#PAGE_PARAMS# #ADS_HEAD_SCRIPTS# #MICRODATA#

ROS regulation of RAS and vulva development in Caenorhabditis elegans


Authors: Maximilian Kramer-Drauberg aff001;  Ju-Ling Liu aff001;  David Desjardins aff001;  Ying Wang aff001;  Robyn Branicky aff001;  Siegfried Hekimi aff001
Authors place of work: Department of Biology, McGill University, Montréal, Québec, Canada aff001
Published in the journal: ROS regulation of RAS and vulva development in Caenorhabditis elegans. PLoS Genet 16(6): e32767. doi:10.1371/journal.pgen.1008838
Category: Research Article
doi: https://doi.org/10.1371/journal.pgen.1008838

Summary

Reactive oxygen species (ROS) are signalling molecules whose study in intact organisms has been hampered by their potential toxicity. This has prevented a full understanding of their role in organismal processes such as development, aging and disease. In Caenorhabditis elegans, the development of the vulva is regulated by a signalling cascade that includes LET-60ras (homologue of mammalian Ras), MPK-1 (ERK1/2) and LIN-1 (an ETS transcription factor). We show that both mitochondrial and cytoplasmic ROS act on a gain-of-function (gf) mutant of the LET-60ras protein through a redox-sensitive cysteine (C118) previously identified in mammals. We show that the prooxidant paraquat as well as isp-1, nuo-6 and sod-2 mutants, which increase mitochondrial ROS, inhibit the activity of LET-60rasgf on vulval development. In contrast, the antioxidant NAC and loss of sod-1, both of which decrease cytoplasmic H202, enhance the activity of LET-60rasgf. CRISPR replacement of C118 with a non-oxidizable serine (C118S) stimulates LET-60rasgf activity, whereas replacement of C118 with aspartate (C118D), which mimics a strongly oxidised cysteine, inhibits LET-60rasgf. These data strongly suggest that C118 is oxidized by cytoplasmic H202 generated from dismutation of mitochondrial and/or cytoplasmic superoxide, and that this oxidation inhibits LET-60ras. This contrasts with results in cultured mammalian cells where it is mostly nitric oxide, which is not found in worms, that oxidizes C118 and activates Ras. Interestingly, PQ, NAC and the C118S mutation do not act on the phosphorylation of MPK-1, suggesting that oxidation of LET-60ras acts on an as yet uncharacterized MPK-1-independent pathway. We also show that elevated cytoplasmic superoxide promotes vulva formation independently of C118 of LET-60ras and downstream of LIN-1. Finally, we uncover a role for the NADPH oxidases (BLI-3 and DUOX-2) and their redox-sensitive activator CED-10rac in stimulating vulva development. Thus, there are at least three genetically separable pathways by which ROS regulates vulval development.

Keywords:

Caenorhabditis elegans – Cysteine – mitochondria – superoxide dismutase – Oxidation – Hydrogen peroxide – Superoxides – Vulva

Introduction

Reactive oxygen species (ROS) are signalling molecules that participate in regulating many cellular processes [13], including in C. elegans [48]. Superoxide (O2•-) is produced by a variety of processes, including intracellularly by mitochondrial respiration [9], enzymes such as cytochrome P450 and aldehyde oxidase [10, 11], as well as extracellularly by membrane-bound NAPDH oxidases (NOXs) [12]. Hydrogen peroxide (H2O2) is produced by the action of superoxide dismutases, which convert superoxide to hydrogen peroxide [13], as well as directly by enzymes like xanthine oxidase [14] and monoamine oxidase [15]. It is also produced by the Dual Oxidases (DUOXs), a sub-class of NOX proteins that possess a peroxidase domain, and can thus convert superoxide to hydrogen peroxide [16]. Several distinct enzymatic systems, such as the Catalases (Ctls) [17], Glutathione peroxidases (Gpxs) [18], Thioredoxins (Trxs) and Peroxiredoxins (Prdxs) [19] remove hydrogen peroxide, thus terminating any signal it might carry. In C. elegans, there are five distinct superoxide dismutases (SODs), with SOD-2 the main mitochondrial matrix enzyme, SOD-1 the main cytoplasmic and mitochondrial inter-membrane space enzyme, and SOD-4 the extracellular space enzyme [20]. There are two NOXs of the Duox sub-class, with BLI-3 required for proper development of the cuticle via tyrosine cross-linking [2123], and the very similar DUOX-2 to which no function has yet be assigned [24, 25].

One of the ways ROS can participate in signalling, is by modulating the activities of small GTPases. For examples, the Ras signalling pathway is known to be modulated by ROS in mammals [26, 27] and C. elegans [4, 28]. One of the ways the RAS pathway is affected by ROS in mammals is by direct oxidation of a sensitive cysteine (C118) of the RAS protein itself, by nitric oxide (NO) and superoxide [29, 30] as well as by hydrogen peroxide in the presence of transition metals [31]. This has been mostly studied in vitro [2933], and in cultured cells [27, 3436] but to a much lesser extent in vivo [37]. Redox-sensitive cysteines have also been studied in other small GTPases, such as Rac, where the C18 cysteine has been identified as redox-sensitive [38] as well as Rho, where it’s the C20 cysteine that is sensitive [39]. Studies with Ras and Rac have generally concluded that oxidation of these cysteines (C118 and C18, respectively) leads to the activation of the protein by stimulating guanine nucleotide release. In contrast, oxidation of C20 generally inhibits Rho proteins because of the presence of an additional cysteine, C16. Oxidation of C20 promotes guanine nucleotide release but subsequent disulfide bridge formation between C16 and C20 prevents guanine nucleotide binding, thus inactivating the protein [39]. A powerful tool to study the roles of these sensitive cysteines in vitro and in vivo is by replacement of the cysteine by a serine that cannot be oxidized [6, 33, 38] or by an aspartic acid to mimic oxidation [38, 40].

In C. elegans the Ras pathway has been particularly well characterized for its role in the development of the C. elegans vulva, the egg-laying organ [41, 42](Fig 1A). let-60ras encodes the C. elegans orthologue of mammalian Ras and is most similar to K-Ras [43]. Severe loss-of-function mutants of let-60ras cannot survive, but a gain-of-function mutation (n1046gf), resulting in a G13E substitution, is viable [44] (below we denote this mutation as let-60rasgf). Such oncogenic mutations at G13 (Fig 1B and S1 Fig) favor the active GTP-bound state [45, 46]. In C. elegans, this mutation induces the formation of multiple vulvas instead of only a single one: the multiple vulva phenotype (Muv) (Fig 1C). An important relay downstream of LET-60ras is MPK-1, the sole C. elegans homologue of the extracellular-signal regulated kinase (ERK1/2), whose level of phosphorylation at two sites is one of the molecular readouts of LET-60ras activation [47](Fig 1A). LIN-1, an ETS-domain transcription factor, acts downstream of MPK-1 to inhibit vulval cell fates [47, 48]. Whereas it is gain-of-function mutations in let-60ras that produce the Muv phenotype, it is loss-of-function mutations that do so in lin-1.

Fig. 1. The multivulva phenotype of let-60rasgf is sensitive to ROS.
The multivulva phenotype of <i>let-60rasgf</i> is sensitive to ROS.
let-60ras(n1046gf) is denoted in the figure as let-60gf. A The genetic pathway by which LET-60ras promotes vulval development. C. elegans gene names are in lowercase italics, and the corresponding mammalian protein homologues are in uppercase. The pathway depicts the genetic epistatic relationships between the genes rather than the biochemical interactions of the proteins. Gain-of-function mutations that activate LET-60ras or loss-of-function mutations in lin-1 lead to the development of multiple vulvas. B Space-filling model of human K-Ras bound to GTP, showing the residue (G13) that is mutated in let-60rasgf, and the redox-sensitive cysteine (C118). The structure (PDB ID: 3GFT) was derived using Pymol. C Sample images from mutants scored in D (asterisks denote the vulvas and arrowheads the pseudovulvas). The scale bar represents 50 μm. D Number of vulvas of the wild type and the let-60rasgf mutant after treatment with PQ and NAC. ***P = 0.0001 compared to let-60rasgf.

Here we use C. elegans vulva formation in the sensitized let-60rasgf gain-of-function background to dissect aspects of ROS signalling in a fully in vivo situation. We do this with genetic and pharmacological manipulations that are in the physiological range, with no impact on the organism’s health. We monitor real developmental outcomes (vulva formation) and, by controlling sources, sinks, and especially targets, we could identify genetically distinct ROS signalling pathways, despite that fact that they act in parallel and use the same enzymes and the same active molecules (superoxide and peroxide). We also provide strong evidence that it is hydrogen peroxide, rather than any other ROS species, that is responsible for cysteine oxidation and that in C. elegans, in vivo, oxidation inhibits, rather than activates LET-60ras and CED-10rac.

