-
Články
- Vzdělávání
- Časopisy
Top články
Nové číslo
- Témata
- Kongresy
- Videa
- Podcasty
Nové podcasty
Reklama- Kariéra
Doporučené pozice
Reklama- Praxe
Challenges associated with homologous directed repair using CRISPR-Cas9 and TALEN to edit the DMD genetic mutation in canine Duchenne muscular dystrophy
Authors: Sara Mata López aff001; Cynthia Balog-Alvarez aff001; Stanislav Vitha aff002; Amanda K. Bettis aff001; Emily H. Canessa aff003; Joe N. Kornegay aff001; Peter P. Nghiem aff001
Authors place of work: Department of Veterinary Integrative Biosciences, College of Veterinary Medicine and Biomedical Sciences, Texas A&M University, College Station, TX, United States of America aff001; Microscopy and Imaging Center, Texas A&M University, College Station, TX, United States of America aff002; Department of Pharmaceutical Sciences, School of Pharmacy and Pharmaceutical Sciences, Binghamton University, Johnson City, NY, United States of America aff003
Published in the journal: PLoS ONE 15(1)
Category: Research Article
doi: https://doi.org/10.1371/journal.pone.0228072Summary
Duchenne muscular dystrophy (DMD) is caused by mutations in the DMD gene that abolish the expression of dystrophin protein. Dogs with the genetic homologue, golden retriever muscular dystrophy dog (GRMD), have a splice site mutation that leads to skipping of exon 7 and a stop codon in the DMD transcript. Gene editing via homology-directed repair (HDR) has been used in the mdx mouse model of DMD but not in GRMD. In this study, we used clustered regularly interspaced short palindromic repeats (CRISPR) and transcription activator-like effector nucleases (TALEN) to restore dystrophin expression via HDR in myoblasts/myotubes and later via intramuscular injection of GRMD dogs. In vitro, DNA and RNA were successfully corrected but dystrophin protein was not translated. With intramuscular injection of two different guide arms, sgRNA A and B, there was mRNA expression and Sanger sequencing confirmed inclusion of exon 7 for all treatments. On Western blot analysis, protein expression of up to 6% of normal levels was seen in two dogs injected with sgRNA B and up to 16% of normal in one dog treated with sgRNA A. TALEN did not restore any dystrophin expression. While there were no adverse effects, clear benefits were not seen on histopathologic analysis, immunofluorescence microscopy, and force measurements. Based on these results, methods must be modified to increase the efficiency of HDR-mediated gene repair and protein expression.
Keywords:
Mutation – Dogs – Polymerase chain reaction – Body limbs – Myoblasts – Muscle proteins – TALENs – Dystrophin
Introduction
Duchenne muscular dystrophy (DMD) is a muscle wasting disease affecting 1 out of ~5,000 males worldwide. Mutations in the DMD gene eliminate expression of dystrophin protein [1]. Dystrophin deficiency leads to cycles of myofiber degeneration, necrosis and regeneration, with muscle eventually replaced by connective tissue and fat [2]. While there is currently no cure for DMD, recent treatment strategies have sought to restore the missing dystrophin protein by delivering part of the DMD gene [3] or by skipping the mutated area to restore the reading frame [4]. Successful DMD gene editing also has been achieved using clustered regularly interspaced short palindromic repeats (CRISPR) coupled with an enzyme, typically caspase (Cas)-9, in cell culture, the DMD murine model (mdx) [5–10], and, most recently, in the deltaE50-MD dog model for DMD [11]. Transcription activator-like effector nucleases (TALEN) has also been tested in vitro [7, 12, 13].
Most of these gene-editing studies have relied on non-homologous end joining (NHEJ) to ‘snip’ out mutated and out-of-frame exons [11–16], with apparent highly efficient correction in the deltaE50-MD dog [11]. Others have used homology-directed repair (HDR), typically relying on a donor clone to integrate with the targeted region to correct the DMD gene mutation [6–8, 10, 17]. Use of TALEN in vitro has shown even better performance [18]. To our knowledge, TALEN has not been used before in vivo, nor has CRISPR-HDR been used in large animals.
Gene editing with NHEJ seeks to produce a considerably milder Becker muscular dystrophy (BMD)-like phenotype associated with in-frame DMD gene mutations and must be employed early in the disease state for maximal benefit [11], In principle, compared to HDR, NHEJ achieves more successful gene editing but is also more prone to replicating errors [19]. An added advantage of HDR is that targeting mitotic cells in the S and G2 phases of the cell cycle alone may lead to efficient gene editing. New studies have emerged, showing a favorable outcome in post-mitotic cells, as well [20].
