repeats in gene huntingtin (HTT), characterized by motor, cognitive, and psychiatric deficits as wel­l as neurodegeneration and brain atrophy begin­n­ing in the striatum and the cortex and extend­ing to other subcortical brain regions. BACHD transgenic rats were generated us­ing a human bacterial artificial chromosome (BAC), which contains the ful­l ‑⁠ length HTT genomic sequence with 97 CAG/ CAA repeats and al­l regulatory elements. These rats display a robust, early onset and progres­sive HD‑like phenotype includ­ing motor deficits and anxiety‑related symp­toms. Neuropathological­ly, the distribution of neuropil aggregates and nuclear accumulation of N‑terminal mutant huntingtin in BACHD rats is similar to the observations in human HD brains. In addition, reduced dopamine receptor bind­ing and fractional anisotropy (FA) were detectable by in vivo imaging.

SCA17 is caused by an expansion of CAG repeats in the gene cod­ing for TATA ‑⁠ box‑bind­ing protein (TBP), characterized by ataxia, dystonia, and seizures, dementia, psychiatric and extrapyramidal features as wel­l as mild sensorimotor axonal neuropathy and cerebral and cerebel­lar atrophy. TBPQ64 rats car­ry­ing a ful­l human cDNA fragment of the TBP gene with 64 CAA/ CAG repeats show a severe neurological phenotype includ­ing ataxia, impairment of postural reflexes, and hyperactivity in early stages fol­lowed by reduced activity, los­s of body weight, and early death. The severe phenotype of SCA17 rats was as­sociated with neuronal los­s, particularly in the cerebel­lum. Degeneration of Purkinje, basket, and stel­late cel­ls, as wel­l as changes in the morphology of the dendrites, nuclear TBP ‑⁠ positive im­munoreactivity, and axonal torpedos were found by light and electron microscopy.

A05 Pig models for monogenic diseases – how to make use of diverse gene target­ing approaches for modify­ing the porcine genome

Klymiuk N

Molecular Animal Breed­ing and Biotechnology, Ludwig Maximilian University of Munich, Germeny

Key words: somatic cel­l nuclear transfer –⁠ BAC ‑⁠ vector –⁠ animal models

Mouse models are standard tools for evaluat­ing genetical­ly inherited diseases, but for many of those it appeared that mutat­ing the orthologous gene in the mouse does often not result in a phenotype that is comparable to that of human patients, either in the severity of the disease or in the pathogenesis or both. Even if mutations af­fect amino acid positions that are conserved between human and mouse, the result is often discouraging. Thus, it has been clear for a long time that alternative animal models are strongly demanded, but until recently, such models were dependent on the presence of spontaneously occur­r­ing mutations. With the development of somatic cel­l nuclear transfer (SCNT), however, a powerful tool became available that al­lowed the usage of genetical­ly modified primary cel­ls for generat­ing animal models in species where embryonic stem cel­ls were not available. First such models have been established by us­ing additive gene transfer, but optimal monogenic disease models would definitely require a site ‑⁠ directed mutagenesis in primary cel­ls. This turned out to be much more dif­ficult for pig primary cel­ls than for embryonic stem cel­ls that are available for mouse our human.

Because conventional DNA‑based vectors contain­ing a few kb of homology to the target region were only ef­ficient in single experiments, dif­ferent groups were aim­ing at improv­ing the rate of homologous recombination. While some researchers made use of AAV‑based vectors, we focused on the usage of BAC ‑⁠ vectors for achiev­ing the desired modifications, fol­low­ing the simple idea that extend­ing the regions of homology to 100 –⁠ 200 kb would also increase interaction of genomic DNA with the exogenous vector. This was first succes­sful­ly demonstrated by modify­ing the porcine CFTR gene for produc­ing a model for cystic fibrosis as wel­l as for the porcine DMD gene for generat­ing a pig with Duchen­ne Muscular Dystrophy. Both models readily revealed a phenotype that was much more similar to that seen in human patients than the numerous mouse models are. By us­ing this BAC‑based approach we were not only able to modify the CFTR and DMD loci in dif­ferent primary cel­ls lines of both sexes, but we modified also other genomic regions in the pig genome, such as GGTA1 or POU5F1, albeit in a context that is not related to monogenic disease research.

BAC‑based approaches were suf­ficient for introduc­ing genetic modifications in porcine cel­l clones, but it became soon apparent that the ef­ficacy was too low to yield cel­l clones with modifications on both al­leles at a considerable rate. Regard­ing the relatively long generation time of pigs, this would have been desirable, so we combined BAC vectors as wel­l as conventional vectors with in­novative designer nucleases such as zinc ‑⁠ finger nucleases (ZFN) or CRISPR/ Cas9 and experienced a dramatic increase of homologous recombination up to 95% of al­l examined cel­l clones. We also succeeded in modify­ing gene loci by the combined usage of nuclease & vector in the rare cases we experienced an unsucces­sful attempt with the BAC vectors alone. In addition, we also showed that nucleases alone can be used for delet­ing the function of a gene by introduc­ing frame ‑⁠ shift mutations on both al­leles in a single attempt.

Thus, the presently available tools already al­low the ef­ficient generation of tailored large animal models and future improvements wil­l reveal their potential to introduce even more complex genetic modifications, such as humanization of entire genes.

A06 Preclinical evaluation of AAV5-miHTT gene therapy of Huntington’s disease

Konstantinova P1, Miniarikova J1,2, Blits B1, Zim­mer V3, Spoerl A3, Southwel­l A4, Hayden M4, van Deventer S2, Deglon N3, Motlik J5, Juhas S5, Juhasova J5, Richard Ch1, Petry H1

1Department of Research and Development, uniQure Biopharma B.V., Amsterdam, The Netherlands

2Department of Gastroenterology and Hepatology, Leiden University Medical Center, Leiden, The Netherlands

3Laboratory of Cel­lular and Molecular Neurotherapies, Lausan­ne University Hospital, Lausan­ne, Switzerland

4Centre for Molecular Medicine and Therapeutics, University of British Columbia, Vancouver, Canada

5Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

Key words: Huntington’s disease –⁠ gene therapy –⁠ AAV5 -⁠ miHTT –⁠ minipigs

Gene therapy is one of the most advanced approaches investigated for the treatment of Huntington’s disease (HD). The most upstream therapeutic target in HD is the mutated huntingtin (HTT) and the goal is gene silenc­ing with therapeutic miRNAs (miHTT) delivered with adeno‑as­sociated viral vector (AAV). Two major approaches have been undertaken for the development of RNAi‑based gene therapy of HD: total HTT silenc­ing by target­ing exon 1 and al­lele ‑⁠ specific inhibition by target­ing heterozygous SNPs linked to the mutant HTT. SNP rs362331 in exon 50 and SNP rs362307 in exon 67 were selected as they have the highest prevalence of heterozygosity in HD. The most ef­ficient miHTT candidates were incorporated in AAV5 vectors and produced us­ing the established uniQure baculovirus‑based manufactur­ing platform. Proof of concept studies have shown ef­ficacy of AAV5 -⁠ miHTT in the lentiviral­ly ‑⁠ derived HD rat model and the humanized Hu97/ 18 mouse model. In both models AAV5 -⁠ miHTT delivery resulted in a lower concentration of the disease ‑⁠ induc­ing HTT protein as­sociated with a delay of neurodegeneration and in reduction of mutant HTT aggregates. Direct intrastriatal delivery of AAV5 -⁠ GFP by convection ‑⁠ enhanced dif­fusion (CED) injection or cerebrospinal fluid (CSF) delivery were evaluated in non‑human primates (NHP) and minipigs to identify the best bio­distribution profile for HD therapy. CED injection resulted in almost complete transduction of the NHP striatum and dif­ferent areas of the cortex. Similarly, intrastriatal transduction of neuronal and glial cel­ls of AAV5 -⁠ GFP was observed in minipig putamen and caudate nucleus. In the minipig cortical areas mainly glial cel­ls were transduced. Further studies in HD minipig model wil­l aim to determine the level of HTT silenc­ing in a large brain animals, the safety of the AAV5-miHTT approach and the long‑term viral persistence. The miHTT proces­s­ing and of­f ‑⁠ target potential wil­l be determined to support the clinical development of the therapeutic candidate. AAV5 -⁠ miHTT provides a huge therapeutic benefit for the HD patients as it wil­l al­low for life ‑⁠ long HTT suppres­sion upon single vector administration.

A07 Experimental model­ing and clinical treatment of amyotrophic lateral sclerosis by spinal graft­ing of human spinal stem cel­ls

Marsala M1, Marsala S1, Juhas S2, Juhasova J2, Miyanohara A3, Johe K4, Motlik J2

1Neuroregeneration Laboratory, Department of Anesthesiology, University of California, San Diego, USA

2Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

3Vector Core Laboratory, University of California, San Diego, USA

4Neuralstem, Inc., Maryland, USA

Key words: rodent model of ALS –⁠ spinal neural precursors grafting –⁠ spinal ‑⁠ segment restricted ALS disease modeling

Twenty percent of familial cases of amyotrophic lateral sclerosis (ALS) are caused by mutations in superoxide dismutase 1 (SOD1) [1,2]. In the 20 years since mutation in SOD1 has been known to be causative of a proportion of inherited ALS, a consensus view has emerged that the mutations cause age ‑⁠ dependent degeneration and death of upper and lower motor neurons from acquisition by mutant SOD1 of one or more toxic properties, not los­s of enzymatic activity [3,4]. Importantly, mutant SOD1 protein expres­sion in microglia and astrocytes significantly drives rapid disease progres­sion [5,6], findings which have led to the conclusion that ALS pathophysiology is non‑cel­l autonomous [3]. There are no ef­fective therapies, but for SOD1 mutant ‑⁠ mediated disease suppres­s­ing synthesis of the mutant product or by improv­ing local neurotrophic and glutamate buf­fer­ing capacity (as achieved by spinal graft­ing of wild type neural precursors) in the local spinal cord milieu has been extensively explored as a pos­sible treatment strategy. Our group, as wel­l as others, have demonstrated a positive treatment ef­fect after spinal lumbar graft­ing of clinical grade human spinal stem cel­ls in rat SOD1 model (G93A) of ALS [7]. The data from the rodent ef­ficacy studies, as wel­l as safety studies, which employed pig model [8] of spinal cel­l graft­ing led to a Phase I safety trial in human ALS patients. The preparation of Phase II/ B is cur­rently in progres­s. One of the limitations of the rodent SOD1G93A model is its aggres­sive nature, which is characterized by a rapid progres­sion from the disease onset to end‑stage. These properties precludes an ef­fective utilization of this model to demonstrate treatment ef­ficacy particularly when a long‑term survival is required to achieve a ful­l therapeutical potential. More specifical­ly, on average 4 –⁠ 6 months (or longer) is required for grafted human spinal stem cel­ls to mature and to acquire the dif­ferentiation phenotype which is consistent with a ful­ly mature and functional CNS tis­sue includ­ing expres­sion of mature neuronal and glial markers such as NSE (neuron ‑⁠ specific enolase), synatophysin and GFAP (glial fibril­lary acidic protein‑astrocyte marker). To addres­s this is­sue we have recently developed a spinal segment(s)-restricted ALS model by overexpres­sion the human mutated SOD1G93A gene in lumbar spinal cord of naïve Sprague ‑⁠ Dawley rat. To achieve that, we have developed a novel technique of subpial AAV9 delivery. This technique, in contrast to intrathecal delivery, leads to a deep parenchymal AAV9 penetration and result­ing transgene expres­sion in the majority of neurons in dorsal and ventral horn of AAV9 -⁠ injected segments. Over ‑⁠ expres­sion of the human mutated SOD1G93A gene in lumbar spinal cord led to a progres­sive deterioration of lower extremity motor function (paraplegia) at periods between 6 –⁠ 12 months after the SOD1G93A gene delivery. The los­s of neurological function cor­responded with over 80% los­s of lumbar A ‑⁠ motoneurons and appearance of misfolded SOD1 protein aggregates throughout the AAV9 -⁠ injected region. Except of lower extremity paralysis, animals display normal upper extremity function, breath­ing and feed­ing behavior. This data demonstrates that this spinal segment(s) -⁠ restricted ALS model may represent an alternative rodent ALS model to study the long‑term engraftment of neural precursors or alternatively can also be used to test gene ‑⁠ silenc­ing and/ or gene editing‑based treatment strategies. In addition to the rodent model, the development of spinal regional ALS model in adult pig is cur­rently in progres­s.

References

  1. Da Cruz S, Cleveland DW. Understand­ing the role of TDP ‑⁠ 43 and FUS/ TLS in ALS and beyond. Cur­r Opin Neurobio­l 2011; 21(6): 904 –⁠ 919. doi: 10.1016/ j.conb.2011.05.029.
  2. Rosen DR, Siddique T, Patterson D, Figlewicz DA, Sapp P, Hentati A et al. Mutations in Cu/ Zn superoxide dismutase gene are as­sociated with familial amyotrophic lateral sclerosis. Nature 1993; 362(3415): 59 –⁠ 62.
  3. Ilieva H, Polymenidou M, Cleveland DW. Non ‑⁠ cel­l autonomous toxicity in neurodegenerative disorders: ALS and beyond. J Cel­l Biol 2009; 187(6): 761 –⁠ 772. doi: 10.1083/ jcb.200908164.
  4. Boil­lee S, Vande Velde C, Cleveland DW. ALS: a disease of motor neurons and their non­neuronal neighbors. Neuron 2006; 52(1): 39 –⁠ 59.
  5. Boil­lee S, Yamanaka K, Lobsiger CS, Copeland NG, Jenkins NA, Kas­siotis G et al. Onset and progres­sion in inherited ALS determined by motor neurons and microglia. Science 2006; 312(5778): 1389 –⁠ 1392.
  6. Yamanaka K, Chun SJ, Boil­lee S, Fujimori ‑⁠ Tonou N, Yamashita H, Gutman­n DH et al. Astrocytes as determinants of disease progres­sion in inherited amyotrophic lateral sclerosis. Nat Neurosci 2008; 11(3): 251 –⁠ 253. doi: 10.1038/ n­n2047.
  7. Hef­feran MP, Galik J, Kakinohana O, Sekerkova G, Santucci C, Marsala S et al. Human neural stem cel­l replacement therapy for amyotrophic lateral sclerosis by spinal transplantation. PLoS One 2012; 7(8): e42614. doi: 10.1371/ journal.pone.0042614.
  8. Usvald D, Vodicka P, Hlucilova J, Prochazka R, Motlik J, Kuchorova K et al. Analy­sis of dos­ing regimen and reproducibility of intraspinal graft­ing of human spinal stem cel­ls in im­munosuppres­sed minipigs. Cel­l Transplant 2010; 19(9): 1103 –⁠ 1122. doi: 10.3727/ 096368910X503406.