Results

RAS signalling is sensitive to ROS

The let-60rasgf mutant provides a sensitized background to score changes in RAS signalling, and allowed for extensive characterization of the pathway by identifying suppressors and enhancers [42]. We used the same logic to identify and characterize mechanisms of ROS signalling acting on the RAS pathway and on vulva formation in general. We treated let-60rasgf mutants with the prooxidant paraquat (PQ). PQ can potentially generate superoxide at many cellular sites [49], but its main site of superoxide production is believed to be in the mitochondrial matrix [50, 51]. We used a very low concentration of PQ (0.1–0.2 mM) that has been shown to increased mitochondrial superoxide [6, 52, 53] but without toxicity [52]. Such a low concentration might provide for alteration of ROS signals within the physiological range. In the presence of mitochondrial and cytoplasmic SODs, increased superoxide generation by PQ is expected to lead to increased hydrogen peroxide generation. N-acetyl cysteine (NAC) is a precursor of glutathione and thus functions as an antioxidant by facilitating the removal of peroxides, including hydrogen peroxide [54]. We used NAC at 9 mM, a concentration that has been shown to lower ROS [55] but has no effect on wild type viability [52]. Like other studies using prooxidants on let-60rasgf mutants [28], we found that although PQ had no effect on vulva formation in the wild type, it partially suppressed the Muv phenotype of let-60rasgf (Fig 1D). Conversely, we found that NAC treatment had no effect on the wild type but enhanced the Muv phenotype of let-60rasgf (Fig 1D). We tested two additional alleles of let-60 in addition to the canonical n1046gf allele (S2 Fig). The n1700 allele leads to the same amino acid change as n1046 (G13E), but was independently isolated and is thus in a different background. It leads to a slightly more severe Muv phenotype. The effects of PQ and NAC on this allele were qualitatively the same, suppression and enhancement, respectively. However, the suppression was relatively greater and the enhancement relatively less, likely due to the more severe baseline Muv phenotype. We also tested ga89, a weaker temperature-sensitive allele [56]. However, the allele is so weak, even at the restrictive temperature (26°C), that only the suppressing effect of PQ could be reasonably inferred (S2 Fig). At this stage we could infer that oxidation inhibits a target that could be either LET-60ras itself or another activator of the RAS pathway. All numerical values for all Muv data shown in bar graphs in all figures are given in S1 Table. We report the total number of vulvas (which includes both the main vulva and the ectopic pseudovulvas) and the controls shown are always scored in parallel for every experiment.

Cysteine C118 of LET-60ras is the target of oxidation by PQ

As described in the introduction, cysteine C118 of mammalian RAS is a known potential target of oxidation by NO and superoxide, with oxidation resulting in activation of the protein. Nitrosylation is not relevant in C. elegans, which lacks nitric oxide synthases [57]. We tested whether C118 was involved in the PQ and NAC sensitivity that we observed (although we observed inhibition rather than activation by PQ, and activation by an antioxidant, NAC). We used CRISPR to replace C118 with a serine (C118S). Serine has a similar structure to cysteine but cannot be oxidized by cellular ROS [58](Fig 2A and 2B). We produced C118S alleles, qm226 and qm225, in the wild type and let-60rasgf backgrounds, respectively. Below we also describe alleles in which C118 is replaced by aspartic acid (C118D). For clarity, we use the following formalism when new alleles that affect C118 are involved: we denotate the wild type let-60 allele as let-60(+) and we use let-60ras(+)-C118S (or C118D) and let-60rasgf-C118S (or C118D) to denotate single and double mutants in which C118 has been replaced by another amino acid.

Fig. 2. The activity of LET-60ras is inhibited by oxidation of C118.
The activity of LET-60ras is inhibited by oxidation of C118.
let-60ras(n1046gf) is denoted in the figure as let-60gf. A Serine mimics a non-oxidizable Cysteine, whereas Aspartic acid mimics Sulfinic acid, a doubly oxidised form of Cysteine. B Oxidative modifications of Cysteine. C Sample images from mutants scored in D and E (asterisks denote the vulvas and arrowheads the pseudovulvas). Scale bar represents 50 μm. D, E ***P = 0.0001 compared to let-60rasgf or as indicated. D C118S denotes a CRISPR modification which changed a TGT codon to a TCT thus resulting in a Cysteine to Serine substitution at amino acid position 118 (C118S). Number of vulvas of let-60ras(+)-C118S, let-60rasgf, and let-60rasgf-C118S mutants in combination with PQ and NAC treatments. E C118D denotes a CRISPR modification which changed a TGT codon to a GAT thus resulting in a Cysteine to Aspartic Acid substitution at amino acid position 118 (C118D). Number of vulvas of let-60ras(+)-C118D, let-60rasgf, and let-60rasgf-C118D mutants in combination with PQ and NAC treatments.

The C118S replacement had no effect on vulva formation in the wild type, but strongly enhanced vulval induction in let-60rasgf mutants (Fig 2C and S3 Fig). We scored both the Muv phenotype by counting visible pseudovulvas in adults (Fig 2C and 2D) as well as invaginations in L4-stage larvae (S3 Fig). The C118S replacement fully suppressed all effects by PQ or NAC (Fig 2D). The degree of enhancement produced by C118S was very similar to that produced by NAC (Fig 2D). We conclude that in the let-60rasgf background, PQ acts on the Muv phenotype by increasing hydrogen peroxide levels, leading to increased oxidation of C118, and NAC acts by preventing oxidation of C118 by lowering hydrogen peroxide levels. When C118 is replaced by a serine that cannot be oxidized, neither compound has any effect. The fact that the C118S replacement leads to increased vulva formation indicates that C118 is normally partially oxidized. The picture of RAS oxidation by ROS is thus very different in living intact C. elegans from that in vertebrate cells: both the mechanism of oxidation (by hydrogen peroxide rather than by superoxide or nitric oxide) and the consequence of oxidation (inhibition rather than activation) are different.

Mimicking constitutive oxidation of C118 fully suppresses the oncogenic let-60rasgf allele

Oxidation of cysteine produces cysteine sulfenic acid, which can be further oxidised to form sulfinic acid and then sulfonic acid [59](Fig 2B). The molecular shape and charges of cysteine sulfinic acid is mimicked by aspartic acid (D) [40](Fig 2A and 2B). We used CRISPR to replace C118 with aspartic acid (C118D), creating two alleles, qm227 and qm228, in the let-60rasgf and in the wild-type backgrounds, respectively. This should mimic an intermediate but permanent degree of oxidization of C118 (Fig 2B). Strikingly, both let-60ras(+)-C118D and let-60rasgf-C118D mutants have only a single vulva and, like the wild type, are completely insensitive to PQ and NAC (Fig 2C and 2E). This is consistent with our interpretation of the effects of PQ and NAC treatment on let-60rasgf and let-60rasgf-C118S: oxidation at C118 inhibits Ras signalling. Note that the down-regulation produced by the C118D substitution doesn’t prevent the formation of a vulva, whereas loss-of-function mutations in let-60ras are vulvaless [44]. Thus, one possibility for the complete suppression of the multi-vulva phenotype of the let-60rasgf oncogenic gain-of-function mutation (G13E) by C118D is that the mode of action of oncogenic mutations at G13 might be by interference with the normal regulation by oxidation at C118 (Fig 1B). In other words, the C118D mutation could be specifically counteracting the effects of the gain-of-function mutation rather than simply down-regulating LET-60rasgf activity. However, our findings of the level of expression of the LET-60rasgf-C118D protein suggest that there may be other possible reasons for the complete suppression of the Muv phenotype in these double mutations (see below).

The degree of oxidation of C118 or the inhibition of oxidation by the C118S mutation does not act on vulva formation through MPK-1 phosphorylation

Activation of the Ras pathway leads to increased phosphorylation of the downstream effector MPK-1 in C. elegans as in other systems [47, 60] (Fig 1A). To investigate whether changes of oxidation of LET-60rasgf by compound treatment or by mutations (C118S or C118D) counteracts or enhance the effects of let-60rasgf on MPK-1 phosphorylation, we used commercial antibodies to quantify MPK-1 phosphorylation in vivo, by Western Blot (Fig 3A and 3B and S4 Fig). There are two isoforms of MPK-1 (a and b), with MPK-1a believed to be the relevant isoform to signalling events in the animal’s soma, including vulval development [61]. Using a variety of controls to ensure accurate quantification (S4 Fig and S5 Fig), we observed increased phosphorylation of MPK-1a in let-60rasgf mutants (Fig 3A and 3B) as expected. However, phosphorylation of MPK-1a was not affected in any way in let-60ras(+)-C118S or let-60rasgf-C118S mutants and neither was it significantly suppressed by PQ treatment or enhanced by NAC treatment of let-60rasgf, despite the dramatic effects of the treatments and the mutation on the Muv phenotype (Fig 3A–3D). These findings suggest that activated Ras might impinge on vulva formation through more than one effector and ROS levels regulate vulval development independently of MPK-1 phosphorylation (see Discussion). However, in contrast to the lack of effects of the treatments and of the C118S mutation, the C118D mutation was capable of suppressing the increases level of MPK-1 phosphorylation that is observed in let-60rasgf mutants, such that the level of MPK-1 phosphorylation in let-60rasgf-C118D mutants is the same as that observed in the wild-type. See below for additional discussion of this observation.

Fig. 3. The effects of altered oxidation by PQ and NAC and the C118S mutation are not mediated via MPK-1 or by altered protein stability whereas the let-60rasgf-C118D double mutation affects both.
The effects of altered oxidation by PQ and NAC and the C118S mutation are not mediated via MPK-1 or by altered protein stability whereas the <i>let-60rasgf</i>-C118D double mutation affects both.
A A representative Western blot for phosphorylated MPK-1a (pMPK-1a), total MPK-1a and Histone H3 as a loading control. Unprocessed original scans of blots and additional analyses are shown in S4 Fig. B The mean ratio of phosphorylated MPK-1a (pMPK-1a) to total MPK-1a ± SEM of three different Western blots. C A representative Western blot for phosphorylated MPK-1a (pMPK-1a), total MPK-1a and Histone H3 as a loading control. Unprocessed original scans of blots and additional analyses are shown in S5 Fig. D The mean ratio of phosphorylated MPK-1a (pMPK-1a) to total MPK-1a ± SEM of three different Western blots. E A representative Western blot for LET-60 with Tubulin as a loading control. Unprocessed original scans of blots are shown in S6A Fig. F The mean band intensity ± SEM of three different Western blots normalised to band intensities in the wild type. G A representative Western blot for LET-60 with Histone H3 as a loading control. Unprocessed original scans of blots are shown in S6B Fig. H The mean band intensity ± SEM of three different Western blots normalised to band intensities in the wild type. Molecular weight markers are shown for E and G as different loading controls were used for these blots. All bars are compared to the wild-type control bar or as indicated. **P<0.01, ***P<0.001.