Golden retriever muscular dystrophy (GRMD) occurs naturally and is genetically homologous with DMD. Affected dogs largely recapitulate the progressive and variable phenotype observed in human patients [21]. A mutation in the DMD intron 6 acceptor splice site of GRMD dogs disrupts the reading frame, leading to exon 7 skipping, a stop codon in exon 8, and subsequent loss of dystrophin protein [22]. Both AAV-mediated gene replacement and exon skipping have been used in the GRMD model to produce a truncated dystrophin protein that could lead to a less severe phenotype typical of BMD [23]. Extending beyond these forms of gene therapy, some small DMD mutations may be amendable to HDR-mediated gene editing to excise and replace the mutated area with a normal sequence [24].
In this study, CRISPR/Cas9 and TALEN were paired with a donor clone to perform HDR-mediated gene editing to restore dystrophin protein in GRMD myoblasts. We then extended this work by injecting gene-editing plasmids intramuscularly in a total of six GRMD dogs. Our results show that HDR-mediated gene editing can safely correct a DMD mutation in a large animal model but also point to challenges that must be addressed to improve efficiency.
Materials and methods
Plasmids
Plasmid constructs were designed and generated by the investigators and Genecopoeia. SgRNA constructs contained the mCherry sequence to confirm clone insertion into the cell, CMV and T7 promoters, and ampicillin and neomycin resistance genes. TALEN left and right arm constructs contained CMV and T7 promoters and ampicillin resistance genes. Donor clone plasmid, from 5’ to 3’, contained the following: CMV, a T2A ribosomal skip site, eGFP sequence, ampicillin and neomycin resistance genes, and the corrected sequence of intron 6 and the acceptor splice site and part of exon 7 (S1 Table). The eGFP construct was located in intron 6.
Glycerol stocks were grown in E. coli with ampicillin and DNA was purified according to the manufacturer’s protocol (Endofree Plasmid Maxi Kit, Qiagen). Purified plasmid identity was confirmed via PCR (S2 Table) and restriction digest (EcoRI, SbfI, AflII for 1h at 37°C).
SgRNA A was targeted for the 5’ region located in intron 6 before the GRMD mutation “5’… CTCTTAAGGAATGATGGGCA…3’” with TGG as a PAM sequence. SgRNA B was targeted for the 3’ region located in exon 7 after the GRMD mutation “5’…GCAGTCAGCCACACAACGCC…3’”, CCA was the PAM sequence. SgRNA C differed from SgRNA A by 5 bp.
TALEN left arm was targeted for the 5’ region located in intron 6 before the GRMD mutation “5’… tcttgtgaaatattgtaa…3’”. Right arm was targeted for the 3’ region located in the splice acceptor site of intron 6 in the GRMD mutation “5’…TTATGTGTGTGTGTTTCG…3’”.
Recommended plasmid DNA and Endofectin concentrations were used. For HDR-CRISPR sgRNA treated cells, 2.5μg of DNA vector was first incubated in OPTI-MEM media (Life Technologies) in equal parts for 5 minutes (min) and subsequently mixed with the transfection agent, Endofectin (Genecopoeia) for 30 min. The DNA plasmid/Endofectin mix was then incubated with 5x105 myoblast cells (previously stained with PAX7 and desmin for myoblast lineage confirmation) in a 6-well plate with Endofectin (Genecopoeia). For an 8-well plate, 233ng of total DNA vector/Endofectin mix was incubated in each well (1*105 cells/well). Control GRMD cells were not treated with any type of DNA but incubated in OPTI-MEM for 70h.
Animal studies
All dogs were used and cared for according to principles outlined in the National Research Council’s Guide for the Care and Use of Laboratory Animals. Procedures in this study were approved by the Texas A&M IACUC through protocols 2018–0182 (Standard Operating Procedures-Canine X-Linked Muscular Dystrophy) and 2017–0148 (Gene Editing in Duchenne Muscular Dystrophy).
Briefly, for the myoblast culture studies, dogs were premedicated (intramuscular acepromazine 0.02 mg/kg, butorphanol 0.4 mg/kg, and atropine 0.04mg/kg) and anesthesia was induced with sevoflurane via inhalation. The vastus lateralis muscle from a 4-year-old normal and a 3-year-old GRMD dog and the biceps femoris muscle from a 4.5-month old GRMD dog were then biopsied using an open surgical procedure to extract myoblasts for the CRISPR studies.
Dogs used in the HDR-gene editing in vivo studies were anesthetized using the above protocol at baseline and three months after treatment [25] and tibiotarsal joint force measurements (twitch and tetanic extension and flexion) and eccentric contraction decrement were performed as previously described [21, 26]. After these baseline measurements, 1x1014 vector copies in a total volume of ~ 6ml plasmid or saline were injected percutaneously using a grid pattern, 0.05 ml per site, into the three tibiotarsal flexor muscles of the cranial tibial compartment (cranial tibialis [CT], long digital extensor [LDE], and peroneus longus [PL]). We hypothesized that flexion force generated by HDR-Tx muscles would increase or deteriorate at a lesser rate if there were a treatment effect. Dogs were humanely euthanized by barbiturate overdose 3 months after HDR-Tx and necropsies were completed.