A08 Development and validation of brain and spinal cord vector and cel­ldelivery techniques in preclinical minipig models of neurodegenerative disorders

Juhas S1, Juhasova J1, Klima J1, Marsala M2, Marsala S2, Atsushi M3, Johe K4, Motlik J1

1Laboratory of Cel­l Regeneration and Plasticity, Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

2Neurodegeneration Laboratory, Department of Anesthesiology, University of California, San Diego, USA

3Vector Core Laboratory, University of California, San Diego, USA

4Neuralstem, Inc., Maryland, USA

Key words: minipig models of neurodegenerative disorders –⁠ brain and spinal cord cel­l delivery techniques –⁠ subpial and intraparenchymal brain and spinal cord AAV5 and AAV9 vector delivery

The use of large animal models represents an es­sential component in preclinical development of cel­l ‑⁠ replacement and gene ‑⁠ delivery‑based therapies. Over the past decade us­ing a wel­l‑established strain of miniature pigs, we have developed several models of neurodegenerative disorders includ­ing a transgenic model of Huntington’s disease, a chronic spinal cord traumatic injury model, and a model of transient global cerebral ischemia. Us­ing a chronic spinal trauma model and a model of transient global cerebral ischemia, we have extensively tested the FDA ‑⁠ approved spinal and brain cel­l ‑⁠ injection devices and have defined the safety and optimal cel­l dos­ing of human clinical ‑⁠ grade neural precursors to be used in human clinical trials for treatment of ALS and chronic spinal trauma patients. Data from these studies were used in the approved IND applications (Neuralstem, Inc.) with both human clinical trials cur­rently in progres­s. More recently, we have developed a novel technique of subpial AAV9 delivery. This new technique was extensively validated in rats and minipigs and has proven to be superior over the cur­rently employed AAV delivery techniques (intrathecal or intra ‑⁠ ventricular) in terms of more robust parenchymal transgene expres­sion and retrograde infection of supraspinal brain motor and sensory centers. This technique is cur­rently be­ing tested for its ef­ficacy in silenc­ing of the mutated human SOD1 gene in a rat G93A model of ALS. If succes­sful, our future studies wil­l focus on establish­ing large animal (pigs and non‑human primates) safety data to enable prospective use of this vector delivery technique in human ALS and spinal trauma patients.

Acknowledgement: This work was supported by the Operational Program Research and Development for In­novations EXAM; CZ.1.05/ 2.1.00/ 03.0124, Norwegian Financial Mechanism 2009 –⁠ 2014 and the Ministry of Education, Youth and Sports under Project Contract no. MSMT ‑⁠ 28477/ 2014 “HUNTINGTON” 7F14308, CHDI Foundation (A ‑⁠ 5378, A ‑⁠ 8248), Neuralstem, Inc. and RVO: 67985904.

A09 Model­ing ALS on human neurons in vitro

Hruska ‑⁠ Plochan M

Laboratory of Prof. Magdalini, Institute of Molecular Life Sciences, University of Zürich, Switzerland

Key words: amyotrophic lateral sclerosis –⁠ C9ORF72 –⁠ dipeptide repeat proteins (DPRs) –⁠ TDP ‑⁠ 43 –⁠ human iPSC ‑⁠ derived NSCs –⁠ human chemical‑induced neuronal cel­ls (hciNs)

Amyotrophic lateral sclerosis (ALS) is an adult ‑⁠ onset neurodegenerative disease, which af­fects motor neurons lead­ing to progres­sive paralysis and death within a few years from onset. ALS is genetical­ly, pathological­ly and clinical­ly linked to another neurodegenerative disease cal­led frontotemporal dementia (FTD), which is the most com­mon type of dementia below 60 years of age and is characterized by language and behavioral dysfunction. Both disorders are devastat­ing and cause death within a few years from dia­gnosis.

Recently, intronic GGGGCC hexanucleotide expansion in an uncharacterized gene cal­led C9ORF72 was found to be the most com­mon genetic cause of both ALS and FTD confirm­ing the hypothesis that ALS and FTD represent opposite ends of the same disease spectrum. In addition to the typical TDP ‑⁠ 43 -⁠ positive inclusions, C9ORF72 patients also develop inclusions that lack TDP ‑⁠ 43, but contain abnormal dipeptide proteins (DPRs) that are produced by the intronic repeat RNA through an unconventional type of translation, cal­led repeat‑as­sociated non‑ATG (RAN) translation. Moreover, the hexanucleotide repeat RNA forms nuclear foci within neurons and glia of C9ORF72 ALS patients.

Nevertheles­s, vast majority of ALS and FTD cases are sporadic with unknown etiology and therefore dif­ficult to model. Accordingly, until very recently, research has been limited to the use of post‑mortem patient samples. However, the recent advent of reprogram­m­ing technologies al­low us to use acces­sible cel­ls, such as fibroblasts, to generate patient ‑⁠ specific neurons and thus study the mechanisms of sporadic ALS in vitro.

Here we employ iPSC and hciNs (human chemical‑induced neuronal cel­ls) technologies to study both sporadic and C9ORF72‑induced ALS. In addition, human iPSC ‑⁠ derived NSCs stably expres­s­ing DPRs were developed to dis­sect the pathogenic mechanisms of C9ORF72 mediated ALS/ FTD.

A10 Antibodybased investigational approaches in neuroproteomics and neurodegenerative diseases

Gadher SJ1, Kovarova H2,3

1Life Science Solutions Group, Thermo Fisher Scientific, Frederick, USA

2Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

3Research Center PIGMOD, Libechov, Czech Republic

Key words: neurodegeneration –⁠ disease models –⁠ multiplexing –⁠ antibodies –⁠ bio­marker(s) –⁠ tau protein

Neurodegenerative diseases are devastat­ing and af­fect mil­lions of individuals worldwide. Unfortunately, no drugs are cur­rently available to halt their progres­sion, except a few that are largely inadequate. Genetic as wel­l as environmental factors have been shown to be as­sociated with neurological disorders and trigger many molecular and cel­lular alterations lead­ing to progres­sive los­s of neural cel­ls and neurodegeneration. The advances in develop­ing ef­fective disease ‑⁠ modify­ing drugs as wel­l as diseases bio­marker(s) identification critical­ly depend on understand­ing of the mechanisms of disease pathogenesis at molecular level.

The recent advances in proteomics and proteomic related technologies could significantly contribute to reveal­ing the under­­-ly­ing molecular mechanisms as wel­l as in the identification of novel bio­marker(s) suitable for use in (pre)clinical trials for such neurodegenerative diseases. An ideal bio­marker(s) would al­low the mapp­ing of mechanisms of action and its quantification could reflect treatment intervention in disease models and particularly in patients. Such bio­marker(s) could come from measurements of analytes in serum, plasma or cerebrospinal fluid and may fulfil­l the criteria for a high throughput, high sensitivity and yet a low cost as­say for the disease.

A number of methodologies includ­ing antibody independent targeted mas­s spectrometry quantification, enzyme‑linked im­munosorbent as­say (ELISA), as wel­l as Luminex xMAP ‘bead‑based’ multiplex­ing technology are be­ing utilised in develop­ing new as­says for monitor­ing of disease progres­sion and novel therapeutic interventions or strategies. Here, we give examples of: 1. a quest for candidate bio­markers for Huntington’s disease, 2. neural stem cel­l research with a view to cel­l replacement therapies as a promis­ing strategy for neurodegenerative diseases, and 3. recently launched neuro panel with a selection of capture antibodies to facilitate measurements of Aβ levels; includ­ing Aβ1 -⁠ 40 and Aβ1 -⁠ 42 and total tau protein in various bio­logical fluids.

Antibody‑based investigational approaches can be powerful in facilitat­ing ‘cutting ‑⁠ edge’ research in specialist areas of neuro‑proteomics, stem cel­l research and bio­marker discovery for neurodegenerative diseases.

A11 Reduction of IFNα and IL10 in central nervous system and increase in peripheral IL8 in transgenic porcine Huntington’s disease model

Kovarova H1, Valekova I2, Jarkovska K2, Kotrcova E2, Motlik J2, Gadher SJ3

1Laboratory of Applied Proteome Analyses and Research Center PIGMOD, Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

2Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

3Life Science Solutions Group, Thermo Fisher Scientific, Frederick, USA

Key words: porcine Huntington’s disease model –⁠ IFNα –⁠ IL‑10 –⁠ IL‑8 –⁠ multiplexing –⁠ cerebrospinal fluid –⁠ microglial cel­ls

Huntington’s disease (HD) is an inherited neurodegenerative disorder which is progres­sive and fatal. Any preventive or disease ‑⁠ modify­ing therapies are not available as yet. Although the pivotal role of neuroinflam­mation and activation of im­mune response is proven in mutant huntingtin (mtHtt) car­riers, further studies are needed on in­nate and adaptive im­mune responses to mtHtt in both central nervous system (CNS) and peripheral system and their intercon­nectivity Additional­ly, cerebrospinal fluid (CSF) and blood plasma/ serum appear to be a promis­ing source of potential bio­markers for monitor­ing HD progres­sion and ef­ficacy of novel therapeutic strategies.

In our study we utilised a novel transgenic TgHD porcine model to investigate inflam­matory and im­mune responses us­ing bead based multiplex­ing Luminex xMAP technology. Among the most pronounced changes was the decline of IFNα in CSF of TG animals and this was observed from very early time intervals of HD. IFNα was also decreased in secretome of microglial cel­ls but not blood monocyte in TgHD animals. In addition, IL‑10 was lower in CSF as wel­l as microglia secretome. On the contrary, elevated levels of pro‑inflam­matory IL‑1β and IL‑8 were produced by microglial cel­ls of TgHD animals. Compared to several cytokine alterations observed in representative parts of CNS, only IL‑8 was elevated in peripheral system in serum of TgHD minipigs. We further demonstrated higher proportion of the mtHtt related to endogenous Htt in microglial cel­ls compared to blood monocytes in transgenic minipigs which may have a causative impact on cytokine production.

Observed dysregulation of cytokine profiles indicated neuroinflam­mation and pos­sible lack of adaptive im­mune response in CNS whilst sign of inflam­mation was detected in peripheral system in TgHD porcine model. We revealed emerg­ing role of IFNα and IL‑10 in central nervous system inflam­mation and im­mune response imbalance in HD progres­sion.

Acknowledgements: This work was supported by the Operational Program Research and Development for In­novations (EXAM; CZ.1.05/ 2.1.00/ 03.0124) and Institutional Research Concept RVO67985904 (IAPG, AS CR, v.v.i). Thermo Fisher Scientific partnered this study to further evaluate the Swine Cytokine Magnetic 7 -⁠ plex Panel (Invitrogen TM LSC0001M, Thermo Fisher Scientific Inc., formal­ly LSC0001 from Life Technologies) as wel­l as provided statistical analysis support includ­ing the algorithm used in this study for data evaluation.

A12 Phenotype development in TgHD minipigs

El­lederova Z1, Vidinska D1,2, Macakova M1,2, Kucerova S2, Bohuslavova B1,2, Sedlackova M3, Liskova I1,4, Valekova I1,2, Baxa M1,2, Ardan T1, Juhas S1, Motlik J1

1Laboratory of Cel­l Regeneration and Plasticity, Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

2Department of Cel­l Biology, Faculty of Science, Charles University in Prague, Czech Republic

3Department of Histology and Embryology, Faculty of Medicine, Masaryk University in Brno, Czech Republic

4Department of Neurology and Centre of Clinical Neuroscience, 1st Faculty of Medicine, Charles University in Prague, Czech Republic

Key words: phenotype –⁠ minipig model of Huntington’s disease –⁠ reproductive failure –⁠ aggregates –⁠ phosphorylation –⁠ N‑terminal fragments –⁠ motoric and behavioural impairment

In July 2009, the first transgenic minipig expres­s­ing N terminal part of human huntingtin (TgHD) was born. The transgenic minipig model was generated us­ing microinjection of a lentiviral vector.

Mutated human HTT gene with 124 CAG repeats was incorporated into chromosome 1 (1q24 –⁠ q25). Further analysis showed that the insertion of the lentiviral construct did not inter­rupt any cod­ing sequence. In this study, we compared TgHD and wild type (WT) siblings in order to describe the phenotype development of TgHD minipigs.

Even though the neurological phenotype of Huntington’s disease (HD) patients is the most prominent, the first sign of phenotype development in TgHD boars of F1 generation was a reproductive failure, start­ing at the age of 13 months. In further studies, we showed that sperm and testicular degeneration of TgHD boars is caused by gain‑of ‑⁠ function of the highly expres­sed mutated huntingtin (mtHtt) in sperms and testes. Nevertheles­s, the HD is as­sociated with neuronal death and the formation of aggregates in basal ganglia and cerebral cortex. Therefore, we focused on aggregate formation in the brain. Unfortunately im­munohistochemical analysis could detect just a few spots resembl­ing to aggregates in coronal sections of 36 months old TgHD, and none in WT. However, the filter retardation as­say showed retention of higher molecular weight Htt polymeric structures in TgHD brains. Moreover, velocity and equilibrium sedimentation method also revealed mutated huntingtin (mtHtt) in higher insoluble fractions. Interestingly, mtHtt in higher insoluble fractions was not phosphorylated on Ser13 and 16. This is in accordance with published data that unphosphorylated rather than phosphorylated huntingtin on Ser 13, 16 tents to form aggregates.

Since previous studies showed that even neurons without aggregates undergo degeneration and death, we focused on the presence of N‑terminal fragments. We screened several tis­sues for fragmentation, and found the most in cortex, and brain of TgHD minipigs.

Moreover, we performed behavioral and motoric tests of F0, and F1 generation of TgHD. Mainly the five years old boars show wobbly movements of their back legs, giv­ing us hints of HD manifestation in transgenic minipigs around five years of age.

Acknowledgement: This work was supported by the Operational Program Research and Development for In­novations (EXAM; CZ.1.05/ 2.1.00/ 03.0124), Norwegian Financial Mechanism 2009 –⁠ 2014 and the Ministry of Education, Youth and Sports under Project Contract no. MSMT ‑⁠ 28477/ 2014 “HUNTINGTON” 7F14308 CHDI Foundation (A ‑⁠ 8248, A ‑⁠ 5378) and RVO: 67985904.

A13 The TgHD minipig on the road to preclinical studies – cur­rent state of the art in behavioral and MR imag­ing as­ses­sments

Reilman­n R

GeorgeHuntingtonInstitute, Muenster, Germany

Department of Clinical Radiology, University of Muenster, Germany

Department of Neurodegenerative Diseases and HertieInstitute for Clinical Brain Research, University of Tuebingen, Germany

Key words: animal models –⁠ minipig –⁠ Huntington’s disease –⁠ pheno-typing –⁠ magnetic resonance imaging –⁠ imaging –⁠ behavioral –⁠ preclinical research

The TgHD minipig may fil­l an important gap in translational preclinical research between rodents and humans. The model can already be applied for studies target­ing delivery or distribution of therapeutics. In addition, studies target­ing proof ‑⁠ of ‑⁠ concept of certain mechanisms ‑⁠ of ‑⁠ action are pos­sible. Lower­ing of mHTT expres­sion, for instance, could be investigated with repetitive in vivo acces­s to bio­specimen in CSF, blood and tis­sue samples. For further translational research the availability of sensitive and meaningful phenotypical as­ses­sments is war­ranted. The presentation wil­l review the cur­rent status of development of a battery of as­ses­sments that have been developed in the sett­ing of the “TRACK ‑⁠ TgHD ‑⁠ Minipig” study. The study fol­lows a cohort of TgHD and wild type minipigs with repetitive as­ses­sments includ­ing behavioral, motor, cognitive, and a variety of magnetic resonance imag­ing (MRI) endpoints. Motor as­ses­sments include the GAITRite gait analysis, a hurdle test, and a tongue coordination test. A color discrimination test was established to test cognitive function and a dominance test is applied to as­ses­s social hierarchy. Imag­ing modalities established al­low volumetric analyses, fiber track­ing and in vivo measurement of metabolites us­ing MRI spectroscopy. Tools needed to further improve reliable imag­ing analyses such as a brain atlas for the Libechov minipig are in development and closed to finalization. The cur­rent state of development al­lows us to conclude that behavioral and imag­ing as­ses­sments of TgHD minipigs are feasible and can reliably be conducted repetitively in the sett­ing of a longitudinal fol­low‑up study. As the “TRACK ‑⁠ TgHD ‑⁠ Minipig” study has a “dynamic” protocol, tests may be revised in future as­ses­sments to al­low for further learn­ing as the study progres­ses. The translation to preclinical studies us­ing the model is in progres­s and examples for applications of the model cur­rently considered wil­l be discus­sed same as further perspectives for applications of the as­ses­sments, e. g., in HD knock ‑⁠ in minipigs.