The effects of altered oxidation and the C118S mutation are not mediated by altered protein stability

We sought to investigate whether changes of protein stability could be the mechanism by which oxidation affects LET-60rasgf and RAS signaling. The possibility existed because overexpression of wild type LET-60ras can lead to the Muv phenotype [62]. We examined how the C118S mutation, and PQ and NAC treatments affect the LET-60ras protein levels for both LET-60ras(+) and LET-60rasgf using Ras-specific commercial antibodies (Fig 3E–3H and S6 Fig). We did not observe any effects on protein levels nor did we observe any effects on let-60 mRNA levels (S7 Fig).

The LET-60rasgf-C118D double mutation lowers protein levels

In contrast to what we observed with drug treatments and for LET-60rasgf-C118S, the protein level of LET-60rasgf-C118D but not of LET-60ras(+)-C118D is significantly lower than that of LET-60ras(+) (Fig 3E and 3F). Possibly therefore, the full suppression of the Muv phenotype observed in let-60rasgf -C118D mutants could be due to the lower level of protein acting on the MPK-1 phosphorylation pathway. Alternatively, the depth of the effect (complete suppression of Muv) could be the result of a double effect: an effect on the MPK-1 pathway via lower LET-60rasgf protein expression and an effect on the MPK-1-independent pathway that appears to mediate the other effects of changes to the oxidation status of C118 of LET-60ras.

C118 oxidation depends on the cytoplasmic pool of hydrogen peroxide regulated by SOD-1

Any excess O2•- produced by PQ treatment is expected to be converted to hydrogen peroxide by superoxide dismutases. Although there are 5 SODs in C. elegans, cytoplasmic SOD-1 and mitochondrial SOD-2 account for virtually all SOD activity [20, 63]. SOD-1 may also be present in the mitochondrial inter-membrane space as is the case in other organisms [64]. To determine the enzymatic source of the relevant hydrogen peroxide, we constructed a let-60rasgf;sod-1 double mutant. These double mutant animals displayed an enhanced Muv phenotype (Fig 4A), similar to that obtained by treating let-60rasgf with NAC or replacing cysteine C118 with serine (Fig 2D). Furthermore, the mutants’ Muv phenotype is no longer enhanced by NAC or suppressed by PQ (Fig 4A). These observations suggest two, not mutually exclusive, mechanisms concerning the origin of the hydrogen peroxide that can oxidize C118: 1) Wherever it is produced, the superoxide produced by PQ reaches the compartment in which SOD-1 is present, and/or 2) in the absence of SOD-1, any hydrogen peroxide produce by other SODs from PQ-dependent superoxide cannot produce a sufficient elevation of cytoplasmic hydrogen peroxide to affect C118 of LET-60ras. Other elements of the data presented in Fig 4A, such as the enhanced vulva formation produced by PQ and the effect of the C118S mutation in the absence of SOD-1, are discussed further below.

Fig. 4. The SOD-1-dependent pool of cytoplasmic hydrogen peroxide regulates Ras via oxidation of C118.
The SOD-1-dependent pool of cytoplasmic hydrogen peroxide regulates Ras via oxidation of C118.
let-60ras(n1046)gf is denoted in the figure as let-60gf. ***P = 0.0001 compared to let-60rasgf or as indicated. A Number of vulvas of sod-1, let-60rasgf, sod-1; let-60rasgf and sod-1; let-60rasgf-C118S mutants in combination with PQ or NAC treatments. ###P = 0.0001 for PQ treatment compared to PQ treatment of let-60rasgf. +++P = 0.0001 for PQ treatment of sod-1; let-60rasgf-C118S compared to PQ treatment of sod-1; let-60rasgf. B Number of vulvas of long-lived mitochondrial mutants in an otherwise wild-type background and in combination with the let-60rasgf mutant, with and without the C118S mutation. ***P = 0.0001 compared to let-60rasgf for the first set of bars, and compared to let-60rasgf-C118S for the second set of bars. ###P = 0.0001 compared to the mutation in the let-60rasgf background. C Number of vulvas of sod-2 mutants in combination with sod-1 and the let-60rasgf mutation. D Number of vulvas of sod-2 mutants, in combination with the let-60rasgf mutation and NAC treatment. E A model that suggests a path by which PQ, SOD-1, and the loss of SOD-2, all increase cytoplasmic H2O2 and thereby suppress let-60rasgf. For simplicity SOD-1 is shown in the cytoplasm although it may also be in the mitochondrial inter-membrane space. F A representative Western blot for phosphorylated MPK-1a (pMPK-1a), total MPK-1a and Histone H3 as a loading control. Unprocessed original scans of blots and additional analyses are shown in S8 Fig. G The mean ratio of phosphorylated MPK-1a (pMPK-1a) to total MPK-1a ± SEM of three different Western blots. All bars are compared to the wild-type control bar. *P<0.01.

Ras signalling is sensitive to increased mitochondrial superoxide levels in mitochondrial mutants

Mitochondria are a site of ROS formation that has been studied extensively. Mitochondrially-derived ROS are believed to be involved in signals that affect mitochondrial dynamics [65], mitophagy and autophagy [66], apoptosis, responses to changes in oxygen levels particularly hypoxia, inflammatory responses [67, 68], wound healing [6, 69] and aging [70]. We used three mutations that have elevated mitochondrial superoxide levels. sod-2 mutants completely lack the main mitochondrial matrix superoxide dismutase SOD-2 [71]. isp-1 and nuo-6 are point mutants in subunits of the mitochondrial respiratory chain that lead to low electron transport, low ATP levels but high level of superoxide generation [72, 73]. All three mutations suppress the Muv phenotypes in double mutant combinations with let-60rasgf (Fig 4B). sod-2 suppresses by about 40% but isp-1 and nuo-6 suppresses almost completely (Fig 4B).

As described above, the loss of SOD-1 enhances the Muv phenotype (Fig 4A) while the loss of SOD-2 suppresses it (Fig 4B). We found that suppression of the Muv phenotype by loss of SOD-2 is partially abrogated by the loss of SOD-1 (Fig 4C) or by treatment with NAC (Fig 4D). These observations suggest that loss of mitochondrial SOD-2 suppresses let-60rasgf via a SOD-1-dependent increase in cytoplasmic or mitochondrial inter-membrane hydrogen peroxide (Fig 4E). This conclusion was supported by the finding that replacement of C118 with serine in the let-60rasgf background suppresses the effect of loss of SOD-2 on the Muv phenotype (Fig 4B). Fig 4E suggests a model of how the increased superoxide produced in the mitochondrial matrix in the absence of SOD-2 reaches the inter-membrane space and/or cytoplasm, where SOD-1 is located. The model includes that in the absence of a mitochondrial matrix SOD, superoxide can be transported out of both mitochondrial compartments into the cytoplasm through specialised channels [74, 75]. Thus, our results suggest that in the absence of SOD-2, superoxide exits the mitochondria to raise levels of hydrogen peroxide in the inter-membrane space and/or the cytoplasm through the action of SOD-1.

Similarly, we tested whether the Muv suppression by isp-1 and nuo-6 depended on C118 by scoring the Muv phenotype in isp-1 let-60rasgf-C118S and nuo-6; let-60rasgf-C118S double mutants (Fig 4B). The C118S replacement also suppressed the Muv suppression by these mitochondrial mutants. Since functional wild-type SOD-2 is present in isp-1 and nuo-6 mutants the effect of their known increased superoxide generation might act through a SOD-2-dependent production of hydrogen peroxide in the mitochondria. This excess mitochondrial hydrogen peroxide could participate to the cytoplasmic pool by exiting the mitochondria through passive membrane diffusion or through specialized channels [76] (Fig 4E). Consistent with what we observed for let-60ras(+)-C118S and let-60rasgf-C118S (Fig 3C and 3D), the isp-1 and nuo-6 mutations do not affect the levels of MPK-1 phosphorylation (Fig 4F and 4G and S8 Fig). In addition, the fact that the suppression of the effect of the ETC mutants by C118S is not complete suggests that other consequences of the mutations, such as low electron transport and low ATP levels might also participate in suppressing the Muv phenotype.

For our observations on the effect of sod-2, isp-1, and nuo-6 on the Muv phenotype we cannot exclude an alternative interpretation: that all the effects we observe are additive, rather than revealing interactions. However, given the known relationships between the cytoplasmic and mitochondrial ROS pools discussed and reviewed in the above paragraphs, this alternative model appears less likely.

The intracellular superoxide pool affects vulva formation by a separate pathway that is independent from hydrogen peroxide generation

As we have seen above, the C118S mutation produces an elevated Muv phenotype that is very similar to that produced by NAC, and NAC has no additional effects on C118S mutants. In addition, the suppression of the Muv phenotype by PQ is fully abolished by the C118S mutation (Fig 2D). Thus, let-60rasgf-C118S mutants, with or without NAC or PQ treatment, have almost the same Muv phenotype as let-60rasgf treated with NAC (Fig 2D). However, loss of SOD-1 in the let-60rasgf background produces an increase in the Muv phenotype that is significantly greater than that produced by NAC (Fig 4A). Furthermore, in the absence of SOD-1, PQ not only fails to suppress the Muv phenotype, it actually increases it (Fig 4A). In addition, the Muv increasing effect of PQ in the sod-1 background is even stronger in the absence of C118 in sod-1;let-60rasgf-C118S mutants (Fig 4A). Thus, increased superoxide formation by PQ in the absence of SOD-1 (which would convert it to hydrogen peroxide), and in the absence of a target for hydrogen peroxide (in the let-60rasgf-C118S background), leads to a stimulation of the Muv phenotype. Note that the fact that PQ simulates more in the let-60rasgf-C118S background means that there is likely residual hydrogen peroxide formation from PQ-dependent superoxide even in the absence of SOD-1. This residual hydrogen peroxide can act in an inhibitory fashion on C118. This effect is eliminated in the C118S mutant leading to even greater vulva formation under the action of PQ. Together, the observations presented in Fig 4A indicate the existence of a distinct pathway in which superoxide stimulates the Muv phenotype, independently of both SOD-1-dependent hydrogen peroxide formation and oxidation of C118.