Cell culture
Myoblast extraction was performed using a pre-plate technique [27]. Tissue was placed in a 15ml conical tube with PBS (Corning Cellgro) and 1% penicillin/streptomycin (Gibco, Life technologies). Muscle and PBS were placed in a petri dish, minced finely with sterile surgical blades, suctioned with a Pasteur pipette, and placed in 0.1% of collagenase (Roche Diagnostics) in DMEM (with Glutagro, Corning Cellgro). The cell lysate was incubated for 1h at 37°C with agitation at 120 rpm, digested every 15 min with a Pasteur pipette, washed with PBS twice, and re-suspended in 5ml of 0.05% trypsin (EDTA, Gibco, Life technologies) for 30 min at 37°C in a rocking incubator at 120 rpm. Trypsin was then inactivated with complete growth media (20% FBS -Pure grade VWR-, 2% chick embryo extract (USBiological), and 1% penicillin/streptomycin (Gibco, Life technologies). The sample was finally passed through two nylon strainers (100μm and 40μm) in a tube, plated in a collagen coated (Sigma) 6-well plate, and proliferated in growth media (20% FBS–VWR-, 2% chick embryo extract -Fisher scientific - 1% penicillin/streptomycin -Gibco, Life technologies - in DMEM -with Glutagro, Corning Cellgro-) until 95% confluency. Cells were stained for Pax7 (DSHB) and desmin (Sigma) to confirm myoblast identity. Myoblasts were treated for 70h with plasmid DNA with the concentrations mentioned above. Genomic DNA, total RNA, and protein were then extracted separately from individual experiments.
Genomic DNA extraction
70h after initial incubation with plasmids, genomic DNA was extracted from the myoblasts following kit manufacturer protocol (QIAamp DNA blood mini kit, Qiagen).
RNA extraction
Myoblasts were differentiated into myotubes with differentiation media (2% horse serum–VWR-, 1% penicillin/streptomycin -Gibco, Life Technologies - in DMEM -with Glutagro, Corning Cellgro-) for 2–3 weeks. Cells were considered myotubes after cell fusion, contained multiple nuclei, and had an elongated-shaped morphology. In addition, developmental myosin heavy chain (Leica) staining was performed after 21 days to confirm myotube lineage. Myotubes and 200mg of muscle from injected and normal dogs were resuspended in Tripure and total RNA was extracted following the manufacturer’s protocol (Roche Diagnostics). The RNA concentrations in the individual samples were measured using Nanodrop 2000 spectrophotometer and assessed for quality on a 2100 Bioanalyzer (Agilent Technologies). The RIN value ranged from 8.2–10. Reverse transcription was performed following the manufacturer’s protocol with oligo dT and Superscript II (Invitrogen). The reactions consisted of 100ng of total RNA in a 50μl reaction, ultra-pure H2O, oligo dt (2.5μl of 500ng/μl) and random hexamer (0.48μl of 1mM stock) heated to 65°C for 5 min and cooled to room temperature. Superscript II (2μl), 5X 1st Strand buffer (10μl), 0.1M DTT (5μl), 10mM dNTPs (2.5μl) and a RNase block Ambion’s Superasin (1μl) were all heated to 37°C for 1h and terminated by heating at 90°C for 5 min for the cell extract. In the case of muscle extracted RNA, reverse transcription was performed following the manufacturer’s protocol with gene specific primer (S3 Table) and Superscript II (Invitrogen). The reactions consisted of 100ng of total RNA in a 20μl reaction, ultra-pure H2O, gene specific primer (2pmole) and dNTP mix (10mM) heated to 65°C for 5 min and cooled in ice. Superscript II (2μl), 5X 1st Strand buffer (10μl), 0.1M DTT (5μl), 10mM dNTPs (2.5μl) and a RNase block Ambion’s Superasin (1μl) were all heated to 42°C for 2 min and after the final addition of SuperScript II the mix was incubated at 42°C for 1h and terminated by heating at 70°C for 15 min.
Immunostaining
Myoblast identity was confirmed via Pax7 and desmin immunostaining [28]. Pax7 (Hybridoma Bank) and desmin (Sigma) were incubated at 1 : 100 each overnight (ON) at 4°C in 4% PFA fixed cells. Secondary antibodies Alexa 488 (Thermo Scientific) was incubated at 1 : 500 for 1h in the dark at room temperature. DAPI was incubated for 5min at 1 : 2000. Myotubes identity was confirmed with myosin heavy chain developmental staining (Leica) at 1 : 100.