Acknowledgement: The “TRACK ‑⁠ TgHD ‑⁠ Minipig” study is funded by the CHDI Foundation.

A14 Investigation of proteolytic enzymes expres­sion in brain tis­sue and cultivated retinal pigment epithelial cel­ls at transgenic animal model of Huntington’s disease

Ardan T, Kocurova G, Motlik J

Laboraty of Cel­l Regeneration and Plasticity, Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

Key words: Huntington’s disease –⁠ transgenic porcine model –⁠ pro­teolytic enzymes

One of the key mechanisms in the pathogenesis of Huntington’s disease (HD) is a proteolysis of mutant huntingtin (mtHtt). Previous studies revealed that smal­l proteolytic fragments derived from mtHtt have particular cytotoxic characteristics. These fragments are highly toxic to neurons, which are located in the striatum and cortex, and inhibition of proteolysis of mtHtt significantly reduces neurotoxicity. Therefore, proteolytic cleavage as a source of these breakdown products was considered as an early or initial step in HD pathogenesis. In this study, we investigated the expres­sion of proteolytic enzymes from the families of caspases, matrix metal­loproteinases (M­mPs), kal­likreins and calpains on the transgenic minipig model of HD. For al­l investigations, we used WT and TgHD minipigs for N‑terminal part of the human mtHtt (548aaHTT ‑⁠ 145Q, both F2 generation, age 36 months; F3 generation, age 48 months in additional experiment), in some cases R6/ 2 mice were used as positive controls. Htt and proteases were examined im­munohistochemical­ly (IHC) and by im­munofluorescence (IF) on cryostat sections, or bio­chemical­ly by Western blott­ing (WB) us­ing the fol­low­ing primary antibodies: anti‑caspase ‑⁠ 3, anti‑caspase ‑⁠ 8, anti‑M­mP ‑⁠ 9, anti‑M­mP ‑⁠ 10, anti‑kal­likrein‑10, anti‑calpain‑5. Us­ing IHC and WB, we demonstrated significantly increased expres­sion of caspase ‑⁠ 3 in nucleus caudatus and cortex area of TgHD minipigs in comparison to WT animals. M­mP ‑⁠ 10 expres­sion was detected im­munohistochemical­ly in al­l brain structures of both WT and TgHD pigs, when the mildly increased expres­sion was seen in the caudate nucleus of TgHD minipig. Increased M­mP ‑⁠ 9 expres­sion was detected im­munohistochemicaly in the striatum and cortex of TgHD minipig, and also bio­chemical­ly were showed increased levels of proces­sed forms of M­mP ‑⁠ 9 in cortex and cerebel­lum of TgHD minipig. Likewise, elevated levels of M­mP ‑⁠ 9 were observed by IF in retinal pigment epithelial cel­ls (RPE) of TgHD minipig (48m). Calpain‑5 was highly expres­sed in the striatum and cortex of TgHD and WT animals without dif­ferences between them. Even if the most proteolytic enzymes revealed the same or increased expres­sions in TgHD brains, the decreased expres­sion of kal­likrein‑10 was detected in these brains in comparison to WT brains. In conclusion, we suggest that high levels of proteolytic enzymes detected in TgHD minipig can increase production of mtHtt derived proteolytic fragments and thus contribute to the disease development.

Acknowledgement: This study was supported by CHDI Foundation (A ‑⁠ 5378, A ‑⁠ 8248), the Operational Program Research and Development for In­novations ExAM ‑⁠ CZ.1.05/ 2.1.00/ 03.0124, Norwegian Financial Mechanism 2009 –⁠ 2014 and the Ministry of Education, Youth and Sports under Project Contract no. MSMT ‑⁠ 28477/ 2014 “HUNTINGTON” 7F14308 and RVO: 67985904.

A15 Grunt­ing in genetical­ly modified minipig animal model for Huntington’s disease – a pilot experiments

Tykalova T1, Hlavnicka J2, Macakova M3, Baxa M3, Cmejla R2, Motlik J3, Klempir J4,5, Rusz J2,4

1Czech Technical University in Prague, Czech Republic

2Department of Circuit Theory, Faculty of Electrical Engineering, Czech Technical University in Prague, Czech Republic

3Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

4Department of Neurology and Centre of Clinical Neuroscience, 1st Faculty of Medicine, Charles University in Prague, Czech Republic

5Institute of Anatomy, 1st Faculty of Medicine, Charles University in Prague, Czech Republic

Key words: Huntington’s disease –⁠ grunting –⁠ transgenic pigs –⁠ animal models –⁠ voice and speech disorders

Huntington’s disease (HD) is an autosomal ‑⁠ dominant neurodegenerative disorder characterized by impairment of voluntary and involuntary movements, behavioral disorders and cognitive decline. Besides the main motor symp­toms, voice and speech disorders have been documented in large majority of patients with HD. Slight changes in voice and speech production have also been observed in persons with preclinical stages of HD. The animal model of pigs is often used in preclinical studies. Although there are obvious dif­ferences in anatomy of articulation organs between pigs and humans, the same trends in pathophysiology mechanism can be expected in both grunt­ing and human phonation. The main aim of the study was therefore to design a suitable experiment that would al­low acquisition of a suf­ficiently long record­ing of grunt­ing from as many pigs as pos­sible. The second goal was to perform the final version of experiment in al­l available pigs and to evaluate the amount and quality of gained recordings. The database consists of 17 HD transgenic minipigs and 16 healthy siblings. Tested variants of the experiment, performed on subgroup of 4 sows, were divided into four subgroups: (a) positive –⁠ feeding, (b) positive –⁠ sound stimulation, (c) negative –⁠ hinder­ing in movement, (d) negative –⁠ unpleasant touch. The evaluation of quality of elicited record­ing was performed us­ing audio software where pure pig’s grunt­ing was selected and al­l acoustic artefacts deleted. The best results were reached us­ing experiment where: 1. a record­ing device is put on pig’s body, 2. pig is left alone for few minutes in the pen in order to calm down, and 3. person enters the room and tries to of­fer the pig feed while reversing. As a result, pig fol­lows the person and grunts. Notably, it is useful to perform experiment with hungry pigs (omitt­ing two feed­ing doses). Suf­ficiently long (20 single grunts or more) and clear recordings were received from 24 out of 33 pigs (73%). Our experiment is designed to be applicable to both genders and various ages and thus might be succes­sful­ly used for gain­ing of pig grunt­ing in future research focused on longitudinal investigation of pos­sible disturbances in pigs’ vocalization due to the HD.

Acknowledgement: The study was supported by the Czech Science Foundation (GACR 102/ 12/ 2230), Czech Technical University in Prague (SGS 15/ 199/ OHK3/ 3T/ 13) and Charles University in Prague (PRVOUK ‑⁠ P26/ LF1/ 4). This work was also supported by Program Research and Development for In­novation Ministry of Education, Youth and Sports ExAM CZ.1.05/ 2.1.00/ 03.0124.

A16 Digital quantitative image of any proteomic sample in the MS2 space: advances in dataindependent LC/MS/MS acquisition strategies

Kruft V

SCIEX, Darmstadt, Germany

Recent advances in high resolution mas­s spectrometry, specifical­ly QqTOF technology, have made it pos­sible to acquire qualitative and quantitative information simultaneously from highly complex samples. The extreme speed and sensitivity of cur­rent instrumentation al­lows near complete analysis in information dependent (IDA) experiments. However, the concept of data independent acquisition (DIA) can now also be realistical­ly applied for the first time. This wil­l avoid the bias introduced by precursor selection and thus increase the reproducibility and comprehensivenes­s of data col­lection. In this data independent workflow –⁠ cal­led MS/ MSAL­L with SWATH™ acquisition –⁠ the Q1 quadrupole is stepped at defined mas­s increments acros­s the mas­s range of interest, for example pas­s­ing a 25 amu window into the col­lision cel­l independent of the number of precursors. Fragments –⁠ so cal­led product ions –⁠ are analyzed in the TOF MS analyzer at high resolution. Due to the high speed of the QqTOF, these experiments can be done in a looped fashion at a cycle time compatible with LC separations. Post‑acquisition MRM‑like analysis can be performed on such datasets by the generation of large numbers of high resolution XIC’s. These are identified and quantified by comparison to the available proteomic or MRM spectral databases.

Recent developments of the data ‑⁠ independent SWATH™ workflow wil­l be explained and compared to other quantitative techniques in systems bio­logy like quantification via SRM/ MRM. These include the introduction of variable window sizes and increas­ing the number of program­mable windows to add even more selectivity to the workflow –⁠ as wel­l as the automatic removal of interferences, a SWATH™ specific feature that further increases the specificity and accuracy of the quantitative results. Final­ly, the OneOMICS™ cloud environment, that al­lows fast data proces­s­ing and comparison of proteomics data with genomic and metabolomic datasets in the public domain, wil­l be introduced.

Recently published investigations wil­l be highlighted, includ­ing studies of kidney disease, histone modifications and the proteome of M. tubercolosis.

A17 As­ses­sment of mitochondrial DNA damage in af­fected and peripheral tis­sue in Huntington’s disease – pos­sible role of stem cel­l origin

Askeland G1, Eide L1, Klungland A2, Nes­se G2

1Department of Medical Biochemistry, Faculty of Medicine, Rikshospitalet, University of Oslo, Norway

2Department of Microbio­logy, Oslo University Hospital, Norway

Key words: Huntington’s disease –⁠ mitochondria –⁠ DNA damage –minipigs

Huntington’s disease (HD) is invariably coupled to DNA stability. Repair of nuclear DNA (nDNA) damage as wel­l as prevention of mitochondrial DNA (mtDNA) damage determines disease progres­sion in HD mouse models. Thus, DNA damage represents a potential dia­gnostic marker for monitor­ing disease and as­ses­s­ing therapy. However, af­fected tis­sue is not easily acces­sible and it is enigmatic how DNA integrity in the periphery cor­relates with that in af­fected tis­sue.

The aim of the cur­rent project is to identify bio­markers in easily acces­sible tis­sue that can be used to monitor disease. Us­ing in‑house established and published methods, we compared the integrity of nDNA and mtDNA in various tis­sues from the TgHD pig model with those obtained from HD patients and match­ing controls. The results demonstrate strong tis­sue ‑⁠ specific dif­ferences in mtDNA and nDNA integrity in the TgHD pig model, while no ef­fects were identified in pig leukocytes. In contrast, samples from human patients demonstrate significant dif­ferences in mtDNA as wel­l as nDNA integrity in leukocytes. A strong cor­relation was also seen between nDNA damage and copy number in pig leukocytes and spleen.

We are cur­rently us­ing the same material to evaluate how DNA integrity cor­relates with nuclear CAG somatic expansions and mitochondrial function. The impact of HD on peripheral tis­sue suggests that genotoxicity is not limited to af­fected areas, but may as wel­l be influenc­ing neurogenesis important for repopulation in the striatal region. We wil­l test the idea that systemic (mt)DNA damage and the subsequent repair impairs CAG triplet stability in neural stem cel­ls.

Acknowledgement: This work was supported by the Norwegian Financial Mechanism 2009 –⁠ 2014 and the Ministry of Education, Youth and Sports under Project Contract no. MSMT ‑⁠ 28477/ 2014 “HUNTINGTON” 7F14308.

A18 Mitochondrial alterations in tis­sues with high energetic demand in minipig model transgenic for Nterminal part of human mutated huntingtin

Hansikova H1, Spacilova J1, Kratochvilova H1, Ondruskova N1, Rodinova M1, Juhas S2, Juhasova J2, El­lederova Z2, Motlik J2, Zeman J1 

1Department of Pediatrics and Adolescent Medicine, 1st Faculty of Medicine, Charles University and General University Hospital in Prague, Czech Republic

2Laboratory of Cel­l Regeneration and Plasticity, Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

Key words: mitochondria –⁠ respiratory chain –⁠ transgenic minipig model

Huntington’s disease (HD) is neurodegenerative disorder caused by an abnormal expansion of CAG repeat encod­ing a polyglutamine tract of huntingtin (Htt). It has been postulated that mitochondria dysfunction and oxidative stres­s may play significant roles in the aetiology of the HD. Given the ubiquitous expres­sion of Htt, al­l cel­l type with high energetic demand may be at risk for HD related dysfunction.

The aim of the present work was phenotypic monitor­ing of the mitochondrial functions and the detection of mitochondrial dysfunctions in tis­sues with high energetic demand in transgenic minipigs (TgHD) of F2 generation dur­ing 12 –⁠ 48 months of life.

Respiratory chain complexes (RCC), Krebs cycle enzyme, pyruvate dehydrogenase (PDH) activity and amount were analyzed by spectrophotometric, radioisotope and imunoelectrophoretic methods in TgHD minipig brain, heart and muscle homogenate and isolated mitochondria. Respiration was measured by polarography. Mitochondrial energy generat­ing system capacity was characterized by oxidation rate of label­led substrates.

Decreased activity of complex I of RCC and PDH in TgHD frontal cortex was found in the age of 36 -⁠ month ‑⁠ old contrary to 24 -⁠ month ‑⁠ old animals. Amount of nutrient and stres­s sensor O ‑⁠ GlcNAcase was decreased in heart homogenates of in the age of 36 -⁠ month ‑⁠ old TgHD minipigs. Although respiration of skeletal muscle mitochondria from 36 -⁠ month ‑⁠ old HD minipigs was equal to control values, one year later the respiration after succinate and ascorbate + TMPD addition in 48 -⁠ month ‑⁠ old HD pig’s mitochondria was decreased to about 60% of control values. Furthermore, decreased oxidation of succinate to 60% and lower amount of RCC in 48 -⁠ month ‑⁠ old HD was detected in comparison with WT. Our results indicate for the preclinical signs of HD in the studied tis­sues of TgHD minipigs.

Acknowledgement: Supported by the Norwegian Financial Mechanism 2009 –⁠ 2014 and the Ministry of Education, Youth and Sports under Project Contract no. MSMT ‑⁠ 28477/ 2014 “HUNTINGTON” 7F14308, COST LD15099 (MSMT), Program Research and Development for In­novation Ministry of Education, Youth and Sports ExAM CZ.1.05/ 2.1.00/ 03.0124 and CHDI Foundation (A ‑⁠ 8248).