The superoxide-stimulated pathway affects vulval development by acting downstream of LIN-1

let-60ras-dependent signalling is implemented by the ETS-transcription factor LIN-1 [48] (Fig 1A). For vulval development loss of LIN-1 is epistatic to changes in the LET-60ras-dependent pathway. Thus, processes that act downstream of LIN-1 to affect the Muv phenotype are likely to be at least partially epistatic to LET-60ras signalling. We observed that loss of SOD-1 has the same effect on lin-1 mutants as on let-60rasgf mutants, that is, it enhances the Muv phenotype (Fig 5A). However, PQ treatment has opposite effects on let-60rasgf and lin-1 mutants: while it suppresses the Muv phenotype of let-60rasgf it enhances lin-1 (Fig 5B). The effect of PQ is also additive to the effect of sod-1 (Fig 5B), which is the same pattern we observed for let-60rasgf in Fig 4A. Thus, an increase in intracellular superoxide resulting from loss of SOD-1 appears to stimulate a second pathway, independent of C118 of let-60ras and acting downstream of lin-1 (Fig 5C).

Fig. 5. The intracellular pool of superoxide affects vulva formation by a pathway that acts downstream of lin-1.
The intracellular pool of superoxide affects vulva formation by a pathway that acts downstream of <i>lin-1</i>.
let-60rasgf is denoted in the figure as let-60gf. ***P = 0.0001 compared to control as indicated. A Number of vulvas of sod-1 mutants in combination with the let-60rasgf and lin-1 mutations. B Number of vulvas of sod-1 mutants in combination with the let-60rasgf and lin-1 mutations and PQ. ### P = 0.0001 for the effect of PQ treatment compared to lin-1 with PQ treatment. C A model depicting the pathways by which cytoplasmic ROS affects vulval formation. Hydrogen peroxide inhibits vulval development by inhibiting LET-60 via oxidation of C118; superoxide promotes vulval development by acting downstream of LIN-1, on an unidentified target.

The two C. elegans NADPH oxidases, BLI-3 and DUOX-2 affect vulva formation

NADPH oxidases (NOXs) are the main enzymatic sources of ROS in the cell. As described in the introduction, NOXs are membrane-bound enzymes that produce superoxide. The Duox sub-class possesses an additional peroxidase domain and can thus convert superoxide into hydrogen peroxide. While DUOXs have well-established roles at the plasma membrane, there is evidence that they may also have intracellular roles, such as at the ER-membrane (reviewed in [25]). The C. elegans genome encodes for two DUOX proteins: BLI-3 and DUOX-2. BLI-3 is expressed in the hypodermis, where it is required for cross-linking of collagen to form the cuticle. Complete loss of bli-3 is lethal while reduction-of-function mutations in bli-3 lead to a blistered cuticle phenotype (Bli), molting defects and altered pathogen susceptibility [25, 77]. Significant expression of duox-2 has not been observed, and loss of duox-2 has not previously been associated with any phenotype [25]. In order to test whether NOX-derived ROS participates in vulva formation, we examined how mutants of the C. elegans BLI-3 and DUOX-2 affect the let-60rasgf Muv phenotype. The bli-3 mutation we used (e767) is in the peroxidase domain, and thus likely prevents hydrogen peroxide formation but not superoxide formation by BLI-3 [23]. The duox-2(ok1775) mutation is likely a strong loss-of-function mutation. We found that each of the NOX mutations leads to strong suppression of the Muv phenotype of let-60rasgf in double mutants (Fig 6A), suggesting that the wild-type function of both NOXs participate in stimulating the Muv phenotype. This is the first function that can be ascribed to DUOX-2. In addition to suppressing the Muv phenotype of let-60rasgf, loss of either of the NOXs renders the let-60rasgf mutants almost insensitive to NAC and PQ (Fig 6B and 6C). This indicates that the effect of the NOX mutations is epistatic to the effect of hydrogen peroxide on LET-60rasgf. However, we have not been able to link NOX activation to the elevation of the SOD-1-dependent intracellular superoxide pool that acts downstream on lin-1 (Fig 5) (see below).

Fig. 6. The NADPH oxidases BLI-3 and DUOX-2 affect vulva formation in a ROS-regulated manner.
The NADPH oxidases BLI-3 and DUOX-2 affect vulva formation in a ROS-regulated manner.
let-60rasgf is denoted in the figure as let-60gf. ****P = 0.0001 compared to let-60rasgf or control as indicated. A Number of vulvas of bli-3 and duox-2 mutants in combination with the let-60rasgf mutation alone, and in combination with ced-10rac-C18S and sod-1 mutations. ###P = 0.0001 for ced-10-C18S let-60gf and sod-1; let-60rasgf compared to let-60rasgf. B Number of vulvas of bli-3 mutants in combination with the let-60rasgf mutation, PQ and NAC. C Number of vulvas of duox-2 mutants in combination with the let-60rasgf mutation, PQ and NAC. D Model illustrating how BLI-3 and DUOX-2 promote vulval formation. ced-10rac activates the NOXs, which promote vulva formation through the production of hydrogen peroxide, and perhaps also superoxide. These ROS targets have not been identified. ced-10rac is inhibited by ROS via C18. Neither the source nor the nature of this ROS is known.

Evidence for the activation of the NOX pathway by ROS

The activity of NOX enzymes is stimulated by the small GTPase Rac [78]. There are three Rac-like GTPases in C. elegans (CED-10, MIG-2, and RAC-2/3), although it is not certain that RAC-2/3 is a functional protein [79]. CED-10 and MIG-2 regulate cytoskeletal dynamics and function in multiple processes in the C. elegans, including phagocytosis of cell corpses, cell migration, axon pathfinding and growth cone protrusion [79]. ced-10 and rac-2 mutants have defects in vulval development, which can mainly be attributed to their roles in vulval cell migrations, but they also have a weak, synthetic defect in vulval cell specification [80]. Rac GTPases can be regulated by ROS. In particular, oxidation of cysteine C18 (S9 Fig) has been found to lead to activation of Rac1 in vitro and in cultured mammalian cells [38]. In light of this, we focused on the Rac1 homologue ced-10 and used CRISPR to create a C18S allele, ced-10rac(qm229), which should be insensitive to ROS. This allele significantly enhanced the Muv phenotype in the let-60rasgf background (Fig 6A). This was the reverse of the effect expected from mammalian studies, as we would expect that inhibition of CED-10 would phenocopy duox-2 and bli-3 loss-of-function mutations, but it had the opposite effect. We interpret this to mean that oxidation of C18 of CED-10 inhibits the protein. This would be similar to what we observed for C118 of LET-60. In both cases, we observed that the loss of the cysteine leads to activation rather than to inhibition of the activity. Since the C18S mutation had the opposite effect to that of the duox-2 and bli-3 mutations, we tested whether Rac was acting through each of the C. elegans Duoxs by creating bli-3(e767); ced-10rac(qm229) and duox-2(ok1775); ced-10rac(qm229) double mutants. The enhancement by C18S was abolished by either of the NOX mutations (Fig 6A), suggesting that the C18S replacement stimulates the Muv phenotype through both of the NOXs (Fig 6D).

Next we wondered whether the increased superoxide due to loss of SOD-1, which stimulates the Muv phenotype (Fig 4A), acted through CED-10rac. To test for this we constructed the let-60gf; sod-1;bli-3 and let-60gf;sod-1;duox-2 triple mutants. However, the effects of loss of SOD-1 and that of the NOX mutations were additive (Fig 6A). In any case, oxidation of C18 of CED-10rac would be inhibitory (as revealed by the activating effect of C18S), but the loss of SOD-1 is activating (Fig 4A). Thus, if there was a link between the effect of loss of SOD-1 and activation of the NOXs it would need to include additional relays, which would remain to be identified. Thus, we consider the NOXs to promote vulval formation in a ROS-regulated manner, by acting in a pathway that is parallel to both LET-60ras and to intracellular superoxide (Fig 7).

Fig. 7. A model depicting three ROS-signalling pathways that affect vulval formation.
A model depicting three ROS-signalling pathways that affect vulval formation.
Cytoplasmic hydrogen peroxide inhibits vulva development by acting directly on LET-60ras, via oxidation of C118. The state of oxidation of C118 is affecting vulva formation independently from MPK-1 phosphorylation via an as yet uncharacterized pathway. The source of hydrogen peroxide is SOD-1 and is either converted from cytoplasmic superoxide or superoxide that exits the mitochondria in the absence of the mitochondrial superoxide dismutase SOD-2. SOD-2-dependent hydrogen peroxide produced in the mitochondria can also participate in the SOD-1-dependent cytoplasmic pool. Cytoplasmic superoxide inhibits vulval development by acting downstream of LIN-1, via an unknown target. The NADPH oxidases BLI-3 and DUOX-2 promote vulva development by an independent pathway. This pathway is ROS-dependent as the NADPH oxidases are activated by CED-10Rac, which is inhibited by ROS via C18, however, the source and nature of this ROS are not known. The targets of NADPH oxidase-produced ROS have not been identified. It is also not known whether for vulva development NADPH oxidases act at the plasma membrane and produce ROS extracellularly, or whether they act at the ER membrane and produce ROS in the ER. All pathways are depicted as acting in the same cell although it is possible that the different signalling pathways act in different cell types and could thereby participate in intercellular communication during vulva development.

Discussion

Our observations demonstrate that, by using molecular genetics, ROS signalling can be studied in a fully in vivo situation with the same detail as other forms of signal transduction. Findings in other systems such as yeast [81] and with other pathways such as the UPRER in C. elegans [5], reinforce this conclusion. ROS signalling resembles signalling through cAMP in that diffusible messages (ROS species) have sources and sinks. It resembles Ca++ signalling in its clear-cut compartmentalization, and it resembles phosphorylation in reversibly targeting specific residues and thus altering protein function. This last feature is particularly powerful for molecular genetic dissection of ROS signalling pathways and functions. There have been many efforts to obtain fluorescent probes for visualizing ROS in living cells similar to tools that allow to visualize calcium [82]. However, for many applications these techniques suffer from lack of resolution and specificity. Although better tools for visualization would be highly desirable, our findings demonstrate that detailed information about ROS signalling can be obtained despite the lack of sufficiently powerful visualization tools.