Cells were plated and treated with HDR-CRISPR in 8 well slide chamber, differentiated for 18–21 days into myotubes and fixed with 1% PFA. Dystrophin (NCL-Dys1, NCL-Dys2 Leica Novacastra) was incubated at 1 : 100 and 1 : 50 respectively ON at 4°C. Secondary antibodies Alexa 647 (Jackson Immunolabs) were incubated at 1 : 500 for 1h at room temperature. DAPI (Invitrogen) was incubated for 5 minutes at 1 : 2000.
Tissue cross sections were cut in a cryostat at 6 nm of thickness as published previously [24]. Sections were mounted on a microscope slide, hydrated for 1h in PBS and fixed with acetone for 10 min. Blocked with 1% HS for 1h and incubated with dystrophin antibodies following the same procedure as above.
PCR
Primers were designed to ensure plasmid identity of the clones (S2 Table). The PCR product was later restriction digested with AflII and SbfI (New England Biolabs), and electrophoresed in an agarose gel.
QRT-PCR was performed in triplicate reactions for Power Sybr Green Master Mix for the primers designed “in-house”. PCR assays were performed on a 7900HT Fast Real-Time PCR System (Applied Biosystems). The qRT-PCR reactions consisted of 10μl of Power Sybr Green, 300nM of each forward and reverse primers (2μl of 3μM stock), 5.5μl of PCR grade water, and 0.5μl of each reverse transcription reaction (cDNA) with a total of 20μl per well. The cycling parameters on the 7900HT machine were: 50C° for 2 min, 95°C for 10 min, and cycling 40 repeats of 95°C for 15 sec and 60°C for 1 min. Assay was performed with a dissociation curve added to validate primers. Primers used (S3 Table, outside primers, and S4 Table) were for DMD mRNA and HPRT1 (control). Off-target, predicted sites were tested via PCR for each of the treatments (S5 and S6 Tables) following manufacturers protocol (OneTaq, New England Biolabs).
Nested PCR
Primary PCR was performed using the outside primers (S3 Table) and TaKaRa Ex Taq Polymerase Kit under the following conditions: 94°C for 30 sec; 98°C for 10 sec, 52°C for 30 sec, 72°C for 1 min (30 times); and 75°C for 5 min. The desired band (540bp) of this reaction was excised from a 1% agarose gel and used for secondary PCR with inside forward and reverse primers designed. Secondary PCR was performed under the same conditions. Gel electrophoresis was used to determine the quality of PCR products. PCR reaction was submitted for Sanger sequencing with in-house primers.
Sanger sequencing
For DNA genotyping of cells, PCR bands that were restriction digested by Sau96I (New England Biolabs) were cut, ligated (T.A. Cloning Kit Life Technologies, One Shot TOP10 Invitrogen), transfected and grown in E. coli. DNA extracted (QIAprep spin miniprep kit, Qiagen) was later sequenced and submitted to Eton and to the Institute for Plants Genomics & Biotechnology at Texas A&M, College Station, for Sanger sequencing with M13 forward primer. Ligated samples were independently sent to Eton without being digested by Sau96I in order to calculate HDR efficiency. CDNA product obtained from nested PCR was sent to Eton for sequencing with in-house primer (S1 Table). Between 5 to 6 colonies were sequenced for each clone, for sgRNA B one colony came up positive. For TALEN-Tx, 2 out of 8 colonies came up with the correctly modified sequence.
Protein extraction and Western blot
Protein was extracted from three different parts of each of the cranial tibial compartment muscles (for statistical comparisons) and only once from the pre-treatment biopsied vastus lateralis/biceps femoris muscle with 10% SDS, 5% B-Mercaptoethanol, 75mM Tris-HCl pH 6.8 and 10mM EDTA. Samples were homogenized for 5 min at 4°C. The protein extract was incubated on ice with protein and phosphatase inhibitors (Halt Protease & Phosphatase Thermo Scientific) for 30 min and then centrifuged. Supernatant was quantified using a BCA protein quantification kit (Pierce Rapid Gold Thermo Scientific) and Nanodrop was used to measure the quantification curve. 7.5% SDS-PAGE gels (TGX Stain-Free Bio-Rad) were casted and ran for 30min at 300V, 70mA in 1X running buffer (1% SDS, 1.92 M glycine, 250mM Tris pH 8.3 for 10X) and transferred to a PVDF membrane on ice for 1 : 07h at 100V, 300mA in transfer buffer (0.1% SDS, 20%MeOH, 192mM Glycine, 25mM Tris). For statistical purposes, each muscle had three different protein aliquots obtained from medial, distal and proximal parts of the muscle. Each protein aliquot was run with baseline muscle sample, making the number of times of n = 3 for each muscle. For β-spectrin and dystrophin staining, membranes were blocked in 5% Milk TBST (TBS and 0.1% Tween-20) for 1h in a rocker, then antibodies (β-spectrin 1 : 2000, dystrophin concentration as above) were incubated at 4°C with rocking agitation. Desmin (1 : 10,000) was also used in some cases as a loading control. Those membranes were blocked in 5% BSA in TBS. Three TBST washes of 5 min each were performed. Secondary antibodies used were the same mentioned above in the immunofluorescence (IF) microscopy section at β-spectrin (1 : 5000), dystrophin (1 : 10,000), and desmin (1 : 10,000) and were incubated for 1h at room temperature while rocking. Three TBST washes were performed before a final 5 min TBS wash and exposure to a chemiluminiscent substance (SuperSignal West Pico Thermo Scientific) for 30 sec. Film was placed on top of the membrane in the dark room for as much time as needed in each case. All western blot membranes and films are provided in full without modification in S1 and S2 Figs.