A19 DNA stability and Huntington’s disease

Klungland A

Department of Microbio­logy, Oslo University Hospital, Norway

Key words: Huntington’s disease –⁠ CAG repeats –⁠ DNA repair

Huntington’s disease (HD) was first described by Johan C. Lund and Georg Huntington dur­ing the late 19th century. One of the major breakthroughs in the understand­ing of HD came with the identification of a gene contain­ing a trinucleotide repeat that is expanded and unstable in the patients (The Huntington’s disease col­laborative research group, Cel­l 1993; 72 : 971 –⁠ 983). HD is a genetical­ly determined neurodegenerative disorder, for which onset is known to depend upon the length of glutamine ‑⁠ encod­ing CAG ‑⁠ repeat sequences ly­ing within the Huntingtin gene. Recently, dramatic somatic CAG expansions have been detected in diseased human brains and in transgenic HD mice (Ken­nedy et al., Hum Mol Genet 2003; 12 : 3359 –⁠ 3367). Yet, the mechanism of expansion remains poorly understood. We, and others, have identified a surpris­ing role for DNA repair in triplet stability. Oxidative damage has long been as­sociated with age­ing and neurological disease; however, mechanistic con­nections of oxidation to these phenotypes have remained elusive. We have demonstrated that the age ‑⁠ dependent somatic mutation as­sociated with HD in mice occurs in the proces­s of remov­ing oxidized base lesions, and is modulated by the base excision repair enzyme, 7,8 -⁠ dihydro‑8 -⁠ oxoguanine ‑⁠ DNA glycosylase. The presentation wil­l present cur­rent models for somatic CAG instability as analyzed on Huntingtons transgenic mice.

Acknowledgement: This work was supported by the Norwegian Financial Mechanism 2009 –⁠ 2014 and the Ministry of Education, Youth and Sports under Project Contract no. MSMT ‑⁠ 28477/ 2014 “HUNTINGTON” 7F14308.

A20 Double strand DNA breaks response in Huntington’s disease

Solc P1, Valasek J2, Rausova P2, Juhasova J2, Juhas S2, Motlik J2

1Laboratory of DNA Intergrity, Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

2Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

Key words: Huntington’s disease –⁠ DNA damage –⁠ double strand DNA breaks

There are strong evidences that DNA damage response (DDR) signal­ing significantly underline the molecular pathology of polyglutamine (polyQ) diseases, includ­ing Huntington’s disease (HD). Double strand DNA breaks (dsDNA breaks) are the most deleterious DNA lesions. The can arise from own cel­l metabolism produc­ing oxygen free radicals, replicative stres­s or also through transcription. After dsDNA breaks arise in cel­l, histone H2AX is rapidly phosphorylated on Ser ‑⁠ 139 form­ing γ ‑⁠ H2AX. This crucial histone modification is mediated by ATM action, although other members of PI3/ PI4 -⁠ kinase family ATR or DNA ‑⁠ PK can do it as wel­l. It was shown that dsDNA breaks are an early event in HD pathology. In mouse R6/ 2 HD model γ ‑⁠ H2AX is elevated in striatal neurons from 4‑weeks ‑⁠ old mice. Interestingly, γ ‑⁠ H2AX increases both in wild type and R6/ 2 mice dur­ing age, however γ ‑⁠ H2AX is significantly higher in R6/ 2 than in wild type animals. Furthermore, striatal neurons and fibroblast of HD human patients exhibit higher γ ‑⁠ H2AX level. In our work we are analyz­ing primary fibroblasts from TgHD minipigs to answer the question whether mtHtt does increase number of dsDNA breaks in TgHD minipig model. This knowledge wil­l be useful for us­ing DNA damage markers as a way how to monitor ef­fectivity of mtHtt lower­ing based therapy. Moreover, experimental target­ing of DDR signal­ing proves therapeutic potential for HD at least in cel­l based and smal­l animal models. Our preliminary data from minipigs shown significant decrease in activatory phosphorylation of ATM and ATM ‑⁠ dependent p53 phosphorylation after exogenous induction of dsDNA breaks. It suggests that ATM ‑⁠ p53 pathway is somehow compromised. Additional­ly we detected fewer DNA damage foci us­ing 53BP1, γ ‑⁠ H2AX and MDC1 in mHTT cel­ls after exogenous dsDNA breaks induction.

Acknowledgement: This study was supported by CHDI Foundation (A ‑⁠ 5378, A ‑⁠ 8248), Norwegian Financial Mechanism 2009 –⁠ 2014 and the Ministry of Education, Youth and Sports under Project Contract no. MSMT ‑⁠ 28477/ 2014 “HUNTINGTON” 7F14308, Operational Program Research and Development for In­novations (ExAM; CZ.1.05/ 2.1.00/ 03.0124).

POSTERS

P01 Behavioral and motoric test­ing of transgenic minipigs – focus on F0, F1, and F2 generations

Bohuslavova B1,2, Kucerova S1,2, Macakova M1,2, El­lederova Z1, Motlik J1

1Laboratory of Cel­l Regeneration and Plasticity, Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

2Department of Cel­l Biology, Faculty of Science, Charles University in Prague, Czech Republic

Key words: involuntary movements –⁠ behavioral tests –⁠ minipig model of Huntington’s disease

Huntington’s disease (HD) is an autosomal dominant monogenetic neurodegenerative disease caused by a pathological CAG expansion in exon 1 of the huntingtin gene lead­ing to the production of the mutant huntingtin protein. The onset of the disease in patients is usual­ly in mid ‑⁠ thirties. It is characterized by involuntary chorea like movements, poor balance, slur­red speech, dif­ficulty swal­lowing, think­ing (cognitive) dif­ficulty, and personality change. Interestingly, not al­l symp­toms are experienced by al­l patients. One of the most used HD animal models has been R6/ 2 mouse. R6/ 2 also exhibit dif­ficulties in a number of tasks namely swim­ming, beam traversing, and maintain­ing balance on the Rota ‑⁠ rod at the fastest rotat­ing speeds. They have characteristic clasp­ing when taken by tail.

In this project, we performed behavioral and motoric tests of our oldest minipigs expres­s­ing N‑terminal part of human mutated huntingtin (TgHD), and their wild type (WT) siblings.

We implemented a variety of behavioral tests, includ­ing tun­nel test, hurdle, seesaw, skittles, cover pan, and cros­s­ing a longitudinal and cros­s stepper. We observed higher fear or inability to perform certain tests, and wobbly movements of back legs of some mainly F0 and F1 TgHD animals. Scor­ing table of performed repeated tests was done. The obtained data were proces­sed statistical­ly.

Acknowledgement: This study was supported by CHDI Foundation (A ‑⁠ 5378, A ‑⁠ 8248), Operational Program Research and Development for In­novations (EXAM; CZ.1.05/ 2.1.00/ 03.0124), Norwegian Financial Mechanism 2009 –⁠ 2014 and the Ministry of Education, Youth and Sports under Project Contract no. MSMT ‑⁠ 28477/ 2014 “HUNTINGTON” 7F14308 and RVO: 67985904.

P02 Im­munoelectrophoretic analysis of mitochondrial protein status in skeletal muscle of minipigs transgenic for the Nterminal part of human mutated huntingtin

Dosoudilova Z1, Kratochvilova H1, Horova E1, Kucerova I1, Juhasova J2, Juhas S2, Klempir J3, Motlik J2, Zeman J1, Hansikova H1

1Laboratory for Study of Mitochondrial Disorders, Department of Pediatrics and Adolescent Medicine, 1st Faculty of Medicine, Charles University and General University Hospital in Prague, Czech Republic

2Laboratory of Cel­l Regeneration and Plasticity, Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

3Department of Neurology and Centre of Clinical Neuroscience, 1st Faculty of Medicine, Charles University in Prague, Czech Republic

Key words: Huntington’s disease –⁠ large animal model –⁠ skeletal muscle –⁠ mitochondria

Huntington’s disease (HD) is an autosomal dominant neurodegenerative disorder caused by the expansion of CAG repeats on chromosome 4p16.3, which results in elevated polyglutamine tract in huntingtin (Htt). Numerous studies demonstrated that CNS and peripheral pathogenic proces­ses in HD share important features. Myocytes, similar to neurons, are post mitotic, long‑lived cel­ls, and muscle tis­sue is a tis­sue that is af­fected in HD patients by progres­sive wasting. Mutant Htt has been implicated in disruptions of mitochondrial functions whose impairment may contribute to the pathogenesis of HD.

The aim of our study was to monitor the level of mitochondrial proteins and their age‑related changes in skeletal muscle of transgenic minipigs (TgHD) in F2 generation in age of 24, 36 and 48 months.

To investigate the native state of oxidative phosphorylation (OXPHOS) complexes, isolated mitochondria were separated by 6 –⁠ 15% BN ‑⁠ PAGE fol­lowed by Coomas­sie Bril­liant Blue staining. Decrease native levels of complex I, III, IV and complex V were detected in dependence on age of minipig models. Pronounced reduction of complex III and complex V were revealed especial­ly in 48m TgHD skeletal muscle samples. Isolated mitochondria were also separated by 12% SDS ‑⁠ PAGE fol­lowed by western blot. The result­ing im­munoblots were incubated with specific antibodies against selected mitochondrial proteins (Abcam) include OXPHOS complex subunits, pyruvate dehydrogenase (PDH) subunits, Krebs cycle enzymes and other mitochondrial proteins. Mild decrease in level of selected proteins were observed (Aconitase, PDH E2/ E3 bp, COX1, COX5a), however intensity of changes were not the same for al­l individuals of the same age TgHD.

Studies of potential deregulation of the target proteins in peripheral tis­sues such as skeletal muscle could provide valuable information about bio­logical changes that track disease progres­sion.

Acknowledgement: Supported by the Operational Program Research and Development for In­novations (EXAM; CZ.1.05/ 2.1.00/ 03.0124), Norwegian Financial Mechanism 2009 –⁠ 2014 and the Ministry of Education, Youth and Sports under Project Contract no. MSMT ‑⁠ 28477/ 2014 “HUNTINGTON” 7F14308 and CHDI Foundation (A ‑⁠ 8248), RVO ‑⁠ VFN 64165.

P03 Striatal magnetic resonance spectroscopy of transgenic HD minipigs

Frank F1,2, Nagelman­n N2, Liebsch L2, Schubert R1, Wirsig M1, Schramke S1,3, Schuldenzucker V1, Faber C2, Reilman­n R1,2,4

1GeorgeHuntingtonInstitute, Muenster, Germany

2Institute for Clinical Radiology, University of Muenster, Germany

3Institute for Animal Hygiene, Animal Welfare and Farm Animal Behaviour, University of Veterinary Medicine Han­nover, Germany

4Department of Neurodegenerative Diseases and HertieInstitute for Clinical Brain Research, University of Tuebingen, Germany

Key words: striatum –⁠ magnetic resonance spectroscopy –⁠ transgenic –⁠ Huntington’s disease –⁠ animal model –⁠ minipig

Our study is the first phenotyp­ing study on TgHD minipigs from the Institute of Animal Physiology and Genetics in Libechov (Czech Republic). MRI scans includ­ing anatomical, dif­fusion ‑⁠ weighted and spectroscopic sequences were performed to as­ses­s anatomical and metabolic changes in the brain. Proton magnetic resonance spectroscopy (MRS) is a validated method for determin­ing changes in the relative molecule concentration in Huntington’s disease (HD) patients and in TgHD mice.

For determin­ing relative molecule concentrations in the striatum of the TgHD and wild type minipigs we performed a baseline and two fol­low‑up as­ses­sments. Feasibility and tolerability same as between group dif­ferences and longitudinal changes wil­l be as­ses­sed.

Methods and techniques: The minipigs were scan­ned on a 3T Philips Achieva system at baseline, at one year and two year fol­low‑up. Single‑voxel based spectroscopy (PRES­s) of the striatum on the right and left hemisphere was acquired us­ing the fol­low­ing parameters: TR: 2 000 ms, TE: 32 ms, measured voxel size: 8 × 22 × 8 m­m, averages: 176, scan duration: 6 min. The concentration of N ‑⁠ acetylasparate, myo ‑⁠ inositol, glutamate and glutamine relative to creatine was calculated by LCModel.

In the data col­lected no significant dif­ferences were seen between the transgenic and the wild type group at MRI 1 (baseline –⁠ 6 month of age) and 2 (18 months of age). The spectra showed wel­l‑resolved lines of the major metabolites, which were observed at similar relative concentrations as expected for humans. The data analysis for MRI 3 (30 month of age) is pend­ing and the statistical analysis wil­l be presented on the Conference on Animal Models for Neurodegenerative Diseases 2015.

In this pilot study cros­s ‑⁠ sectional baseline and longitudinal data from TgHD minipigs and controls was succes­sful­ly acquired. Thus longitudinal changes between transgenic and wild type may be expected later on due to the slowly progres­sive nature of HD.

Acknowledgement: Founded by the CHDI Foundation.

P04 Spermatozoa im­munophenotype markers as­sociated with porcine HD model

Klima J, Vochozkova P, Juhasova J, Bohuslavova B, Macakova M, Motlik J, Juhas S

Laboratory of Cel­l Regeneration and Plasticity, Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

Key words: Huntington’s disease –⁠ transgenic porcine model –⁠ spermatozoa

Huntington’s disease (HD) is inherited and incurable progres­sive neurodegenerative disease. Predominantly rodent animal models are utilized to explore the mechanism and the potential treatment of HD. Large animal models like sheep and pig are little characterized and stil­l lack the prominent symp­toms and neuropathological features. Nonetheles­s, in accordance to HD patients and R6/ 2 mouse the porcine HD model displays defects in spermatogenesis. As previously reported on western blot the porcine transgenic TgHD model line bear­ing a 548aa ‑⁠ 120Q N‑terminal fragment of human huntingtin expres­s mutant huntingtin in sperm cel­ls. Detailed localization of huntingtin protein epitopes was not determined yet. Ejaculated pig spermatozoa of F1 and F3 generation were used in this study. Indirect im­munofluorescence stain­ing of cytospin­ned spermatozoa was performed us­ing a set of anti ‑⁠ huntingtin specific (EPR5526, MW8) and poly ‑⁠ Q specific (3B5H10) antibodies. In addition mouse R6/ 2 and human patient spermatozoa were also included to evaluate the relevance of porcine TgHD model. The 3B5H10 im­munolabel­ing results in punctate stain­ing that lines the whole sperm tail of transgenic (Tg) boars. Similar stain­ing pattern is detected us­ing EPR5526 antibody recogniz­ing both mutant and endogenous huntingtin. On contrary to a transgen specific 3B5H10 stain­ing of sperm tail, EPR5526 also detects endogenous huntingtin in wild type (WT) spermatozoa. Total EPR5526 fluorescent signal in TgHD sperm tail is higher than in WT one. The presence of putative aggregated forms of huntingtin can­not be confirmed us­ing MW8 antibody. In sum­mary the endogenous WT huntingtin is a natural constituent of porcine sperm flagel­la and shows the same localization as mutant protein. Spermatozoa of transgenic animals display elevated levels of huntingtin protein but MW8 positive aggregates can­not be detected.

Acknowledgement: This study was supported by CHDI Foundation (A ‑⁠ 5378, A ‑⁠ 8248), Norwegian Financial Mechanism 2009 –⁠ 2014 and the Ministry of Education, Youth and Sports under Project Contract no. MSMT ‑⁠ 28477/ 2014 “HUNTINGTON” 7F14308, Operational Program Research and Development for In­novations (ExAM; CZ.1.05/ 2.1.00/ 03.0124)and RVO: 67985904.