Our findings suggest that ROS produced in mitochondria can participate in cytoplasmic ROS signalling in multiple ways (Figs 4E and 7). In the presence of mitochondrial superoxide dismutase (SOD-2), superoxide produced in the mitochondrial matrix is converted to hydrogen peroxide and can contribute to the cytoplasmic pool of this species. In the absence of SOD-2, superoxide exits the mitochondrial matrix, where it is converted to hydrogen peroxide by the cytoplasmic superoxide dismutase (SOD-1) and participates in ROS signalling in the cytoplasm. At this stage we don’t know whether hydrogen peroxide directly modifies C118 as observed with other redox sensitive cysteines [83], or whether it is required for oxidation via additional steps.

In addition to a role for hydrogen peroxide, we also identified a specific signalling role for superoxide (Figs 5C and 7). By elevating the cytoplasmic superoxide pool by removal of SOD-1, with or without concomitant PQ treatment to enhance the effect, we showed that it can affect the Muv phenotype downstream of LIN-1, by acting on an as yet unidentified target. Interestingly, Xu and Chisholm have also demonstrated a specific role for superoxide in C. elegans wound healing. They showed that mitochondrial superoxide targets the C. elegans Rho GTPase RHO-1 [6]. Epidermal wounding causes a local increase in mitochondrial superoxide, which inhibits RHO-1 via the redox sensitive cysteines C16 and C20, and this promotes actin-dependent wound closure.

The NOX system is a transmembrane signalling system that can release ROS extracellularly or intracellularly [12] including in C. elegans [5, 25] We found that the activity of the NOXs could affect vulva formation independently of ROS regulation of LET-60rasgf via C118 (Figs 6B, 6C and 7). At this stage we don’t know if for this function the NOXs act intracellularly or extracellularly. The NOXs appear themselves to be regulated by intracellular ROS via oxidation of C18 of CED-10rac (Fig 6A and 6D). However, the species (e.g. superoxide or hydrogen peroxide) and the origin of the ROS that regulate CED-10rac, and thus the NOXs, is still unknown. We have also yet to identify the direct targets of cytoplasmic superoxide, and the targets of the NOX-derived ROS.

We identified two key targets of cytoplasmic ROS regulation of vulva formation as known redox sensitive cysteines in the small GTPases LET-60ras (C118) and CED-10rac (C18). Strikingly, we observed that in C. elegans, oxidation of C118 in LET-60ras and C18 in CED-10rac is inhibitory, while in vitro and cell culture experiments in mammalian cells have suggested they would be stimulatory by promoting guanine nucleotide dissociation. How to explain these differences? One important difference is that C. elegans does not produce, and likely doesn’t use, nitric oxide (NO) [57]. Thus, the cysteines that are susceptible to oxidation by NO are free to be oxidized by different reactive species, which might result in different effects on the target protein. It is also possible that the cellular redox conditions are different in C. elegans and mammalian cells, including differences in the concentration of various ROS species or the amplitude of variations in these concentrations. More generally redox conditions in vivo, in C. elegans and in mammals, might be very different from those in cultured cells. For example, most mammalian cell types experience low levels of oxygen, low levels of hormonal stimulation, and possibly very low or no amounts of NO. Thus, some of the findings in mammalian cells might be only pertain to the conditions in cultured cells. In contrast, our tools to manipulate ROS levels are all compatible with normal or extended survival of the animals.

In addition, the cellular redox conditions (as well as the composition of the cellular milieu in the direct vicinity of a ROS target) will contribute to determining whether a modification is inhibitory or stimulatory. That is to say, reactive nitrogen, superoxide and hydrogen peroxide promote Ras guanine nucleotide dissociation. But this by itself is not activating, it’s only activating under conditions that allow Ras to be competent to re-associate with GTP. Of note, in vitro, prolonged exposure of Ras in the presence of oxidants and GTP do not result in significant fraction of GTP-bound Ras, unless a radical scavenger is also included in the reaction [31].

We observed that PQ and NAC treatment and the C118S mutation, as well as isp-1 and nuo-6 mutations, have no effect on the enhanced MPK-1 phosphorylation resulting from the n1046gf allele, suggesting that the state of oxidation of LET-60ras affects a pathway that does not affect MPK-1 phosphorylation but that modulates vulva formation in the presence of elevated MPK-1 phosphorylation. We have no information yet as to the nature of this pathway. However, there is other evidence that such pathways may exist. For example, let-60ras mutants have many phenotypes in addition to vulval development, that indicate that LET-60ras acts in multiple cell types and tissues. mpk-1 mutants share most of these phenotypes, suggesting that LET-60ras mainly signals through MPK-1 [47]. However, there are also some let-60ras phenotypes which are either not shared by mpk-1 mutants, or for which an involvement of mpk-1 has not been examined [42, 47], suggesting that there may be other effectors of LET-60ras. Even for vulval development, where it has been clearly established that LET-60ras acts via MPK-1 [84], it has also recently been shown that there is also MPK-1-independent signaling. In some VPCs LET-60ras acts through an alternative pathway, via RGL-1(RalGEF) and RAL-1(Ral), to specify the secondary vulval cell fate [85].

The possibility that mimicking constitutive oxidation of C118 suppresses a classical gain-of-function allele similar to oncogenic alleles in mammals is potentially of great interest. It suggests that the reason why mutations in the N-terminal G12 and G13 of Ras produce a gain-of-function could be intimately linked to events that involve the oxidation of C118. When C118 looks like it is permanently oxidized (with the C118D mutation) the G13E oncogenic mutation is fully suppressed. On the other hand, we found that the LET-60rasgf-C118D double mutant protein is expressed at a significantly lower level than LET-60rasgf. This lower level might be the basis for the complete suppression of the effect of n1046gf on MPK-1. However, given that PQ has no effect on protein levels or MPK-1 phosphorylation, we favor the model that both effects (the mimicking of constitutive strong oxidation and low level of expression) might be necessary for the complete suppression conferred by the C118D mutation. Identification of the hypothetical pathway downstream of LET-60ras oxidation could help resolve this issue in the future.

Materials and methods

General methods and strains

All animals were grown at 20°C and cultured on NGM plates. The Bristol strain N2 was used as the wild type. The mutations used in this study are as follows: nuo-6(qm200), sod-2(ok1030), bli-3(e767), duox-2(ok1775) I, sod-1(tm783) II, isp-1(qm150), let-60(n1046), let-60(n1700), let-60(ga89) and lin-1(e1026) IV. For temperature shift experiments, let-60(ga89) adults were switch to the restrictive temperature (26°C) as adults and the progeny was used for the assay.

For testing the effects of Methyl viologen dichloride hydrate/Paraquat (PQ; Sigma-Aldrich 856177) and N-Acetyl-Cysteine (NAC; Sigma-Aldrich A7250), compounds were dissolved in water and stored at 4°C. The compounds were added to the NGM just before pouring the plates. The final concentrations of PQ and NAC used for vulva studies were 0.1 mM and 9 mM, respectively.

CRISPR modifications of let-60 and ced-10

The LET-60 amino acid Cys118 (C118) and the CED-10 amino acid Cys18 (C18) were modified using the CRISPR/Cas9 gene editing protocol as described [58]. Briefly, http://crispr.mit.edu was used to select crRNA sequences targeting let-60 or ced-10. The let-60 gene-specific crRNA (5’-AGGTTCCTATGGTCTTGGTAGUUUUAGAGCUAUGCUGUUUUG-3’), the ced-10 gene-specific crRNA (5’-CGTTTGTGGTGTAGGATATCGUUUUAGAGCUAUGCUGUUUUG-3‘), the coCRISPR dpy-10 crRNA and the tracRNA (Dharmacon) were re-suspended in 10mM Tris pH 7.4 to 8 μg/μl. The purified Cas9 protein (PNA Bio. Inc.) was reconstituted in water to 2 mg/ml. The repair templates for let-60-C118S (5’-TGAAATTATCAGTCAATGGTTGAATATTTGTATTTCTTCTAGGTTCCTATGGTGTTGGTAGGCAATAAATCTGATTTGTCATCTCGATCAGTCGACTTCCGAACAGTCAGTGAGACA-3’), let-60-C118D (5’-TGAAATTATCAGTCAATGGTTGAATATTTGTATTTCTTCTAGGTTCCTATGGTGTTGGTAGGCAATAAAGATGATTTGTCATCTCGATCAGTCGACTTCCGAACAGTCAGTGAGACA-3’) and ced-10-C18S (5’-ATGCAAGCGATCAAATGTGTCGTCGTTGGTGACGGAGCCGTCGGTAAAACGTCTCTACTGATCTCCTACACCACAAACGCATTTCCCGGAGAATATATTCCGACGGTGAGTCATTT-3’) (IDT) were resuspended in water to 1 μg/μl and 500 ng/μl for dpy-10. The injection mix contained 6.25 μl Cas9 protein, 1.25 μl tracrRNA, 0.2 μl crRNA dpy-10, 0.275 μl ssODN dpy-10, 0.5 μl crRNA let-60 or ced-10, 1.1 μl ssODN let-60-C118S, let-60-C118D or ced-10-C18S, 0.25 μl KCl (1M) and 0.375 μl Hepes pH 7.4 (200 mM). The mix was activated for 15 min at 37°C and injected into distal gonads of young adult worms. F1 roller worms were singled out and after they laid eggs, were genotyped by single worm lysis and PCR using the primers 5’-GTGAGACATGCCTCCTCGAC-3‘ and 5‘-GGTGTCGTATTTTTGGCGCGA-3‘ for the let-60 modifications and the primers 5’-CGTCTTGATGCCCGTTGTG-3‘ and 5‘-GCTGTATCCCAGAGCCCGA-3‘ for the ced-10 modification. The let-60 modifications were confirmed by sequencing the PCR product, whereas the ced-10 modification was confirmed by digesting the PCR product with EcoRV (R0195S, New England Biolabs) since isoleucine 21 of CED-10, which is encoded by ATA codon, creates an EcoRV cut site which is removed by successful editing. The non-roller F2 worms were sequenced to verify successful editing.