Imaging
Confocal microscopy was performed using an Olympus FV1000 inverted confocal microscope (Olympus America, Waltham, MA) equipped with an UPLSAPO 20x/0.85 and 20x/0.75 oil immersion objective. Scanning was performed with the confocal aperture corresponding to 1 Airy unit in sequential mode to minimize spectral overlap. Z-stacks were acquired in some cases with 1.52 um/slice steps. Excitation and emission wavelengths for individual channels were as follows: DAPI (Ex. 405 nm, Em 425–475 nm); GFP/Alexa488 (Ex. 488 nm, Em. 500-530nm); Cy3 (Ex. 543, Em. 565–615), Cy5/Alexa647 (Ex. 633, Em. > 650 nm).
Cell counts
IF stained cells and necrotic fiber counts were calculated for every 100 cells counted performed in a blinded manner. Three images at 20X objective were analyzed per muscle per dog with an average of ~ 80 muscle cells in each image. Positive cells were considered those with dystrophin signal throughout the entire sarcolemmal membrane. Necrotic fibers were counted on H&E stained slides. A minimum of two to three images taken at 20X, with an average of 80 myofibers per image, were analyzed for all seven muscles from each dog, Features of necrosis extended from hyalinization whereby myofibers were round, swollen, and hypereosinophilic to different stages of fragmentation and phagocytosis.
Liquid chromatography tandem mass spectrophotometry (LC-MS/MS)
One aliquot consisting of 100 μg of protein for each time point was loaded per lane into a TGX pre-cast 7.5% gel (Bio-Rad, Hercules, CA, USA) and separated for 40 minutes using 300V and 70mA. Gel was stained with Biosafe Coomassie blue (Bio-Rad, Hercules, CA, USA) for 1h. The gel was imaged and bands of interest were excised and processed for in-gel digestion by trypsin following previously published protocol [29]. The resulting peptides were extracted from the gel piece, vacuum dried, and then resuspended in 10 μl of 0.1% formic acid for LC-MS/MS analysis. An aliquot of 5μl peptide solutions were injected onto a Q Exactive™ HF-X Hybrid Quadrupole-Orbitrap™ Mass Spectrometer connected to a Dionex UltiMate 3000 RS UPLC system. A two-hour gradient was run using a mobile phase A of 0.1% formic acid in water, and a mobile phase B of 0.1% formic acid in 80% acetonitrile. An EASY-Spray™ LC Column (75 um diameter, 500 mm length, pore size 100 Å, particle size 2 μm; Thermo Scientific) column was first equilibrated with 98% mobile phase A and 2% mobile phase B for 10 minutes, then 5–35% B gradient for 90 minutes, 35‐100% B for 5 minutes, 100‐100% B for 5 minutes, 100–2% B for 1 minute and 2% B for 10 minutes. Data-dependent acquisition was performed at 60,000 resolution for a scan mass range of 300–1000 m/z, with one full MS scan followed by 20 MS/MS scans.
Peptide identification was performed using the Sequest algorithm in Proteome Discoverer 2.2. A canis lupus familiaris proteome from Uniprot (Proteome ID: UP000002254, last edit: May 16, 2019) containing 25,496 proteins was used for protein identification. Peptides were matched using oxidation, carbamidomethylation and acetylation dynamic modifications at a 10 ppm mass tolerance. To define the cellular function of detected proteins, the more extensive human (homo sapiens) database from Uniprot (v2017-07-05) was used containing 42,182 proteins. that contained 172,501 entries, 20,432 of them reviewed (Swiss-Prot) and 152,069 unreviewed (TrEMBL) (last edit: July 30, 2019).
For SILAC quantification, 50ug of dog tissue and 25ug of spiked-in SILAC labeled cell extract was used. The combined protein extract was run in a gel, followed by in-gel digestion procedures, as described above. For purposes of identifying muscle-specific protein, the top band of the gel was excised and processed. For analysis, only proteins that had a ratio of 10 or below with 3 or more peptides detected were reported. Peptides with a higher or outlier ratio were excluded.