P05 Mas­s spectrometrybased SRM as­say for quantification of human mutant huntingtin protein in a transgenic minipig model of Huntington’s disease

Kotrcova E1, Sucha R1, Tyleckova J1, Dresler J2, Kovarova H1

1Laboratory of Applied Proteome Analyses and Research Center PIGMOD, Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

2Military Health Institute, Prague, Czech Republic

Key words: Huntington’s disease –⁠ huntingtin –⁠ selected reaction monitoring

Huntington’s disease (HD) is an autosomal dominant hereditary disease caused by expansion of CAG repeats in huntingtin gene (HTT). Translation of this gene results in polyQ stretch in the N‑terminus ot the huntingtin protein (Htt). This mutation significantly af­fects Htt conformation, proteolysis, posttranslational modifications, as wel­l as its ability to bind interact­ing proteins.

Animal models of HD us­ing genetic manipulations are crucial for test­ing of the ef­ficacy of novel therapeutic strategies before initiation of clinical trials in human. A transgenic minipig model for HD car­ry­ing the first 548 amino acids of human Htt with 124 glutamines has been established at our institute, which has been demonstrated to maintain the germ line transition through several generations. The transgenic animals car­ry two al­leles cod­ing endogenous porcine Htt and one al­lele for the N‑terminal part of human mutant Htt under control of the human promoter.

Protein sequences of human (mutant, transgenic) and porcine (wild type, endogenous) Htt dif­fer in a couple of amino acids which enables to distinguish species ‑⁠ specific forms of Htt and independently quantify mutant and wild type proteins expres­sed in our model us­ing selected reaction monitor­ing (SRM).

The first step of this project focused on brain tis­sue samples has led to the optimization of SRM as­says for a set of Htt peptides. To quantify the N‑terminal part of the transgenic and endogenous Htt simultaneously, optimal coordinates for al­l pos­sible tryptic peptides were derived and individual SRM as­says were then as­sembled into a multiplexed fingerprint as­say. Development of SRM as­says was performed us­ing heavy ‑⁠ labeled, unpurified synthetic version of each peptide. In order to validate SRM as­says, peptides contain­ing a heavy ‑⁠ isotope label were spiked into real samples and cor­respond­ing transitions were targeted by time ‑⁠ scheduled SRM.

To monitor transgenic and endogenous Htt levels and its lower­ing in preclinical studies of HD therapy, a sample that could be col­lected repeatedly in the course of HD progres­sion would be beneficial.

Acknowledgement: This work was supported by TACR (TA01011466), the Operational Program Research and Development for In­novations (EXAM; CZ.1.05/ 2.1.00/ 03.0124), Norwegian Financial Mechanism 2009 –⁠ 2014 and the Ministry of Education, Youth and Sports under Project Contract no. MSMT ‑⁠ 28477/ 2014 “HUNTINGTON” 7F14308 and Institutional Research Concept (RVO67985904).

P06 Mitochondrial impairments in fibroblasts of minipigs transgenic for the Nterminal part of human mutated huntingtin

Kratochvilova H1, Rodinova M1, Spacilova J1, Ondruskova N1, Markova M1, Danhelovska T1, Valekova I2, Hulkova M1, Tesarova M1, Juhasova J2, El­lederova Z2, Zeman J1, Motlik J2, Hansikova H1 

1Laboratory for Study of Mitochondrial Disorders, Department of Pediatrics and Adolescent Medicine, 1st Faculty of Medicine, Charles University and General University Hospital in Prague, Czech Republic

2Laboratory of Cel­l Regeneration and Plasticity, Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

Key words: Huntington’s disease –⁠ large animal model –⁠ fibroblast –⁠ mitochondria

Huntington’s disease (HD) is an autosomal dominant neurodegenerative disorder caused by expansion of CAG repeats on chromosome 4p16.3, which results in elongated glutamine tract of huntingtin (Htt). The most pathological ef­fects of HD are focused on the central nervous system but numerous reports had described abnormalities in peripheral tis­sues. Mutant Htt has been implicated in disruptions of mitochondrial functions whose impairment may contribute to the pathogenesis of HD. The aim of the study was to analyze mitochondrial bio­energetics in cultivated fibroblasts derived from minipigs transgenic for the N‑terminal part of human mutated Htt (TgHD).

Cultivated skin fibroblasts from TgHD and WT minipigs of F0 –⁠ F2 generations (12 –⁠ 60 months) were used for al­l analyses. Respiratory chain complexes (RCC) activity and amount were analyzed by spectrophotometric, im­munoelectrophoretic and im­munocapture methods. Respiration was measured by polarography. Mitochondrial ultrastructure, network and reactive oxygen species (ROS) were visualized us­ing fluorescent and electron microscopy. Amount of mtDNA was detected by qPCR.

Pathological changes in mitochondrial ultrastructure (swol­len mitochondria, onion like phenotype), network (unequal distribution, isolated segments and fragmentation), increased level of ROS and selectively decreased level of RCC I and IV were detected in TgHD minipig fibroblasts in comparison with WT individuals. Cultured skin fibroblasts could serve as a good tool to investigate mitochondrial impairment as potential disease marker incur­red in con­nection with HD.

Acknowledgement: Supported by the Norwegian Financial Mechanism 2009 –⁠ 2014 and the Ministry of Education, Youth and Sports under Project Contract no. MSMT ‑⁠ 28477/ 2014 “HUNTINGTON” 7F14308, COST LD15099 (MSMT), ExAM –⁠ CZ.1.05/ 2.1.00/ 03.0124 (MSMT) and CHDI Foundation (A ‑⁠ 8248), RVO ‑⁠ VFN 64165.

P07 Generation of induced pluripotent stem cel­ls from transgenic minipigs expres­s­ing the Nterminal part of the human mutant huntingtin – a new way to study pathogenesis of Huntington’s disease

Liskova I1,2, Vodicka P3, Juhas S1, Klempir J2,4, Motlik J1

1Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

2Department of Neurology and Centre of Clinical Neuroscience, 1st Faculty of Medicine, Charles University in Prague, Czech Republic

3Institute for Neurodegenerative Disease, Mas­sachusetts General Hospital, Boston, USA

4Institute of Anatomy, 1st Faculty of Medicine, Charles University in Prague, Czech Republic

Key words: Huntington’s disease –⁠ huntingtin –⁠ induced pluripotent stem cel­ls –⁠ neural stem cel­ls –⁠ cel­l reprogram­ming –⁠ transgenic minipigs

Huntington’s disease (HD) is a progres­sive neurodegenerative disorder caused by a CAG ‑⁠ triplet expansion in exon 1 of the gene encod­ing huntingtin (Htt) protein. HD is characterized by motor, cognitive and psychiatric abnormalities result­ing from progres­sive los­s of medium spiny neurons in striatum, fol­lowed by a cortical and subcorctical atrophy and many other systemic changes. The aim of our research is to study pathogenesis of HD in vivo dur­ing the lifespan of our pigs as wel­l as in vitro us­ing dif­ferent tis­sues and cel­l types to better understand and describe the development of the disease.

Since 2006 the new technology of somatic cel­ls reprogram­m­ing to pluripotency has created new opportunities for in vitro model­l­ing of various disorders includ­ing neurodegenerative diseases such as HD.

We work on generation of induced pluripotent stem cel­l (iPSCs) lines from our transgenic minipigs. Neural stem cel­ls, porcine embryonic fibroblasts and porcine adult fibroblasts from both transgenic and wild type pigs were isolated and transfected with piggyBac transposon vector system contain­ing oct ‑⁠ 4, klf ‑⁠ 4, c ‑⁠ myc and sox ‑⁠ 2 reprogram­m­ing factors. For transfection itself we used an electroporation‑based system from Lonza. Cel­ls were then cultivated in serum‑free medium with addition of smal­l molecules such as histone deacetylase inhibitors which can af­fect the activity of epigenetic regulators and improve reprogram­m­ing ef­ficiency. After 1 –⁠ 5 weeks of cultivation we observed morphological changes fol­lowed by appearance of colonies morphological­ly similar to embryonic stem cel­ls. Colonies were then isolated and further cultivated to establish stable cel­l lines.

Our further research is focused on characterization of iPSCs and their dif­ferentiation into neuronal precursors and striatal neurons as wel­l as into other tis­sues to better understand al­l dif­ferences between transgenic and wild type lines and the role of mutated Htt in the proces­s of embryonic development and cel­l dif­ferentiation.

Acknowledgement: This work was supported by the Operational Program Research and Development for In­novations (EXAM; CZ.1.05/ 2.1.00/ 03.0124) and Norwegian Financial Mechanism 2009 –⁠ 2014 and the Ministry of Education, Youth and Sports under Project Contract no. MSMT ‑⁠ 28477/ 2014 “HUNTINGTON” 7F14308.

P08 Testicular pathology in transgenic minipig boars – in brief

Macakova M1,2, Bohuslavova B1,2, Vochozkova P1,2, Baxa M1,2, El­lederova Z1, Sedlackova M3, Liskova I1,4, Valekova I1,2, Vidinska D1,2, Klima J1, Juhas S1, Motlik J1

1Laboratory of Cel­l Regeneration and Plasticity, Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

2Department of Cel­l Biology, Faculty of Science, Charles University in Prague, Czech Republic

3Department of Histology and Embryology, Faculty of Medicine, Masaryk University in Brno, Czech Republic

4Department of Neurology and Centre of Clinical Neuroscience, 1st Faculty of Medicine, Charles University in Prague, Czech Republic

Key words: transgenic minipig model of Huntington’s disease –⁠ testes –⁠ spermatozoa –⁠ reproductive parameters

Huntington’s disease (HD) is a neurodegenerative disease in the traditional conception. However, mutated protein huntingtin (mtHtt) is ubiquitously expres­sed in al­l tis­sues of the body. Changes in the peripheral tis­sues are les­s ‑⁠ known. Next to the brain, the most abundant expres­sion of huntingtin is in the testes. Accordingly, testicular atrophy was detected in the post mortem samples of HD patients and also in HD transgenic mouse models.

We studied reproductive parameters in the transgenic (TgHD) and wild type (WT) boars of F1 and F2 generations. We evaluated the sperm parameters –⁠ sperm count, motility and progres­sivity. The number of sperms in the ejaculate and their penetration activity were significantly impaired. The motility of the sperms and the results of the survival test of TgHD animals were also lower compare to the WT controls. In contrast, libido sexualis was not decreased. Electron microscopy of sperms of TgHD boars revealed number of the sperm abnormalities like cytoplasmic droplets, deformation of mitochondrial sheath in tail midpiece, folded or coiled tails, instability of acrosome manifested by precocious acrosome reaction. Morphological analysis of the testes by electron microcopy and im­munofluorescence showed atrophic seminiferous tubule, los­s of gem cel­ls, and high expres­sion of mtHtt. Moreover, we measured the levels of testosterone, FSH, luteiniz­ing hormone, and inhibin alpha in order to eliminate the influence of defects in neurons responsible for hormonal levels. The hormonal screen­ing did not show any dif­ferences between WT and TgHD animals.

In conclusion, we show the sperm and testicular pathology in TgHD minipigs caused by the highly abundant expres­sion of mutated huntingtin in testes, and sperms.

Acknowledgement: This work was supported by the Norwegian Financial Mechanism 2009 –⁠ 2014 and the Ministry of Education, Youth and Sports under Project Contract no. MSMT ‑⁠ 28477/ 2014 “HUNTINGTON” 7F14308, Operational Program Research and Development for In­novations (EXAM; CZ.1.05/ 2.1.00/ 03.0124), CHDI Foundation (A ‑⁠ 8248, A ‑⁠ 5378) and RVO 67985904.

P09 Evidence of amyotrophic lateral sclerosis (ALS) features in SOD1–G93A transgenic swine

Novel­la CM1, Corona C1, Crociara P1, Perota A2, Bendotti C3, Botter A4, D’Angelo A5, Duchi R2, Formicola D7, Lo Faro M1, Palmites­sa C1, Ber­rone E1, Favole A1, Rainoldi A7, Gal­li C5,8, Casalone C1

1Istituto Zooprofilattico Sperimentale, Torino, Italy

2AVANTEA, Laboratorio di Tecnologie del­la Riproduzione, Cremona, Italy

3Istituto di Ricerche Farmacologiche Mario Negri IRCCS, Dipartimento di Neuroscienze, Milano, Italy

4Laboratorio di Ingegneria del Sistema Neuromuscolare (LISIN), Politecnico di Torino, Italy

5Dipartimento di Scienze Veterinarie, Università di Torino, Italy

7Centro Ricerche Scienze Motorie – SUISM, Dipartimento Scienze Mediche, Università di Torino, Italy

8Dipartimento di Scienze Mediche Veterinarie, Università di Bologna, Italy

Key words: amyotrophic lateral sclerosis –⁠ swine –⁠ hSOD1 –⁠ phenotypical characterization

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease that occurs in two clinical­ly indistinguishable forms: sporadic and familial, the latter mainly linked to mutations in the SOD1 gene. The use of mice car­ry­ing the hSOD1G93A mutation is cur­rently widespread in ALS research; however a real improvement of patients prognosis has not yet been obtained (Turner et al., 2013). Another model, more closely related to human species, is strongly demanded by the scientific com­munity that has already foreseen swine as an attractive alternative for model­l­ing human neurodegenerative diseases (Lind et al., 2007). Recently we produced four hSOD1G93A cloned boars (Chieppa et al., 2014), that were bred to establish a transgenic line. To validate the model we performed on the founder animals an extensive molecular and phenotypical characterization.

Copy Number analysis was conducted with the 2 –⁠ ∆∆ct method us­ing the fol­low­ing primers pair: SOD1Fw CATGAACATGGAATCCATGCAGG and SOD1Rw TAATGGACCAGTGAAGGTGTG for the human SOD1 gene and gapdhFW TGCCACCCAGAAGACTGTGG and gapdhRW ACCTTGCCCACAGCCTTGGC for the glyceraldehyde ‑⁠ 3 -⁠ phosphate dehydrogenase used as reference gene while genomic human DNA was used as a calibrator. Regard­ing clinical evaluation, motor function and gait dynamics were evaluated us­ing an integrated protocol of digital gait analysis (3D Motion Capture) and surface electromyography (EMG).

The boar #168, car­ry­ing 25 to 30 transgene copy number, started to show lamenes­s around twenty seven months of age. At 28 months of age, only a slight incoordination was detectable, which become clear and as­sociated to hypermetria around the 29 –⁠ 30 months of age. Hereinafter appeared dysphagia and regurgitation phenomena meanwhile, dur­ing spontaneous walking, the pig kept fal­l­ing down. Thus the #168 hSOD1G93A transgenic swine showed motor dysfunction and symp­toms resembl­ing ALS. The remain­ing transgenic boars (#174, #204 and #205), car­riers of a smal­ler number of transgene copies, to date are healthy and have reached 48 months of age.

After euthanasia, specific analysis on #168 tis­sues were performed. Im­munohistochemistry and im­munofluorescence data revealed granular mutant protein aggregates in the brain and spinal cord, a characteristic ALS hal­lmark.

Al­l these findings might be consistent with the disease onset, course and end point. However, further molecular and pathological investigations are required to reach a complete and exhaustive characterization of this ALS large animal model.