Western blotting

200 synchronized young adult worms were harvested and washed in M9 buffer, and finally placed into 50 μl of 1x SDS sample buffer. The samples were lysed at 95°C for 5 min followed by centrifugation at 13,000 rpm for 1 min. For each blot and each sample 15 μl of the supernatant was loaded on to a 10% SDS‐PAGE gel followed by electro-transfer to nitrocellulose membrane. Primary antibodies were anti-di-phosphorylated ERK-1&2 antibody (1:1000, Sigma), anti-ERK1/2 antibody (1:1000, Cell Signalling Technology), Anti-Ras antibody [EPR3255] (1:1000, Abcam), anti-Tubulin antibody (1:1000, Sigma), and anti-Histone H3 antibody (1:2000, Abcam). After overnight incubation with the primary antibodies, membranes were washed 3 times with PBS-Tween and incubated with secondary antibodies which were anti-rabbit or anti-mouse conjugated to HRP (1:2000, Cell Signalling Technology). Blots were visualized using ECL (GE Healthcare) and film. Band intensity quantification was performed using Image J software (http://imagej.nih.gov/ij/).

Quantitative Real-Time PCR

Synchronized worms were harvested at the young-adult stage, as for Western Blotting. RNA was isolated using TRIzol reagent (Invitrogen) and was transcribed into cDNA using qScript XLT cDNA SuperMix (Quanta Biosciences). Real-time PCR was performed on a CFX96 qPCR system (Bio-Rad) with the Luna Universal Probe qPCR Master Mix (NEB) according to the manufacturer's instruction. The following primers are used: LET-60 forward: 5’- GTCAGTGAGACAGCAAAGGGT-3’, reverse: 5’-CGTGACGCTCACGATGCTTG-3’; PMP-3 forward: 5’-GTTCCCGTGTTCATCACTCAT-3’, reverse: 5’-ACACCGTCGAGAAGCTGTAGA-3’. The gene pmp-3 was used as the normalisation control.

Multivulva phenotype scoring

Adult worms were transferred to control NGM plates or plates containing PQ or NAC for a 3- hour limited egg-laying. Once hatched worms reached adulthood with completed vulval formation, animals were scored for the presence of a normal vulva as well as the ectopic pseudovulvas. We report the total number of vulvas, which includes both. The controls shown are always scored in parallel for every experiment. All numerical data are presented in S1 Table.

Statistical analyses

For scoring of the multivulva phenotype, experimental strains were compared to the control using one-way ANOVA followed by Dunnett’s multiple comparison test, which corrects for multiple comparisons. P-values and samples sizes are reported in S1 Table. For comparing % Muv, the Chi-square test was used. For Western Blot quantifications, ratios of phosphorylated pMPK-1a to total MPK-1 or LET-60 levels normalised to the wild-type control were compared using one-way ANOVA followed by Dunnett’s multiple comparison test. All statistical analyses were carried out using Graphpad Prism 7.03.

Supporting information

S1 Fig [g13]
Alignment of RAS proteins from . and . with isoforms from humans.

S2 Fig [n1046]
Effect of PQ and NAC on the Muv phenotype of three alleles.

S3 Fig [tif]
Oxidation of C118 of LET-60ras inhibits the specification of vulval cell fates.

S4 Fig [sem]
Western blot analysis of MPK-1 levels in WT and mutants.

S5 Fig [sem]
Western blot analysis of MPK-1 levels in WT and mutants treated with PQ and NAC.

S6 Fig [tif]
Western blot analysis of LET-60 levels in WT and mutants.

S7 Fig [tif]
mRNA expression levels of in C118S and C11D mutants.

S8 Fig [sem]
Western blot analysis of MPK-1 levels in and mutants.

S9 Fig [c18]
Alignment of Rac proteins from . , . and humans.

S1 Table [docx]
Numerical values for Muv data shown in bar graphs in all figures.


Zdroje

1. Holmstrom KM, Finkel T. Cellular mechanisms and physiological consequences of redox-dependent signalling. Nat Rev Mol Cell Biol. 2014;15(6):411–21. doi: 10.1038/nrm3801 24854789.

2. Sena LA, Chandel NS. Physiological roles of mitochondrial reactive oxygen species. Mol Cell. 2012;48(2):158–67. doi: 10.1016/j.molcel.2012.09.025 23102266; PubMed Central PMCID: PMC3484374.

3. Putker M, Madl T, Vos HR, de Ruiter H, Visscher M, van den Berg MC, et al. Redox-dependent control of FOXO/DAF-16 by transportin-1. Mol Cell. 2013;49(4):730–42. doi: 10.1016/j.molcel.2012.12.014 23333309.

4. Shibata Y, Branicky R, Landaverde IO, Hekimi S. Redox regulation of germline and vulval development in Caenorhabditis elegans. Science. 2003;302(5651):1779–82. doi: 10.1126/science.1087167 14657502.

5. Hourihan JM, Moronetti Mazzeo LE, Fernandez-Cardenas LP, Blackwell TK. Cysteine Sulfenylation Directs IRE-1 to Activate the SKN-1/Nrf2 Antioxidant Response. Mol Cell. 2016;63(4):553–66. doi: 10.1016/j.molcel.2016.07.019 27540856; PubMed Central PMCID: PMC4996358.

6. Xu S, Chisholm AD. C. elegans epidermal wounding induces a mitochondrial ROS burst that promotes wound repair. Dev Cell. 2014;31(1):48–60. doi: 10.1016/j.devcel.2014.08.002 25313960; PubMed Central PMCID: PMC4197410.

7. Ewald CY, Hourihan JM, Bland MS, Obieglo C, Katic I, Moronetti Mazzeo LE, et al. NADPH oxidase-mediated redox signaling promotes oxidative stress resistance and longevity through memo-1 in C. elegans. Elife. 2017;6. doi: 10.7554/eLife.19493 28085666; PubMed Central PMCID: PMC5235354.

8. Schmeisser S, Priebe S, Groth M, Monajembashi S, Hemmerich P, Guthke R, et al. Neuronal ROS signaling rather than AMPK/sirtuin-mediated energy sensing links dietary restriction to lifespan extension. Mol Metab. 2013;2(2):92–102. doi: 10.1016/j.molmet.2013.02.002 24199155; PubMed Central PMCID: PMC3817383.

9. Murphy MP. How mitochondria produce reactive oxygen species. Biochem J. 2009;417(1):1–13. doi: 10.1042/BJ20081386 19061483; PubMed Central PMCID: PMC2605959.

10. Kundu TK, Velayutham M, Zweier JL. Aldehyde oxidase functions as a superoxide generating NADH oxidase: an important redox regulated pathway of cellular oxygen radical formation. Biochemistry. 2012;51(13):2930–9. doi: 10.1021/bi3000879 22404107; PubMed Central PMCID: PMC3954720.

11. Zangar RC, Davydov DR, Verma S. Mechanisms that regulate production of reactive oxygen species by cytochrome P450. Toxicol Appl Pharmacol. 2004;199(3):316–31. doi: 10.1016/j.taap.2004.01.018 15364547.

12. Bedard K, Krause KH. The NOX family of ROS-generating NADPH oxidases: physiology and pathophysiology. Physiol Rev. 2007;87(1):245–313. doi: 10.1152/physrev.00044.2005 17237347.

13. Fridovich I. Superoxide anion radical (O2-.), superoxide dismutases, and related matters. J Biol Chem. 1997;272(30):18515–7. doi: 10.1074/jbc.272.30.18515 9228011.

14. Kelley EE, Khoo NK, Hundley NJ, Malik UZ, Freeman BA, Tarpey MM. Hydrogen peroxide is the major oxidant product of xanthine oxidase. Free Radic Biol Med. 2010;48(4):493–8. doi: 10.1016/j.freeradbiomed.2009.11.012 19941951; PubMed Central PMCID: PMC2848256.

15. Edmondson DE. Hydrogen peroxide produced by mitochondrial monoamine oxidase catalysis: biological implications. Curr Pharm Des. 2014;20(2):155–60. doi: 10.2174/13816128113190990406 23701542.

16. Lambeth JD, Neish AS. Nox enzymes and new thinking on reactive oxygen: a double-edged sword revisited. Annu Rev Pathol. 2014;9:119–45. doi: 10.1146/annurev-pathol-012513-104651 24050626.

17. Zamocky M, Koller F. Understanding the structure and function of catalases: clues from molecular evolution and in vitro mutagenesis. Prog Biophys Mol Biol. 1999;72(1):19–66. doi: 10.1016/s0079-6107(98)00058-3 10446501.

18. Toppo S, Flohe L, Ursini F, Vanin S, Maiorino M. Catalytic mechanisms and specificities of glutathione peroxidases: variations of a basic scheme. Biochim Biophys Acta. 2009;1790(11):1486–500. doi: 10.1016/j.bbagen.2009.04.007 19376195.

19. Hanschmann EM, Godoy JR, Berndt C, Hudemann C, Lillig CH. Thioredoxins, glutaredoxins, and peroxiredoxins—molecular mechanisms and health significance: from cofactors to antioxidants to redox signaling. Antioxid Redox Signal. 2013;19(13):1539–605. doi: 10.1089/ars.2012.4599 23397885; PubMed Central PMCID: PMC3797455.

20. Wang Y, Branicky R, Noe A, Hekimi S. Superoxide dismutases: Dual roles in controlling ROS damage and regulating ROS signaling. J Cell Biol. 2018;217(6):1915–28. doi: 10.1083/jcb.201708007 29669742; PubMed Central PMCID: PMC5987716.