Results
HDR-mediated guides
Canine myoblasts from GRMD dogs were treated (Tx) for 70 hours (h) with equal amounts of donor clone and either CRISPR/Cas-9 single guide RNA (sgRNA) plasmids (denoted as HDR-CRISPR) or TALEN left and right arms (denoted as HDR-TALEN; Fig 1). Left and right TALEN arms (Fig 1C) were incubated together; sgRNAs A and B, targeting different areas around the GRMD mutation (Fig 1A), were incubated with GRMD cells independently and together (sgRNA A&B). A donor clone was designed to include the correct DMD gene sequence at the intron 6 acceptor splice site-exon 7 boundary, enhanced green fluorescent protein gene (eGFP), and a cytomegalovirus (CMV) promoter (Fig 1B). An additional CRISPR guide with 5 mismatches to sgRNA A (sgRNA C) was used independently, combined with the donor clone and alone. A donor clone only treatment was also evaluated.
Fig. 1. Experimental design of HDR-mediated CRISPR/Cas9 and TALEN gene editing for the GRMD mutation. (a) Guide selection included sgRNA A (PAM A underlined) and sgRNA B (PAM B underlined). (b) Experimental design. Double stranded breaks (DSB) occurred at the intron 6 area (highlighted) and/or at the exon 7 area to excise the GRMD mutation (asterisk). The donor clone (green) was used as a template for HDR to replace the excised area with the corrected DMD gene sequence. The black arrow designates the cutting site for Sau96I restriction enzyme, used to genotype GRMD dogs. When the dog does not have the mutated bp, Sau96I does not cut the DNA. (c) TALEN arm design with left and right sequences. HDR-treatment repairs the DNA at the myoblast level
Genomic DNA from GRMD-HDR-treated (Tx) and non-Tx myoblasts was extracted and genotyped for the GRMD mutation [30] via Sau96I restriction digest (Fig 2). In this genotyping process, the PCR-amplified region was cut into two bands if the GRMD mutation was present; a normal dog would have one PCR band; and a carrier dog would have three bands (one normal band and one Sau96I digested band cut into two parts). GRMD-HDR-Tx cells showed one each of a mutated and wild-type DMD gene PCR band (Fig 2A), similar to the profile seen in carrier dogs [30], presumably due to less than 100% transfection efficiency. PCR bands of interest were cloned and Sanger sequencing confirmed inclusion of the corrected basepair (bp) in the splice site area of intron 6 (Fig 2B, 2C and 2D). TA cloning was performed to determine the efficiency of donor clone insertion into various clones: TALEN showed around 25% insertion efficiency and sgRNA B was approximately 16% effective, while other treatments did not yield positive colonies, presumably due to less than 10% efficacy, in line with levels seen in mdx mice treated in vivo [8, 10].
Fig. 2. DNA and RNA analysis revealed HDR-mediated gene editing in GRMD-treated (Tx) myoblasts. (a) Agarose gel after PCR and restriction digest of GRMD-Tx and non-Tx cells. From left to right: Normal (N), carrier (Ca), non-Tx GRMD (md), GRMD-sgRNA A-Tx (A), GRMD-sgRNA B-Tx (B), GRMD-sgRNA A&B combined Tx (A&B), GRMD-TALEN Tx (T), ladder (100bp). All bands were sequenced: top band of ~ 700bp (red asterisk) matched part of the sequence of the donor clone after being cut with Sau96I enzyme, second band of ~ 500bp (red cross) was the corrected DMD gene sequence in GRMD-HDR-Tx samples and normal dog cells. This band was not cut with Sau96I. This second band had a higher molecular weight in GRMD-Tx cells compared to normal due to additional genes (eGFP) present in the donor clone. Third and fourth bands ~ 200bp (red dash, red cash sign) correspond to fragments of the GRMD mutated dog genome that was cut with Sau96I. (b) Sanger sequencing from the cut band (red cross) in a normal dog. Red arrow denotes the correct bp (A) in the DMD gene. (c) Sanger sequencing from the cut band in GRMD-HDR-Tx myoblasts but not successfully edited. Red arrow points at mutated bp (G) in GRMD dogs (d) Sanger sequencing from cut band in successfully GRMD-HDR-Tx GRMD cells. Red arrow denotes successfully replaced bp (A). (e) Dystrophin mRNA expression (mean±SE) among HDR treatments and normal cells compared to normal cells expression. *** p ≤ 0.001, ** p ≤ 0.01 vs Normal. Samples were analyzed using a pair wise fixed reallocation randomization test, excluding outliers with a Grubb’s test. Vertical bars indicate standard error of the mean. Treated myoblasts were differentiated into myotubes for 18 to 21 days and RNA was extracted from 6 replicates; values were normalized to HPRT1 (house-keeping gene). In some cases, Sanger sequencing in the region of interest showed that the wrong sequence of the donor clone had been inserted into the cell’s genome. Off-target, predicted sites within various genes were determined via webserver for CRISPR [31] and TALEN [32]. PCR analysis was performed for 9 (sgRNA A&B), 7 (sgRNA A) and 8 (sgRNA B) of the predicted genes. None showed banding differences between GRMD-HDR-CRISPR-Tx and GRMD non-Tx cells (S5 and S6 Tables) (S3 Fig). TALEN sequences did not match to any known genes for predicted off-target sites.