Acknowledgement: GR ‑⁠ 2010 -⁠ 2312522, IZSPLV 04/ 10RC to CC; grant Superpig from Regione Lombardia to CG.

P10 Study of protein OGlcNAcylation in the brain tis­sue in Huntington’s disease

Ondruskova N1, Rodinova M1, Kratochvilova H1, Klempir J2, Roth J2, Motlik J3, Radoslav M4, Zeman J1, Hansikova H1

1Department of Pediatrics and Adolescent Medicine, 1st Faculty of Medicine, Charles University and General University Hospital in Prague, Czech Republic

2Department of Neurology, 1st Faculty of Medicine, Charles University and General University Hospital in Prague, Czech Republic

3Laboratory of Cel­l Regeneration and Plasticity, Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

4Department of Pathology and Molecular Medicine, Thomayer Hospital in Prague, Czech Republic

Key words: Huntington’s disease –⁠ glycosylation –⁠ N ‑⁠ acetylglucos-amine –⁠ brain tis­sue

Recent studies suggest a role of O ‑⁠ GlcNacylation –⁠ protein modification with N ‑⁠ acetylglucosamine –⁠ in the pathophysiology of neurodegenerative diseases. Moreover, altered O ‑⁠ GlcNacylation of mitochondrial proteins has been linked to impaired mitochondrial function. In a Caenorhabditis elegans model of Huntington’s disease (HD), genetic manipulation of the O ‑⁠ GlcNAc cycl­ing enzymes OGT and OGA af­fected proteotoxicity and disease progres­sion. However, no study has been published up until now where the changes of O ‑⁠ GlcNAc signal­ing in HD patients were analyzed. Our aim was to analyze protein O ‑⁠ GlcNAcylation in the brain tis­sue of patients with HD.

The analyses were performed in the postmortem brain tis­sue (Basal Ganglia; BG; Frontal Cortex; FC) of two HD patients (both female, P1 : 66 years old, P2 : 48 years old) and in cor­respond­ing samples from age ‑⁠ matched controls. The global extent of O ‑⁠ GlcNAcylation and levels of O ‑⁠ GlcNAc cycl­ing enzymes, as wel­l as the levels of selected mitochondrial proteins, were analyzed by SDS ‑⁠ PAGE and detected by Western blot. Mitochondrial network was visualized in cultivated dermal fibroblasts (CDF) from P1 us­ing im­munofluorescence stain­ing with MitoTracker.

Elevated levels of global protein O ‑⁠ GlcNAcylation were found in BG and FC of P1. Additionaly, increased level of OGT, normalized to tubulin, was detected in BG of both patients. Also in BG of P1 and P2, an unusual OGA pattern was observed with markedly increased ratio of the smal­ler band to the one with higher molecular weight. Mitochondrial alterations found in the patients included decreased level of multiple pyruvate dehydrogenase subunits (BG), increased level of alpha ‑⁠ ketoglutarate dehydrogenase subunit DLST (BG) and higher fragmentation of the mitochondrial network (CDF).

Our results indicate a disturbed O ‑⁠ GlcNAcylation in the brain tis­sue of HD patients. We suggest that O ‑⁠ GlcNAcylation dysregulation could be as­sociated with HD pathophysiology, includ­ing mitochondrial dysfunction observed in this disease.

Acknowledgement: This work was supported by the Norwegian Financial Mechanism 2009 –⁠ 2014 and the Ministry of Education, Youth and Sports under Project Contract no. MSMT ‑⁠ 28477/ 2014 “HUNTINGTON” 7F14308, Program Research and Development for In­novation Ministry of Education, Youth and Sports ExAM CZ.1.05/ 2.1.00/ 03.0124.

P11 Decreased mitochondrial density and ultrastructural changes of mitochondria in cultivated skin fibroblasts of patients with Huntington’s disease

Rodinova M1, Markova M1, Kratochvilova H1, Kucerova I1, Tesarova M1, Liskova I2,3, Klempir J2, Roth J2, Zeman J2,Hansíková H1

1Department of Paediatrics and Adolescent Medicine, 1st Faculty of Medicine, Charles University and General University Hospital in Prague, Czech Republic

2Department of Neurology, 1st Faculty of Medicine, Charles University and General University Hospital in Prague, Czech Republic

3Laboratory of Cel­l Regeneration and Plasticity, Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

Key words: Huntington’s disease –⁠ fibroblasts –⁠ mitochondrial ultra-structure –⁠ respiratory chain complexes –⁠ pyruvate dehydrogenase

Huntington’s disease (HD) is an autosomal dominant neurodegenerative disease caused by the expansion of the number of CAG repeats on the gene for protein huntingtin (Htt). More than 36 CAG repeats leads to pathological extension of glutamine tract of Htt which leads to changes of secondary structure and function of the Htt. Mutant Htt has been implicated in the disruption of multiple cel­lular proces­ses, includ­ing mitochondrial functions whose impairment is emerg­ing as a contribut­ing factor to the pathogenesis of HD. Central nervous system is the most af­fected in HD but pathologic changes are detectable also in peripheral tis­sues.

The aim of our study was to analyze the impact of HD on selected bio­energetics’ functions, includ­ing mitochondrial networks and ultrastructure in cultivated skin fibroblasts. Analyzed group consists of 10 heterozygotic patients with confirmed HD and six healthy adult controls. Number of CAG triplet repeats on the mutated al­lele ranged between 43 and 53. Al­l fibroblasts were obtained after informed consents. The protein amount of respiratory chain complexes (RCC) was detected by im­munoelectrophoretic methods and by dipstick im­munocapture analysis (Mitosciences), mitochondrial ultrastructure and network were visualized us­ing fluorescent and transmis­sion electron microscopy and evaluated by Fiji software. Mitochondrial respiration was measured by polarography.

Decreased level of cristae and swol­len mitochondria were detected in fibroblasts of al­l 10 patients. Mitochondrial density was significantly decreased in HD lines in comparison to controls (p < 0.001). Protein analysis of patient’s fibroblasts showed decreased level of CI subunit NDUFA9 in 8/ 10 patients and decreased PDH subunit E1 -⁠ α in 8/ 10 patients in comparison to controls. Polarographic measurement showed mild decrease in respiration after addition of substrate for complex IV in patient’s samples. Our findings of ultrastructural abnormalities in peripheral tis­sue, such as skin fibroblasts, that are easier to get than autoptic brain, suggests fibroblasts to use as a tool to investigate the pathogenic cascade fol­low­ing huntingtin dysregulation.

Acknowledgement: This work was supported by the Norwegian Financial Mechanism 2009 –⁠ 2014 and the Ministry of Education, Youth and Sports under Project Contract no. MSMT ‑⁠ 28477/ 2014 “HUNTINGTON” 7F14308, COST LD15099 (MSMT), Program Research and Development for In­novation Ministry of Education, Youth and Sports ExAM CZ.1.05/ 2.1.00/ 03.0124 and RVO ‑⁠ VFN64165.

P12 TRACK TgHD minipigs – a Discrimination Test as part of an as­ses­sment battery for phenotyp­ing TgHD minipigs

Schramke S1,2, Schuldenzucker V1, Schubert R1, Frank F1,3, Wirsig M1, Fels M2, Kemper N2, Hölzner E1, Reilman­n R1,2,4

1GeorgeHuntingtonInstitute, Muenster, Germany

2Institute for Animal Hygiene, Animal Welfare and Farm Animal Behaviour, University of Veterinary Medicine Han­nover, Germany

3Department of Clinical Radiology, University of Muenster, Germany

4Department of Neurodegenerative Diseases and HertieInstitute for Clinical Brain Research, University of Tuebingen, Germany

Key words: animal models –⁠ minipig –⁠ Huntington’s disease –⁠ phenotyping –⁠ behavioral –⁠ preclinical research –⁠ cognition –⁠ discrimination –⁠ reversal learning

The TRACK TgHD minipig study aims to evaluate the potential of the Libechov TgHD minipig model for pre‑clinical studies for Huntington’s disease. We here introduce the Discrimination Test as part of an as­ses­sment battery for minipigs designed to as­ses­s the motor, cognitive and behavioral phenotype of a transgenic (Tg) HD minipig model. The Discrimination Test introduced here is thought to primarily target cognitive dysfunction.

The Discrimination Test was performed to as­ses­s the feasibility and tolerability of the application in Libechov minipigs and to explore the TgHD minipigs’ performance compared with that of wild type (WT) minipigs.

Thirty two female Libechov minipigs –⁠ 18 WT and 14 Tg –⁠ were available for the study. The TgHD minipigs have with an N‑terminal fragment of the huntingtin gene cod­ing for 548aa with 124Q. Al­l animals were housed in six mixed groups (WT and Tg) at the animal facility of the University of Muenster, Germany, in stables with 2 qm per animal enriched with litter and toys.

The Discrimination Test was performed us­ing a special setup. Dur­ing initial training, the minipigs learnt to leave a startbox (SB A), enter a walkway, open a blue plastic box (bB) as opposed to red and yel­low box (rB/ yB), and return to SB A. The boxes’ position was changed clockwise in subsequent runs. Every box is fil­led with three cornflakes (reward), but only the bB can be opened. The train­ing was performed twice. Dur­ing test­ing 1, preparation time (minipig retained in SB for predefined period of 30 s), initiation time (time required to start run by leav­ing SB A), exploration time (time required to open cor­rect box) and return time (time required to solve Discrimination task and return to SB A) were recorded and a score was given based on attempts to open and/ or investigate bB and/ or rB and yB. Dur­ing test­ing 2, yB had to be opened instead of bB and yB (reversal learning). Each pig completes trainings (each 5 min), test­ing 1 (six runs) and test­ing 2 (six runs) bian­nual­ly.

The animals show a good tolerance of the method. Cros­s sectional and longitudinal data analysis is in progres­s us­ing SPS­s 22.0.

The data col­lected to date shows that implementation of the “discrimination test” is feasible and wel­l tolerated. It is hypothesized that performance of the test is impaired in TgHD minipigs compared to controls. We expect to report between group comparisons at the meeting.

Acknowledgement: Funded by the CHDI foundation.

P13 MRIbased stereotaxic standard brain atlas of the Libechov minipig

Schubert R1, Frank F1,2, Johnson H3, Kim EY3, Nagelman­n N2, Schramke S1,4, Schuldenzucker V1, Wirsig M1, Faber C2 , Hölzner E1, Reilman­n R1,2,5

1GeorgeHuntingtonInstitute, Muenster, Germany

2Department of Clinical Radiology, University of Muenster, Germany

3Department of Psychiatry, University of Iowa, Iowa City, USA

4Institute for Animal Hygiene, Animal Welfare and Farm Animal Behaviour, University of Veterinary Medicine Han­nover, Germany

5Department of Neurodegenerative Diseases and HertieInstitute for Clinical Brain Research, University of Tuebingen, Germany

Key words: magnetic resonance imaging –⁠ standard brain atlas –⁠ Huntington’s disease –⁠ animal model –⁠ transgenic –⁠ minipig

In the TRACK TgHD minipig study, we aim to investigate characteristics of the transgenic Libechov minipig as a model for Huntington’s disease (HD). An­nual magnetic resonance imag­ing (MRI) scans are performed, includ­ing anatomical, spectroscopic and dif­fusion weighted imag­ing (DWI) sequences. Quantitative analysis like comput­ing the fractional anisotropy (FA) require a standard brain as target for registration of imag­ing data. We present here a standard brain template for the Libechov minipig created as target for registration. The standard brain wil­l be used as registration target to al­low automated analyses like volumetry, FA analysis and fiber tracking.

In the TRACK TgHD minipig study, we aim to investigate characteristics of the transgenic Libechov minipig as a model for HD. An­nual MRI scans are performed, includ­ing anatomical, spectroscopic and dif­fusion weighted imag­ing (DWI) sequences. Quantitative analysis like comput­ing the fractional anisotropy (FA) require a standard brain as target for registration of imag­ing data. To date, no standard brain atlas for the Libechov minipig exists.

To provide a stereotaxic standard brain atlas of the Libechov minipig that serves primarily as target for registration of dif­fusion weighted MR images.

Nine T1 -⁠ weighted, sagittal acquired MRI volumes of Libechov minipigs were transformed into a com­mon coordinate system and manual­ly skul­l ‑⁠ stripped. A domestic pig reference atlas (Saikali et al., 2010) was registered on the extracted brains with a landmark and intensity based algorithm (Ghayoor et al., 2013). The BRAINSTools library was used for tis­sue segmentation (Kim et al., 2014) and structural segmentation (Johnson et al., 2007). The segmentation was cleaned up manual­ly and Multi‑atlas joint label fusion (MALF) (Wang and Yushkevich, 2013, Wang et al., 2012) was used to create a standard brain, segmented at regions of interest. The T1 -⁠ weighted images were acquired with a 3T Philips Achieva scan­ner.

A total of > 90 T1 -⁠ weighted 3D brain scans of 32 minipigs have succes­sful­ly been acquired. A standard brain template could be created as target for registration. The standard brain wil­l be used as registration target to al­low automated analyses like volumetry, FA analysis and fiber tracking. The shown images are yet unpublished and likely be released in a Journal of Neuroscience Methods special edition on HD animal models.

Most quantitative analysis methods for MR images require registration of the images to a standard volume. Such templates already exist for several species, but not for the Libechov minipig. The result­ing brain template serves as registration target for dif­fusion weighted MR images and is the first step in creat­ing a Libechov minipig FA template for quantitative analysis of cros­s sectional and longitudinal DWI data.

 Acknowledgement: Funded by the CHDI Foundation.

P14 TRACK TgHD minipigs – Tongue Test as a part of an as­ses­sment battery for phenotyp­ing TgHD minipigs

Schuldenzucker V1, Schramke S1,2, Wirsig M1, Frank F1,3, Schubert R1, Hölzner E1, Reilman­n R1,3,4

1GeorgeHuntingtonInstitute, Muenster, Germany

2Institute for Animal Hygiene, Animal Welfare and Farm Animal Behaviour, University of Veterinary Medicine Han­nover, Germany

3Department of Clinical Radiology, University of Muenster, Germany

4Department of Neurodegenerative Diseases and HertieInstitute for Clinical Brain Research, University of Tuebingen, Germany

Key words: animal models –⁠ minipig –⁠ Huntington’s disease –⁠ pheno-typing –⁠ behavioral –⁠ preclinical research –⁠ motor function –⁠ tongue

This study aims to as­ses­s if transgenic (Tg) minipigs (124 Q) develop symp­toms characteristic of human Huntington’s disease (HD) in comparison with wild type (WT) minipigs. To investigate this, we developed motor, cognitive and behavioral tests.

We here report a motor function test, the “Tongue Test”, and as­ses­s the feasibility and tolerability of this as­ses­sment.

The WT (n = 18) and Tg (n = 14) minipigs had to perform the same motor function test. The Tongue Test was divided into a train­ing phase and a test phase. Dur­ing the train­ing phase the pig was presented with a board contain­ing 12 holes measur­ing the same in diameter and depth. A treat was placed in each hole and had to be picked up with the tongue. A train­ing ses­sion lasted until the pig had succes­sful­ly recovered al­l 12 treats. It was repeated three times unles­s a trial lasts more than 5 min, in which case the as­ses­sment was stopped. Dur­ing the test phase the pig was presented with a board that looked the same as the one used in the train­ing ses­sion. However, the holes in this test board increased in their depth and the number of succes­sful­ly recovered treats was counted. As in the train­ing phase the pigs had to perform three runs. Particular determined sections the pigs ran through were counted with a stopwatch. Train­ing and test were videotaped for quality control and further analysis.