21. Meitzler JL, Brandman R, Ortiz de Montellano PR. Perturbed heme binding is responsible for the blistering phenotype associated with mutations in the Caenorhabditis elegans dual oxidase 1 (DUOX1) peroxidase domain. J Biol Chem. 2010;285(52):40991–1000. doi: 10.1074/jbc.M110.170902 20947510; PubMed Central PMCID: PMC3003398.

22. Thein MC, Winter AD, Stepek G, McCormack G, Stapleton G, Johnstone IL, et al. Combined extracellular matrix cross-linking activity of the peroxidase MLT-7 and the dual oxidase BLI-3 is critical for post-embryonic viability in Caenorhabditis elegans. J Biol Chem. 2009;284(26):17549–63. doi: 10.1074/jbc.M900831200 19406744; PubMed Central PMCID: PMC2719394.

23. Edens WA, Sharling L, Cheng G, Shapira R, Kinkade JM, Lee T, et al. Tyrosine cross-linking of extracellular matrix is catalyzed by Duox, a multidomain oxidase/peroxidase with homology to the phagocyte oxidase subunit gp91phox. J Cell Biol. 2001;154(4):879–91. doi: 10.1083/jcb.200103132 11514595; PubMed Central PMCID: PMC2196470.

24. McCallum KC, Garsin DA. The Role of Reactive Oxygen Species in Modulating the Caenorhabditis elegans Immune Response. PLoS Pathog. 2016;12(11):e1005923. doi: 10.1371/journal.ppat.1005923 27832190; PubMed Central PMCID: PMC5104326.

25. Ewald CY. Redox Signaling of NADPH Oxidases Regulates Oxidative Stress Responses, Immunity and Aging. Antioxidants (Basel). 2018;7(10). doi: 10.3390/antiox7100130 30274229; PubMed Central PMCID: PMC6210377.

26. Guyton KZ, Liu Y, Gorospe M, Xu Q, Holbrook NJ. Activation of mitogen-activated protein kinase by H2O2. Role in cell survival following oxidant injury. J Biol Chem. 1996;271(8):4138–42. doi: 10.1074/jbc.271.8.4138 8626753.

27. Lander HM, Hajjar DP, Hempstead BL, Mirza UA, Chait BT, Campbell S, et al. A molecular redox switch on p21(ras). Structural basis for the nitric oxide-p21(ras) interaction. J Biol Chem. 1997;272(7):4323–6. doi: 10.1074/jbc.272.7.4323 9020151.

28. Liu Y, Zhi D, Li M, Liu D, Wang X, Wu Z, et al. Shengmai Formula suppressed over-activated Ras/MAPK pathway in C. elegans by opening mitochondrial permeability transition pore via regulating cyclophilin D. Sci Rep. 2016;6:38934. doi: 10.1038/srep38934 27982058; PubMed Central PMCID: PMC5159904.

29. Heo J, Campbell SL. Superoxide anion radical modulates the activity of Ras and Ras-related GTPases by a radical-based mechanism similar to that of nitric oxide. J Biol Chem. 2005;280(13):12438–45. doi: 10.1074/jbc.M414282200 15684418.

30. Heo J, Prutzman KC, Mocanu V, Campbell SL. Mechanism of free radical nitric oxide-mediated Ras guanine nucleotide dissociation. J Mol Biol. 2005;346(5):1423–40. doi: 10.1016/j.jmb.2004.12.050 15713491.

31. Heo J, Campbell SL. Ras regulation by reactive oxygen and nitrogen species. Biochemistry. 2006;45(7):2200–10. doi: 10.1021/bi051872m 16475808.

32. Heo J, Campbell SL. Mechanism of p21Ras S-nitrosylation and kinetics of nitric oxide-mediated guanine nucleotide exchange. Biochemistry. 2004;43(8):2314–22. doi: 10.1021/bi035275g 14979728.

33. Mott HR, Carpenter JW, Campbell SL. Structural and functional analysis of a mutant Ras protein that is insensitive to nitric oxide activation. Biochemistry. 1997;36(12):3640–4. doi: 10.1021/bi962790o 9132016.

34. Huang L, Counter CM. Reduced HRAS G12V-Driven Tumorigenesis of Cell Lines Expressing KRAS C118S. PLoS One. 2015;10(4):e0123918. doi: 10.1371/journal.pone.0123918 25902334; PubMed Central PMCID: PMC4406447.

35. Ibiza S, Perez-Rodriguez A, Ortega A, Martinez-Ruiz A, Barreiro O, Garcia-Dominguez CA, et al. Endothelial nitric oxide synthase regulates N-Ras activation on the Golgi complex of antigen-stimulated T cells. Proc Natl Acad Sci U S A. 2008;105(30):10507–12. doi: 10.1073/pnas.0711062105 18641128; PubMed Central PMCID: PMC2492470.

36. Mallis RJ, Buss JE, Thomas JA. Oxidative modification of H-ras: S-thiolation and S-nitrosylation of reactive cysteines. Biochem J. 2001;355(Pt 1):145–53. doi: 10.1042/0264-6021:3550145 11256959; PubMed Central PMCID: PMC1221722.

37. Huang L, Carney J, Cardona DM, Counter CM. Decreased tumorigenesis in mice with a Kras point mutation at C118. Nat Commun. 2014;5:5410. doi: 10.1038/ncomms6410 25394415; PubMed Central PMCID: PMC4234187.

38. Hobbs GA, Mitchell LE, Arrington ME, Gunawardena HP, DeCristo MJ, Loeser RF, et al. Redox regulation of Rac1 by thiol oxidation. Free Radic Biol Med. 2015;79:237–50. doi: 10.1016/j.freeradbiomed.2014.09.027 25289457; PubMed Central PMCID: PMC4708892.

39. Heo J, Raines KW, Mocanu V, Campbell SL. Redox regulation of RhoA. Biochemistry. 2006;45(48):14481–9. doi: 10.1021/bi0610101 17128987.

40. Permyakov SE, Zernii EY, Knyazeva EL, Denesyuk AI, Nazipova AA, Kolpakova TV, et al. Oxidation mimicking substitution of conservative cysteine in recoverin suppresses its membrane association. Amino Acids. 2012;42(4):1435–42. doi: 10.1007/s00726-011-0843-0 21344177.

41. Sternberg PW. Vulval development In: Community TCeR, editor. WormBook2005.

42. Sundaram MV. Canonical RTK-Ras-ERK signaling and related alternative pathways. WormBook. 2013:1–38. doi: 10.1895/wormbook.1.80.2 23908058; PubMed Central PMCID: PMC3885983.

43. Reiner DJ, Lundquist EA. Small GTPases. In: Community TCeR, editor. WormBook: WormBook.

44. Han M, Sternberg PW. let-60, a gene that specifies cell fates during C. elegans vulval induction, encodes a ras protein. Cell. 1990;63(5):921–31. doi: 10.1016/0092-8674(90)90495-z 2257629.

45. Smith MJ, Neel BG, Ikura M. NMR-based functional profiling of RASopathies and oncogenic RAS mutations. Proc Natl Acad Sci U S A. 2013;110(12):4574–9. doi: 10.1073/pnas.1218173110 23487764; PubMed Central PMCID: PMC3607025.

46. Lu S, Jang H, Nussinov R, Zhang J. The Structural Basis of Oncogenic Mutations G12, G13 and Q61 in Small GTPase K-Ras4B. Sci Rep. 2016;6:21949. doi: 10.1038/srep21949 26902995; PubMed Central PMCID: PMC4763299.

47. Lackner MR, Kim SK. Genetic analysis of the Caenorhabditis elegans MAP kinase gene mpk-1. Genetics. 1998;150(1):103–17. 9725833; PubMed Central PMCID: PMC1460334.

48. Beitel GJ, Tuck S, Greenwald I, Horvitz HR. The Caenorhabditis elegans gene lin-1 encodes an ETS-domain protein and defines a branch of the vulval induction pathway. Genes Dev. 1995;9(24):3149–62. doi: 10.1101/gad.9.24.3149 8543158.

49. Reczek CR, Birsoy K, Kong H, Martinez-Reyes I, Wang T, Gao P, et al. A CRISPR screen identifies a pathway required for paraquat-induced cell death. Nat Chem Biol. 2017;13(12):1274–9. doi: 10.1038/nchembio.2499 29058724; PubMed Central PMCID: PMC5698099.

50. Cocheme HM, Murphy MP. Complex I is the major site of mitochondrial superoxide production by paraquat. J Biol Chem. 2008;283(4):1786–98. doi: 10.1074/jbc.M708597200 18039652.

51. Castello PR, Drechsel DA, Patel M. Mitochondria are a major source of paraquat-induced reactive oxygen species production in the brain. J Biol Chem. 2007;282(19):14186–93. doi: 10.1074/jbc.M700827200 17389593; PubMed Central PMCID: PMC3088512.

52. Yang W, Hekimi S. A mitochondrial superoxide signal triggers increased longevity in Caenorhabditis elegans. PLoS Biol. 2010;8(12):e1000556. doi: 10.1371/journal.pbio.1000556 21151885; PubMed Central PMCID: PMC2998438.

53. Yang W, Li J, Hekimi S. A Measurable increase in oxidative damage due to reduction in superoxide detoxification fails to shorten the life span of long-lived mitochondrial mutants of Caenorhabditis elegans. Genetics. 2007;177(4):2063–74. doi: 10.1534/genetics.107.080788 18073424; PubMed Central PMCID: PMC2219504.

54. Aruoma OI, Halliwell B, Hoey BM, Butler J. The antioxidant action of N-acetylcysteine: its reaction with hydrogen peroxide, hydroxyl radical, superoxide, and hypochlorous acid. Free Radic Biol Med. 1989;6(6):593–7. doi: 10.1016/0891-5849(89)90066-x 2546864.