HDR-treatment can modify mRNA at the myotube level
GRMD-HDR-CRISPR-Tx myoblasts were differentiated into myotubes for 18 to 21 days. Total RNA extraction and QRT-PCR for HPRT1 and DMD genes were then quantified. DMD mRNA expression was compared to normal (dotted line Fig 2E, S7 Table) and was paradoxically increased in GRMD non-Tx cells versus normal. Using pair wise fixed reallocation randomization and Grubb’s outlier tests, with six replicates per treatment, DMD mRNA differed in all GRMD-HDR-Tx cells compared to normal except for sgRNA C combined with donor clone (S7 Table). SgRNA A&B and TALEN HDR-Tx showed decreased expression in the mRNA DMD transcript when compared to normal, while sgRNA A, sgRNA B, sgRNA C, donor clone alone and GRMD non-Tx cells increased their mRNA DMD expression. Once mRNA expression was compared between treatments (S7 Table), there were significant differences between sgRNA A with A&B, TALEN, sgRNA C and GRMD No-Tx; between sgRNA B and all the treatments except sgRNA A; and between sgRNA A&B and TALEN with all the treatments evaluated.
HDR-treatment can modify protein at the myotube level
In an independent experiment, GRMD-HDR-Tx myoblasts were differentiated into multi-nucleated, elongated myotubes and evaluated for dystrophin expression with IF (Fig 3A–3F) and western blotting (Fig 3G and S4 Fig). Non-Tx GRMD cells had significantly reduced dystrophin protein compared to normal cells (p < 0.05; S4A Fig). SgRNA A-Tx, sgRNA&B-Tx and TALEN-Tx cells showed partial dystrophin restoration (Fig 3 and S4A Fig), such that these values no longer differed statistically from normal. The values for neither SgRNA A-Tx nor sgRNA B-Tx differed from GRMD non-Tx cells, indicating no difference in the amount of dystrophin, and those treated with SgRNA A&B-Tx had lower levels of dystrophin (p < 0.01). TALEN-Tx cells showed the highest dystrophin expression in IF and differed statistically from GRMD non-Tx cells. Dystrophin expression for all HDR treatments was then compared to GRMD non-Tx cells via western blot, but no significant differences were observed after multiple replicates (Fig 3G and S4B and S4C Fig). Differences between both quantification methods are presumably due to the semi-quantitative nature of IF versus western blotting.
Fig. 3. Dystrophin protein immunostaining and western blot from HDR- treated (Tx) and non-Tx myotubes. Dystrophin co-stained with C and N-terminus antibodies, Alexa 647 (red) and DAPI stained nuclei (blue). EGFP from the cells treated with donor clone (green) and mCherry from the sgRNA/Cas9 clones (yellow) indicate expression of plasmid proteins in the cell. All images were taken with the 20X objective; only multinucleated, elongated myotubes were used for quantification. (a) GRMD non-Tx myotubes showed background signal for Alexa 647. (b) sgRNA A-Tx and (c) B-Tx GRMD myotubes had increased dystrophin. (d) GRMD myotubes sgRNA A&B-Tx, (e) TALEN-Tx GRMD myotubes, and (f) normal myotubes. (g) Western blot from protein extracted from treated and non-Tx myotubes. Dystrophin co-stained with C and N-terminus antibodies and β-spectrin was used as a loading control. Design of HDR-TX in GRMD dogs
Six GRMD dogs were treated in groups of two with each plasmid for HDR gene editing (sgRNA A, sgRNA B, TALEN; Table 1). A total of 1x1014 vector copies were injected percutaneously using a grid pattern into the three muscles (CT, LDE, and PL) of one cranial tibial compartment, while the other was injected with saline. Dogs were euthanized after 3 months and the muscles were removed for analysis. A biopsy from either the vastus lateralis or biceps femoris muscle was obtained before treatment to be used as a baseline for each dog.