The animals show a good tolerance of the method. Cros­s sectional and longitudinal data analysis is in progres­s us­ing SPS­s 22.0.

TgHD and wild type minipis are capable to perform the Tongue Test succes­sful­ly and repeatedly. Phenotypical characteristics of the TgHD versus WT comparison wil­l be reported and discus­sed after completion of further analysis.

Acknowledgement: Funded by the CHDI Foundation.

P15 TRACK TgHD minipigs – Dominance Test as a part of an as­ses­sment battery for phenotyp­ing TgHD minipigs

Schuldenzucker V1, Schramke S1,2, Wirsig M1, Ott S1, Frank F1,3, Schubert R1, Hölzner E1, Reilman­n R1,3,4

1GeorgeHuntingtonInstitute, Muenster, Germany

2Institute for Animal Hygiene, Animal Welfare and Farm Animal Behaviour, University of Veterinary Medicine Han­nover, Germany

3Department of Clinical Radiology, University of Muenster, Germany

4Department of Neurodegenerative Diseases and HertieInstitute for Clinical Brain Research, University of Tuebingen, Germany

Key words: animal models –⁠ minipig –⁠ Huntington’s disease –⁠ phenotyping –⁠ behavioral –⁠ preclinical research –⁠ dominance

The TRACK TgHD minipig project aims to evaluate the phenotype of the Libechov TgHD minipig model. Established tests for as­ses­s­ing dif­ferent domains of pos­sible phenotype manifestation in minipigs are lacking. The test introduced here is thought to primarily target behavioral dysfunction.

We here report a behavioral test, the Dominance Test, and as­ses­s the feasibility and tolerability of this as­ses­sment.

Thirty two minipigs –⁠ 18 wild type (WT) and 14 transgenic (Tg) (124 Q) had to perform the same behavioral test. The animals were housed in six mixed groups (WT and Tg). The Dominance Test was conducted in a nar­row aisle divided in half by a removable board. Dur­ing training, the minipigs learnt to enter the aisle from one side, wait at the door, leave the aisle on the other side and receive a highly favored food treat here. Dur­ing testing, two animals entered the aisle from either end. The door was opened and the animals faced each other. A “win” was noted for reach­ing the opposite end of the aisle first, push­ing the conspecific aside. Al­l animals per group faced each other once. Number of wins per encounters were compared between WT and Tg minipigs.

The animals show a good tolerance of the method. Cros­s sectional and longitudinal data analysis is in progres­s us­ing SPS­s 22.0.

TgHD and WT minipigs are able to perform the Dominance Test succes­sful­ly and repeatedly. Phenotypical characteristics of the TgHD versus WT comparison wil­l be reported and discus­sed after completion of further analysis.

Acknowledgement: Funded by the CHDI Foundation.

P16 TRACK TgHD minipigs – Hurdle Test as a part of an as­ses­sment battery for phenotyp­ing TgHD minipigs

Schuldenzucker V1, Schramke S1,2, Wirsig M1, Frank F1,3, Schubert R1, Hölzner E1, Reilman­n R1,3,4

1GeorgeHuntingtonInstitute, Muenster, Germany

2Institute for Animal Hygiene, Animal Welfare and Farm Animal Behaviour, University of Veterinary Medicine Han­nover, Germany

3Department of Clinical Radiology, University of Muenster, Germany

4Department of Neurodegenerative Diseases and HertieInstitute for Clinical Brain Research, University of Tuebingen, Germany

Key words: animal models –⁠ minipig –⁠ Huntington’s disease –⁠ phenotyping –⁠ behavioral –⁠ preclinical research –⁠ motor function –⁠ gait

This study aims to as­ses­s if transgenic (Tg) minipigs (124 Q) develop symp­toms characteristic of human Huntington’s disease (HD) in comparison with wild type (WT) minipigs. To investigate this, we developed motor, cognitive and behavioral tests.

We here report a motor function test, the “Hurdle Test”, and as­ses­s the feasibility and tolerability of this as­ses­sment.

The WT (n = 18) and Tg (n = 14) minipigs had to perform the same motor function test. The aim of the Hurdle Test was to as­ses­s the gait of the pigs in a more chal­leng­ing environment than the trot as­ses­sed dur­ing the GAITRite®. The test has some similarity to the tandem walk­ing sub‑item of the UHDRS ‑⁠ TMS performed in humans which also needs higher coordinative skil­ls from the patients than perform­ing the normal gait. It was hypothesized that the Hurdle Test is able to as­ses­s deficits in the coordination of the gait in TgHD minipigs earlier, because of the more complex and chal­leng­ing environment. Furthermore it was supposed to be a good supplement to the GAITRite®.

The test as­ses­sed general motor function of the minipigs while walk­ing over hurdles and contained a test phase only, since no specific train­ing is needed. The pigs had to perform six runs while the as­ses­sment of each pig was videotaped for independent re‑analysis and quality control of as­ses­sments and gait patterns.

The animals show a good tolerance of the method. Cros­s sectional and longitudinal data analysis is in progres­s us­ing SPS­s 22.0.

TgHD and WT minipigs are capable to perform the Hurdle Test succes­sful­ly and repeatedly. Phenotypical characteristics of the TgHD versus WT comparison wil­l be reported and discus­sed after completion of further analysis.

Acknowledgement: Funded by the CHDI Foundation.

P17 TRACK TgHD minipigs – a Stres­s Level Test as a part of an as­ses­sment battery for phenotyp­ing TgHD minipigs

Schuldenzucker V1, Schramke S1,2, Frank F1,3, Wirsig M1, Hölzner E1, Reilman­n R1,3,4

1GeorgeHuntingtonInstitute, Muenster, Germany

2Institute for Animal Hygiene, Animal Welfare and Farm Animal Behaviour, University of Veterinary Medicine Han­nover, Germany

3Department of Clinical Radiology, University of Muenster, Germany

4Department of Neurodegenerative Diseases and HertieInstitute for Clinical Brain Research, University of Tuebingen, Germany

Key words: animal models –⁠ minipig –⁠ Huntington’s disease –⁠ pheno-typing –⁠ behavioral –⁠ preclinical research –⁠ stres­s level test –⁠ saliva –⁠ cortisol

This study aims to evaluate transgenic (Tg) minipigs (124 Q) as a large animal model for pre‑clinical studies for Huntington’s disease (HD). We here introduce the Stres­s Level Test as a part of an as­ses­sment battery for minipigs designed to as­ses­s the motor, cognitive and behavioral phenotype of a transgenic (Tg) HD minipig model. The Stres­s Level Test introduced here is an as­ses­sment to explore behavior. Furthermore the test include a bio­marker measurement.

Stres­s Level Test was performed to explore the feasibility and tolerability of the setup in Libechov minipigs and to study the TgHD minipigs’ behavior and bio­markers compared with that of wild type (WT) minipigs.

Thirty two female Libechov minipigs –⁠ 18 WT and 14 Tg –⁠ were used for this study. The TgHD (124Q) minipigs have with an N‑terminal fragment of the huntingtin gene cod­ing for 548aa. Al­l animals were housed in six mixed groups (WT and Tg) at the animal facility of the University of Muenster, Germany, in stables with 2 qm per animal enriched with litter and toys.

Several studies showed a higher cortisol level in HD patients in comparison to control groups. For this reason a stres­s level test was developed, where cortisol samples are col­lected standardized before, dur­ing and after hoof trim­ming. The trim­m­ing situation in the self ‑⁠ designed hoof trim­m­ing stand was unaccustomed and new for the animals. Additional­ly a pulse oximeter is fastened on the animal’s tail, and heart rate is documented every 30 seconds to detect the stres­s level. Respiratory rate and body temperature of the animal are measured frequently.

The animals show a good tolerance of the method. Cros­s sectional and longitudinal data analysis is in progres­s us­ing SPS­s 22.0.

The data col­lected to date shows that implementation of the Stres­s Level Test is feasible and wel­l tolerated. It is hypothesized that the behavior and the bio­markers dif­fer between TgHD and WT minipigs. We expect to report between group comparisons at the meeting.

Acknowledgement: Funded by the CHDI Foundation.

P18 Mitochondrial functions in spermatozoa of minipig boars car­ry­ing transgene with the Nterminal part of human mutated huntingtin

Spacilova J1, Rodinova M1, Kratochvilova H1, Ondruskova N1, Macakova M2, Bohuslavova B2, El­lederova Z2, Zeman J1, Motlik J2, Hansikova H1 

1Laboratory for Study of Mitochondrial Disorders, Department of Pediatrics and Adolescent Medicine, 1st Faculty of Medicine, Charles University and General University Hospital in Prague, Czech Republic

2Laboratory of Cel­l Regeneration and Plasticity, Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

Key words: Huntington disease –⁠ large animal model –⁠ sperma-tozoa –⁠ mitochondria –⁠ pig

Huntington’s disease (HD), an autosomal dominant neurodegenerative disorder caused by CAG repetition expansion cod­ing glutamine (Q) in sequence of huntingtin gene (HTT; human chromosome 4p16.3), is manifested by central nervous system pathologies and also other abnormalities expres­sed in peripheral tis­sues.

Mutant Htt (mtHtt) was described to af­fect cel­lular functions due to polyQ‑chain cytotoxicity includ­ing impairment of mitochondrial metabolism, glycolysis or protein homeostasis.

The aim of this study was to analyse mitochondrial functions in spermatozoa obtained from transgenic minipig boars (TgHD) car­ry­ing the N‑terminal part of human mtHtt.

Spermatozoa were col­lected from TgHD and healthy controls from four generations (F0 –⁠ F3) at the age between 12 –⁠ 60 months. Respiratory chain complexes (RCC) activities and content were analysed by spectrophotometry and imunoelectrophoresis respectively. Oxygen consumption was measured by high‑resolution respirometry (Oroboros ‑⁠ 2k). Mitochondrial energy generat­ing system (MEGS) capacity was characterized by oxidation rate of radiolabeled substrates.

The presence of human mtHtt in sperm tails significantly disturbed bio­energetics functions of mitochondria in spermatozoa of TgHD boars. Impaired mitochondrial respiration, reduced MEGS capacity and decreased RCC II amount and activity was found in sperm of TgHD boars in comparison with age‑related controls. These results support findings from TgHD sperm motility and in vitro penetration tests.

Spermatozoa are useful material for non‑invasive monitor­ing of mitochondrial impairment in con­nection with HD even in presymp­tomatic stages of disease, but further monitor­ing of pathologic phenotype development in this large animal model is needed.

Acknowledgement: Supported by the Norwegian Financial Mechanism 2009 –⁠ 2014 and the Ministry of Education, Youth and Sports under Project Contract no. MSMT ‑⁠ 28477/ 2014 “HUNTINGTON” 7F14308, RVO-VFN64165 and Program Research and Development for In­novation Ministry of Education, Youth and Sports ExAM –⁠ CZ.1.05/ 2.1.00/ 03.0124.

P19 Characterization of im­mune cel­l function in Nterminal fragment minipig model of Huntington’s disease

Valekova I1,2, Butalova N2, Vidinska D1,2, Juhas S1, Kovarova H1, Motlik J1

1Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

2Department of Cel­l Biology, Faculty of Science, Charles University in Prague, Czech Republic

Key words: neuroinflam­mation –⁠ in­nate im­mune system –⁠ microglia –⁠ myeloid cel­ls –⁠ cytokines –⁠ minipig model of Huntington’s disease

Huntington’s disease (HD) is an autosomal dominantly inherited neuropsychiatric degenerative, progres­sive, and fatal condition. Any preventive or disease ‑⁠ modify­ing therapies are not available so far. Therapeutic interventions can only target symp­toms. Whilst the primary pathology in HD is believed to arise from mas­sive degeneration of neurons in the basal ganglia, the expres­sion of mutant huntingtin (mtHtt) has been detected in al­l examined tis­sues. Thus the mutation in non‑neuronal cel­ls both within the brain and in periphery contributes to the HD pathology. Neuroinflam­mation, especial­ly microglia activation, is now wel­l characterised feature of neurodegenerative diseases. Im­mune system disorder outside the central nervous system (CNS) is also increasingly recognised to be involved in the pathogenesis of HD. Given evidence that mutated huntingtin is expres­sed in peripheral im­mune cel­ls, it is pos­sible that inflam­matory changes detected in peripheral tis­sues may reflect the inflam­matory proces­s in CNS.

Utilis­ing the transgenic porcine HD (TgHD) model bear­ing N‑terminal fragment of human mutant huntingtin and the quantitative proteomic approach (bead‑based Luminex xMAP technology), we monitored the im­mune system dysfunction in HD myeloid cel­ls (includ­ing monocytes, macrophages and microglia) and searched for candidate bio­markers of HD onset and progres­sion. Age ‑⁠ matched TgHD and wild type (WT) minipigs with similar genetic background and before the onset of clinical symp­toms were used in this study.

Our results provide significant increase in IL‑1β and IL‑8 levels in non‑stimulated microglial cel­ls isolated from TgHD minipigs indicat­ing hyperactivity of these cel­ls. After stimulation, the levels of al­l measured cytokines were increased in both TgHD and WT animals compared to non‑stimulated. However, it was evident that IFNα concentration in responses to stimulation was significantly reduced in TgHD minipigs. Additional­ly, IL‑10 levels were significantly decreased in TgHD minipigs after stimulation. Measurements of cytokine levels in monocyte/ macrophage secretomes of non‑stimulated cel­ls and in response to stimulation did not reveal any significant dif­ferences between TgHD and WT animals despite the observation that the levels of measured cytokines were increased in both stimulated TgHD and WT animals.

The cytokine alterations reveal involvement of in­nate im­mune system as wel­l as pos­sible lack of adaptive im­mune response in CNS. Us­ing the measurement of cytokine levels, we wil­l continue to monitor the disease progres­sion in pre‑manifest stages in transgenic minipigs. Better understand­ing of the earliest changes in brain and peripheral im­mune cel­ls could lead to development of preventive or disease ‑⁠ modify­ing therapies.

Acknowledgement: This work was supported by CHDI Foundation(A ‑⁠ 8248, A ‑⁠ 5378), Program Research and Development for In­novation Mi-nistry of Education, Youth and Sports ExAM CZ.1.05/ 2.1.00/ 03.0124, Norwegian Financial Mechanism 2009 –⁠ 2014 and the Ministry of Educa-tion, Youth and Sports under Project Contract no. MSMT ‑⁠ 28477/ 2014 “HUNTINGTON” 7F14308, RVO67985904, GAUK no. 378215.

P20 Histological characterization of 36 months old TgHD minipigs

Vochozkova P1,2, Kocurova G1, Hrnciarova E1,2, Ardan T1, Motlik J1

1Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

2Department of Cel­l Biology, Faculty of Science, Charles University in Prague, Czech Republic

Key words: Huntington’s disease –⁠ minipig –⁠ im­munohistochemistry –⁠ brain

The Libechov transgenic minipigs for Huntington’s disease (HD) car­ry the N‑terminal part of human mutated huntingtin gene with an expanded CAG repeats cod­ing protein contain­ing 124Q. Even though a lot of rodent models for HD were genetical­ly engineered, the minipigs represent a promis­ing model for the research of HD pathogenesis due to its similarities with human.