55. Desjardins D, Cacho-Valadez B, Liu JL, Wang Y, Yee C, Bernard K, et al. Antioxidants reveal an inverted U-shaped dose-response relationship between reactive oxygen species levels and the rate of aging in Caenorhabditis elegans. Aging Cell. 2017;16(1):104–12. Epub 2016/09/30. doi: 10.1111/acel.12528 27683245; PubMed Central PMCID: PMC5242296.

56. Eisenmann DM, Kim SK. Mechanism of activation of the Caenorhabditis elegans ras homologue let-60 by a novel, temperature-sensitive, gain-of-function mutation. Genetics. 1997;146(2):553–65. Epub 1997/06/01. 9178006; PubMed Central PMCID: PMC1207997.

57. Morton DB, Hudson ML, Waters E, O'Shea M. Soluble guanylyl cyclases in Caenorhabditis elegans: NO is not the answer. Curr Biol. 1999;9(15):R546–7. doi: 10.1016/s0960-9822(99)80349-2 10469574.

58. Paix A, Folkmann A, Rasoloson D, Seydoux G. High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics. 2015;201(1):47–54. doi: 10.1534/genetics.115.179382 26187122; PubMed Central PMCID: PMC4566275.

59. Lo Conte M, Carroll KS. The redox biochemistry of protein sulfenylation and sulfinylation. J Biol Chem. 2013;288(37):26480–8. doi: 10.1074/jbc.R113.467738 23861405; PubMed Central PMCID: PMC3772195.

60. Romagnolo B, Jiang M, Kiraly M, Breton C, Begley R, Wang J, et al. Downstream targets of let-60 Ras in Caenorhabditis elegans. Dev Biol. 2002;247(1):127–36. doi: 10.1006/dbio.2002.0692 12074557.

61. Ohmachi M, Rocheleau CE, Church D, Lambie E, Schedl T, Sundaram MV. C. elegans ksr-1 and ksr-2 have both unique and redundant functions and are required for MPK-1 ERK phosphorylation. Curr Biol. 2002;12(5):427–33. doi: 10.1016/s0960-9822(02)00690-5 11882296.

62. Sundaram M, Han M. The C. elegans ksr-1 gene encodes a novel Raf-related kinase involved in Ras-mediated signal transduction. Cell. 1995;83(6):889–901. Epub 1995/12/15. doi: 10.1016/0092-8674(95)90205-8 8521513.

63. Doonan R, McElwee JJ, Matthijssens F, Walker GA, Houthoofd K, Back P, et al. Against the oxidative damage theory of aging: superoxide dismutases protect against oxidative stress but have little or no effect on life span in Caenorhabditis elegans. Genes Dev. 2008;22(23):3236–41. doi: 10.1101/gad.504808 19056880; PubMed Central PMCID: PMC2600764.

64. Yanase S, Onodera A, Tedesco P, Johnson TE, Ishii N. SOD-1 deletions in Caenorhabditis elegans alter the localization of intracellular reactive oxygen species and show molecular compensation. J Gerontol A Biol Sci Med Sci. 2009;64(5):530–9. doi: 10.1093/gerona/glp020 19282511.

65. Jezek J, Cooper KF, Strich R. Reactive Oxygen Species and Mitochondrial Dynamics: The Yin and Yang of Mitochondrial Dysfunction and Cancer Progression. Antioxidants (Basel). 2018;7(1). doi: 10.3390/antiox7010013 29337889; PubMed Central PMCID: PMC5789323.

66. Lee J, Giordano S, Zhang J. Autophagy, mitochondria and oxidative stress: cross-talk and redox signalling. Biochem J. 2012;441(2):523–40. doi: 10.1042/BJ20111451 22187934; PubMed Central PMCID: PMC3258656.

67. Chandel NS. Mitochondria as signaling organelles. BMC Biol. 2014;12:34. doi: 10.1186/1741-7007-12-34 24884669; PubMed Central PMCID: PMC4035690.

68. Finkel T. Signal transduction by reactive oxygen species. J Cell Biol. 2011;194(1):7–15. doi: 10.1083/jcb.201102095 21746850; PubMed Central PMCID: PMC3135394.

69. Shadel GS, Horvath TL. Mitochondrial ROS signaling in organismal homeostasis. Cell. 2015;163(3):560–9. doi: 10.1016/j.cell.2015.10.001 26496603; PubMed Central PMCID: PMC4634671.

70. Van Raamsdonk JM, Hekimi S. Reactive Oxygen Species and Aging in Caenorhabditis elegans: Causal or Casual Relationship? Antioxid Redox Signal. 2010;13(12):1911–53. doi: 10.1089/ars.2010.3215 20568954.

71. Van Raamsdonk JM, Hekimi S. Deletion of the mitochondrial superoxide dismutase sod-2 extends lifespan in Caenorhabditis elegans. PLoS Genet. 2009;5(2):e1000361. doi: 10.1371/journal.pgen.1000361 19197346; PubMed Central PMCID: PMC2628729.

72. Feng J, Bussiere F, Hekimi S. Mitochondrial electron transport is a key determinant of life span in Caenorhabditis elegans. Dev Cell. 2001;1(5):633–44. doi: 10.1016/s1534-5807(01)00071-5 11709184.

73. Yang W, Hekimi S. Two modes of mitochondrial dysfunction lead independently to lifespan extension in Caenorhabditis elegans. Aging Cell. 2010;9(3):433–47. doi: 10.1111/j.1474-9726.2010.00571.x 20346072.

74. Han D, Antunes F, Canali R, Rettori D, Cadenas E. Voltage-dependent anion channels control the release of the superoxide anion from mitochondria to cytosol. J Biol Chem. 2003;278(8):5557–63. doi: 10.1074/jbc.M210269200 12482755.

75. Lustgarten MS, Bhattacharya A, Muller FL, Jang YC, Shimizu T, Shirasawa T, et al. Complex I generated, mitochondrial matrix-directed superoxide is released from the mitochondria through voltage dependent anion channels. Biochem Biophys Res Commun. 2012;422(3):515–21. doi: 10.1016/j.bbrc.2012.05.055 22613204; PubMed Central PMCID: PMC3400138.

76. Bienert GP, Moller AL, Kristiansen KA, Schulz A, Moller IM, Schjoerring JK, et al. Specific aquaporins facilitate the diffusion of hydrogen peroxide across membranes. J Biol Chem. 2007;282(2):1183–92. doi: 10.1074/jbc.M603761200 17105724.

77. van der Hoeven R, Cruz MR, Chavez V, Garsin DA. Localization of the Dual Oxidase BLI-3 and Characterization of Its NADPH Oxidase Domain during Infection of Caenorhabditis elegans. PLoS One. 2015;10(4):e0124091. Epub 2015/04/25. doi: 10.1371/journal.pone.0124091 25909649; PubMed Central PMCID: PMC4409361.

78. Brandes RP, Weissmann N, Schroder K. Nox family NADPH oxidases: Molecular mechanisms of activation. Free Radic Biol Med. 2014;76:208–26. doi: 10.1016/j.freeradbiomed.2014.07.046 25157786.

79. Reiner DJ, Lundquist EA. Small GTPases. WormBook. 2018;2018:1–65. Epub 2016/05/25. doi: 10.1895/wormbook.1.67.2 27218782; PubMed Central PMCID: PMC6369420.

80. Kishore RS, Sundaram MV. ced-10 Rac and mig-2 function redundantly and act with unc-73 trio to control the orientation of vulval cell divisions and migrations in Caenorhabditis elegans. Dev Biol. 2002;241(2):339–48. Epub 2002/01/11. doi: 10.1006/dbio.2001.0513 11784116.

81. Hanzen S, Vielfort K, Yang J, Roger F, Andersson V, Zamarbide-Fores S, et al. Lifespan Control by Redox-Dependent Recruitment of Chaperones to Misfolded Proteins. Cell. 2016;166(1):140–51. doi: 10.1016/j.cell.2016.05.006 27264606.

82. Meyer AJ, Dick TP. Fluorescent protein-based redox probes. Antioxid Redox Signal. 2010;13(5):621–50. doi: 10.1089/ars.2009.2948 20088706.

83. Denu JM, Tanner KG. Specific and reversible inactivation of protein tyrosine phosphatases by hydrogen peroxide: evidence for a sulfenic acid intermediate and implications for redox regulation. Biochemistry. 1998;37(16):5633–42. Epub 1998/05/16. doi: 10.1021/bi973035t 9548949.

84. Lackner MR, Kornfeld K, Miller LM, Horvitz HR, Kim SK. A MAP kinase homolog, mpk-1, is involved in ras-mediated induction of vulval cell fates in Caenorhabditis elegans. Genes Dev. 1994;8(2):160–73. doi: 10.1101/gad.8.2.160 8299936.

85. Zand TP, Reiner DJ, Der CJ. Ras effector switching promotes divergent cell fates in C. elegans vulval patterning. Dev Cell. 2011;20(1):84–96. Epub 2011/01/18. doi: 10.1016/j.devcel.2010.12.004 21238927; PubMed Central PMCID: PMC3028984.


Článek vyšel v časopise

PLOS Genetics


2020 Číslo 6
Nejčtenější tento týden
Nejčtenější v tomto čísle
Kurzy

Zvyšte si kvalifikaci online z pohodlí domova

BMS srdce kurz
Hypertrofická kardiomyopatie: Moderní přístupy v diagnostice a léčbě
nový kurz
Autoři: doc. MUDr. David Zemánek, Ph.D., MUDr. Anna Chaloupka, Ph.D.

Vliv funkčního chrupu na paměť a učení
Autoři: doc. MUDr. Hana Hubálková, Ph.D.

Současné možnosti léčby obezity
Autoři: MUDr. Martin Hrubý

Svět praktické medicíny 4/2024 (znalostní test z časopisu)

INSIGHTS from European Respiratory Congress

Všechny kurzy
Kurzy Podcasty Doporučená témata Časopisy
Přihlášení
Zapomenuté heslo

Zadejte e-mailovou adresu, se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.

Přihlášení

Nemáte účet?  Registrujte se

#ADS_BOTTOM_SCRIPTS#