In this study, we used three wild type (WT) and three transgenic (TgHD) minipigs of F2 generation (36 months old) and im­munohistochemical methods and image analysis techniques were employed for qualitative detection and quantitative determination of protein expres­sion in the brain tis­sue. Because of mutant huntingtin (mtHtt) af­fects not only striatum (even if mainly) but also cortex, we evaluated selected cortical areas (motor, somatosensory and insular cortex). In this way we utilized al­l obtained information from stain­ing coronal section and monitored additional important areas in which proces­ses as­sociated with mtHtt presence got underway. The specificity of the primary antibodies was verified by Western Blot and comparative im­munohistochemistry (IHC) of WT and TgHD mouse (R6/ 2, 12 weeks old) brain sections. The main attention was focused on visualization of mutant huntingtin and its aggregation by the fol­low­ing antibodies: anti‑Htt (BML‑PW0595 and EPR5526), anti‑polyQ (1C2) and anti‑aggregated mtHtt (MW8). It is known that mtHtt is expres­sed in al­l cel­l types of the brain and in each of them mtHtt sets of­f a cascade of events result­ing in a selective neuronal los­s and an activation of glial cel­ls in the striatum and the cortex. For this purpose, we used anti Iba ‑⁠ 1, anti‑GFAP and anti‑DARPP32 antibodies. Final­ly, we car­ried out also histochemical examination with Toluidine blue and Luxol fast blue in coronal brain sections for detection of changes in cel­lularity and myelinization.

The results of IHC stain­ing revealed increased expres­sion of huntingtin (endogenous and mutant) in TgHD brain. We probably detected the first mtHtt aggregates. The DARPP32 label­ing showed the reduced level of expres­sion in striatum of TgHD compared to WT animals. Consider­ing that DARPP32 is a selective marker of striatal medium spiny neurons, our findings suggest a partial los­s of inhibitory function of these neurons on dopaminergic signal­ing in striatum of TgHD minipig brain.

We conclude that our results can contribute to better characterization of the minipig model of HD.

Aknowledgements: This work was supported by CHDI Foundation (A ‑⁠ 8248, A ‑⁠ 5378), Operational Program Research and Development for In­novations EXAM –⁠ CZ.1.05/ 2.1.00/ 03.0124, Norwegian Financial Mechanism 2009 –⁠ 2014 and the Ministry of Education, Youth and Sports under Project Contract no. MSMT ‑⁠ 28477/ 2014 “HUNTINGTON”, GAUK no. 378215 and RVO67985904.

P21 Czech Huntington As­sociation

Vondrackova Z, Sasinkova P, Musilova M

Czech Huntington As­sociation, Hradec Kralove, Czech Republic

Key words: Huntington’s disease in Czech Republic

In 2013, 432 patients were dia­gnosed with Huntington’s disease (HD) in the Czech Republic (CR). Consider­ing the population size in CR, the HD prevalence is very low. Probably this is the main reason, why not only Czech society but also medical doctors are not familiar with HD problematic. HD patients and families lack the most the general understand­ing and educated person­nel in hospitals and residential facilities.

Therefore, Czech Huntington As­sociation (CzHA) was found to support and help HD families. The main goal is improv­ing of quality of life and standards of care for HD families in CR. CzHA aims at psychological support of the people at risk and their protection against discrimination and support for caregivers and children from HD families. CzHA is a member of international Huntington As­sociations and have one active study centre within the scope of European Huntington’s Disease Network.

CzHA faces the problems with the lack of volunteers and profes­sionals, especial­ly child and adolescence psychiatrists and psychologists and also family therapists.

CzHA helped to start with the use of preimplantation genetic dia­g­­-nosis in CR and managed cover­ing for its costs from public health insurance.

CzHA organizes recondition ‑⁠ educational weekend stays for patients, publish periodical bul­letin Archa and brochures about liv­ing with HD, cooperates with residential facilities and educates their person­nel in specific aspects of car­ing about HD patients.

Our long‑term ef­fort is to raise public awarenes­s about HD.

P22 TRACK TgHD minipig – startbox back and forth test as a part of an as­ses­sment battery for phenotyp­ing TgHD minipigs

Wirsig M1, Schuldenzucker V1, Schramke S1,2, Frank F1,3, Schubert R1, Hölzner E1, Reilman­n R1,3,4

1GeorgeHuntingtonInstitute, Muenster, Germany

2Institute for Animal Hygiene, Animal Welfare and Farm Animal Behaviour, University of Veterinary Medicine Han­nover, Germany

3Department of Clinical Radiology, University of Muenster, Germany

4Department of Neurodegenerative Diseases and HertieInstitute for Clinical Brain Research, University of Tuebingen, Germany

Key words: animal models –⁠ minipig –⁠ Huntington’s disease –⁠ phenotyping –⁠ behavioral –⁠ preclinical research –⁠ cognition

This study aims to investigate characteristics of the TgHD Libechov minipig as an animal model for Huntington’s disease (HD). The “startbox back and forth test” introduced here is part of the as­ses­sment battery for phenotyp­ing TgHD minipigs.

The aim of this study is to as­ses­s the feasibility and tolerability of apply­ing the “startbox back and forth test” in minipigs and explore its sensitivity to detect cros­s ‑⁠ sectional and longitudinal dif­ferences between transgenic (Tg) HD and wild type (WT) minipigs.

Fourteen TgHD (124 Q) and eighteen WT minipigs were included. The setup the pigs were trained and tested in consisted of a walkway and two startboxes (SB 1 and SB 2) on both ends, con­nected through trapdoors. In the train­ing phase, minipigs were trained to run back and forth between SB 1and SB 2 and were rewarded when reach­ing the opposite startbox. Dur­ing the test­ing phase the pigs were not rewarded, while the option to run back and forth was maintained. The learn­ing target in this test was not to run back and forth, because of the mis­s­ing reward. Dur­ing train­ing and testing, completed runs within 5 min were counted. The test was stopped when a pig stayed 1 min either in a startbox or in the walkway (as­sum­ing that it had learnt there was no reward to expect). Bian­nual­ly, each pig completed two train­ing ses­sions and subsequently the test­ing ses­sion was performed.

Al­l data has been succes­sful­ly acquired in al­l TgHD and WT minipigs suggest­ing good tolerance of the method. An ANOVA analysis compar­ing the dif­ferences in behavior between TgHD and WT minipigs is in progres­s.

The data col­lected to date demonstrates that application of the “startbox back and forth test” is feasible and wel­l tolerated. It is hypothesized that recognition of the lack of be­ing awarded is impaired in TgHD minipigs compared to controls. This is cur­rently as­ses­sed and we expect to report first results at the meeting.

Acknowledgement: Funded by the CHDI Foundation.

P23 TRACK TgHD minipigs – GAITRite® as a part of an as­ses­sment battery for phenotyp­ing TgHD minipigs

Wirsig M1, Schuldenzucker V1, Schramke S1,2, Frank F1,3, Schubert R1, Hölzner E1, Reilman­n R1,3,4

1GeorgeHuntingtonInstitute, Muenster, Germany

2Institute for Animal Hygiene, Animal Welfare and Farm Animal Behaviour, University of Veterinary Medicine Han­nover, Germany

3Department of Clinical Radiology, University of Muenster, Germany

4Department of Neurodegenerative Diseases and HertieInstitute for Clinical Brain Research, University of Tuebingen, Germany

Key words: animal models –⁠ minipig –⁠ Huntington’s disease –⁠ pheno-typing –⁠ behavioral –⁠ preclinical research –⁠ motor function –⁠ GAITRite®

Human Huntington’s disease (HD) patients show motor disabilities such as decreased stride length and impaired dynamic balance. The GAITRite® system is part of the study to detect phenotypical changes in transgenic (Tg) HD Libechov minipigs compared to wild type (WT) Libechov minipigs.

The aim of this study is to detect gait impairment in TgHD minipigs longitudinal­ly, compared to WT minipigs. The feasibility and applicability of the GAITRite® System is tested.

The project included fourteen TgHD (124 Q) and eighteen WT minipigs. The pigs were trained and tested on the Platinum® 2006 MAPCIR GAITRite®, the computer system used for quadruped gait is the GAITFour®software. While the pigs walked over the carpet, footprints were automatical­ly identified and recorded in the software. Al­l ses­sions are recorded by video.

Before the train­ing ses­sion, pigs were conditioned to a clicker. Dur­ing the trainings, pigs were taught by clicker to trot in an even speed over the carpet. As soon as the pigs learnt how to perform the GAITRite®, no clicker was used anymore. Cornflakes were given for motivation as a treat. The pigs had to perform 15 trots in an even speed.

The GAITRite® was performed bian­nual­ly by each pig.

Al­l data has been succes­sful­ly acquired in al­l TgHD and WT minipigs. As data is col­lected longitudinal­ly, analysis is in progres­s.

The GAITRite® System is feasible and wel­l tolerated by the minipigs. The data col­lection is to be analyzed. It is hypothesized, that TgHD minipigs wil­l show gait impairment, compared to WT minipigs and a deterioration compared to themselves, longitudinal­ly.

Acknowledgement: Funded by the CHDI Foundation.

P24 Targeted mas­s spectrometry based as­say for monitor­ing neuronal dif­ferentiation

Zizkova M1, Sucha R1, Rakocyova M1, Dolezalova D2, Cervenka J1, Kovarova H1

1Institute of Animal Physiology and Genetics, AS CR, v.v.i., Libechov, Czech Republic

2Department of Histology and Embryology, Faculty of Medicine, Masaryk University in Brno, Czech Republic

Key words: pluripotent cel­ls –⁠ neural dif­ferentiation –⁠ neurons –⁠ mas­s spectrometry –⁠ selected reaction monitoring

Embryonic stem cel­ls (ESCs) are self ‑⁠ renew­ing pluripotent cel­ls that have the capability of dif­ferentiat­ing into a wide variety of cel­l types. ESC ‑⁠ derived neural precursors undergo cur­rently preclinical investigation for test­ing their potential in cel­l‑based therapies of neurological disorders due to their succes­sful expansion and dif­ferentiation in vitro giv­ing rise to neurons, astrocytes and oligodendrocytes. Despite extensive research focused on the lineage ‑⁠ specific dif­ferentiation of neural stem cel­ls (NSCs), much remains to be elucidated before their translation toward clinical applications. In order to ef­ficiently generate a homogeneous population of neural precursors required for transplantation with their anticipated in vivo dif­ferentiation and simultaneous elimination of teratoma formation, it is neces­sary to ful­ly characterize the developmental stages of neural cel­ls at molecular level.

Us­ing targeted mas­s spectrometry approach, based on selected reaction monitor­ing (SRM), our study aimed at the characterization of human NSCs upon neuronal dif­ferentiation induced by BDNF (Brain Derived Neurotrophic Factor) and GDNF (Glial Derived Neurotrophic Factor). Instead of cur­rently used im­munocytochemistry, SRM was applied to generate quantitative information on typical protein markers of neuronal dif­ferentiation. Doublecortin, Tuj1 and MAP2 were found gradual­ly ris­ing dur­ing NSC dif­ferentiation into mature neurons. To evaluate the presence of support­ing glial cel­ls as wel­l as pos­sible residual pluripotent cel­ls, the levels of other relevant protein markers were also measured by SRM.

Acknowledgement: This work was supported by TACR (TA01011466), the Operational Program Research and Development for In­novations (EXAM; CZ.1.05/ 2.1.00/ 03.0124), IGA (UZFG/ 14/ 20) and Institutional Research Concept RVO67985904 (IAPG, AS CR, v.v.i), Norwegian Financial Mechanism 2009 –⁠ 2014 and the Ministry of Education, Youth and Sports under Project Contract no. MSMT ‑⁠ 28477/ 2014 “HUNTINGTON” 7F14308.

P25 The ef­fect of melatonin on proliferation of primary porcine cel­ls expres­s­ing mutated huntingtin

Rausova P1,2, Valasek J1,2, El­lederova Z1, Motlik J1

1Institute of Animal Physiology and Genetics AS CR, v.v.i., and Research Centre PIGMOD, Libechov, Czech Republic

2Department of Cel­l Biology, Faculty of Science, Charles University in Prague, Czech Republic

Key words: Huntington’s disease –⁠ melatonin –⁠ time lapse microscopy –⁠ minipig model –⁠ proliferation curves –⁠ skin fibroblasts

Accord­ing to the recent studies, melatonin might play an important role in Huntington’s disease (HD) and act as a novel therapeutic approach in the treatment of the disease. HD, the inherited neurodegenerative disorder, is accompanied by gradual melatonin reduction as it progres­ses.

Melatonin in normal cel­ls (non‑tumor) has the anti‑apoptotic ability due to its antioxidant property and its ability to prevent the activation of p53. Furthermore, melatonin increases the expres­sion of BDNF (brain derived neurotrophic factor) and other neuroprotective factors.

The aim of this study was to evaluate the nontoxic dose of melatonin for primary skin fibroblasts isolated from minipigs transgenic for the N‑terminal part of human mutated huntingtin (TgHD), and the ef­fect of melatonin treatment to these cel­ls exposed to genotoxic stres­s.

Cel­ls were cultured in medium supplemented with dif­ferent doses of melatonin. Us­ing time lapse microscopy, we estimated the ef­fect of decreas­ing melatonin concentrations by analyz­ing the proliferation curves.

We show that higher doses of melatonin are toxic for primary porcine fibroblasts. Interestingly, TgHD cel­ls were more sensitive to these doses of melatonin treatment than wild type cel­ls. We evaluated the ef­fective dose of melatonin and demonstrated its rescue proliferative ef­fect on porcine primary cel­ls exposed to genotoxic stres­s.

Acknowledgement: This work was funded by Program Research and Development for In­novation Ministry of Education, Youth and Sports ExAM CZ.1.05/ 2.1.00/ 03.0124, Norwegian Financial Mechanism 2009 –⁠ 2014 and the Ministry of Education, Youth and Sports under Project Contract no. MSMT –⁠ 28477/ 2014 “HUNTINGTON” 7F14308.


Štítky
Dětská neurologie Neurochirurgie Neurologie

Článek vyšel v časopise

Česká a slovenská neurologie a neurochirurgie

Číslo Supplementum 2

2015 Číslo Supplementum 2
Nejčtenější tento týden
Nejčtenější v tomto čísle
Kurzy

Zvyšte si kvalifikaci online z pohodlí domova

Mazová zátka a její řešení
nový kurz

Svět praktické medicíny 2/2026 (znalostní test z časopisu)

Citikolin v neuroprotekci a neuroregeneraci – nové poznatky
Autoři: MUDr. Petr Výborný, CSc., FEBO

Revma Focus: Spondyloartritidy

Denzitometrie v praxi: od kvalitního snímku po správnou interpretaci
Autoři: prof. MUDr. Vladimír Palička, CSc., Dr.h.c., doc. MUDr. Václav Vyskočil, Ph.D., MUDr. Petr Kasalický, CSc., MUDr. Jan Rosa, Ing. Pavel Havlík, Ing. Jan Adam, Hana Hejnová, DiS., Jana Křenková

Všechny kurzy
Přihlášení
Zapomenuté heslo

Zadejte e-mailovou adresu, se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.

Přihlášení

Nemáte účet?  Registrujte se

#ADS_BOTTOM_SCRIPTS#