Tab. 1. Study design for HDR-treated dogs. Dogs were assessed 3 months after treatment. HDR-TX alters DMD mRNA transcript in vivo
Quantification of the amount of transcript in the mutated area was performed via QRT-PCR (Fig 4) and confirmation of exon 7 insertion was observed via Sanger sequencing (S5 Fig). mRNA DMD expression in treated samples was averaged for each treatment group (n = 2 dogs for each HDR-Tx, with three replicates per muscle per dog) and compared to levels in normal (dotted line, Fig 4) and GRMD carrier dogs. SgRNA A treated dogs showed increased expression in DMD mRNA in their pre-treatment biopsy muscle compared to normal DMD mRNA levels, mirroring in vitro results. SgRNA A treated PL and saline treated CT had significantly increased DMD mRNA levels when compared to normal. No other muscles showed significant variability in the mRNA expression when compared to normal, potentially due to a systemic effect that caused normalization of DMD transcript after treatment (CT, LDE). When sgRNA B was used, the only significant differences were between the saline injected PL when compared to normal muscle levels, while no differences were observed between normal and GRMD pre-treatment biopsy or any other treated muscle. However, sgRNA B injected CT showed a promising range in DMD mRNA expression, indicating variability between animals, one of which could be mirroring carrier-like DMD mRNA expression levels. HDR-TALEN Tx dogs showed significant differences between normal DMD mRNA levels and pre-treatment biopsy, the saline injected PL and the TALEN injected LDE, all of which had a significantly decrease DMD mRNA fold change when compared to normal DMD mRNA levels. Expression levels in both the other treated and saline control muscles did not differ from normal, potentially due to a systemic effect. Paradoxically, pre-biopsy mRNA levels of TALEN treated dogs had a significantly reduced fold change when compared to normal. SgRNA A levels were significantly increased when compared to normal and sgRNA B levels did not differ from normal. This could be explained by the age of the dog at the time of the biopsy (Table 1), in that TALEN dogs were the youngest and sgRNA A the oldest. Expression of DMD mRNA at the area studied (exon 6–8) increases with aging in the GRMD dogs (unpublished data Mata and Nghiem).
Fig. 4. QRT-PCR results analyzed with a pair wise fixed reallocation randomization test. CT values for mRNA area between exon 6–8 of the DMD gene were normalized to HPRT1 (house-keeping gene) as an internal control gene. Samples were analyzed using a pair wise fixed reallocation randomization test, excluding outliers with a Grubb’s test. Vertical boxes include standard error of the mean. RNA was extracted from each muscle and run in triplicate. All values were expressed as fold change compared to the normal dog values, which were also normalized to HPRT1 (dotted line). CT = cranial tibial; PL = peroneus longus; LDE = long digital extensor; *p<0.05; ***p<0.001. HDR-TX can increase protein in vivo
We then quantified dystrophin protein expression via western blot and IF. On western blot, only three (Bubbles, Miercoles, Friendly) of the six dogs showed dystrophin expression. Pre-treatment biopsy samples from the vastus lateralis and/or biceps femoris muscles had ~ 2–5% dystrophin levels compared to normal, consistent with the level of revertant fibers present in GRMD (Fig 5 and S6 and S7 Figs). Similar to the DMD transcript levels, the level of restored dystrophin expression in the GRMD-HDR-CRISPR injected limbs varied among the three dogs and treated muscles. Miercoles’ sgRNA A HDR-CRISPR-treated PL and LDE muscles had a modest increase of ~ 6% of normal levels (Fig 5) versus ~0–5% in the saline injected muscles (p < 0.001 for PL). Bubbles’ sgRNA B HDR-CRISPR-treated CT muscle showed the highest increase of approximately 16% of normal levels (S6 Fig). This was significantly higher than pre-treatment levels in her untreated vastus lateralis muscle. There were also 2–9% dystrophin levels in saline injected muscles, suggesting a possible systemic effect from the HDR-CRISPR treatment. The HDR-CRISPR - sgRNA A-Tx muscles in Friendly had dystrophin levels of ~2–5% of normal, consistent with the ~3–5% seen in untreated biceps femoris pre-treatment sample or saline-treated muscles. Levels in Friendly’s HDR-CRISPR-treated CT were lower than the saline-treated muscle (S7 Fig). Dystrophin protein was not detected in Clove, Gantu and Hera on multiple Western blots and the absence of expression was confirmed in CT samples analyzed via mass spectrometry with LC-MS/MS with SILAC (13C6 and 15N2 Lys and 13C6 Arg) labeled spike-in normal myoblasts (unpublished data). No dystrophin peptides were detected in any of the samples except normal dog control.
Fig. 5. Dystrophin protein expression after HDR-CRISPR treatment in Miercoles. CRISPR sgRNA A was injected into one cranial tibial compartment and saline into the other. The vastus lateralis muscle from Miercoles (GRMD) was biopsied before injections to provide a general baseline and the HDR-CRISPR/saline muscles were harvested 3 months after treatment. (a) Dystrophin co-stained with C and N-terminus antibodies with goat anti-mouse secondary staining, β-spectrin stained as a muscle marker with goat anti rabbit secondary staining. Total protein from the PVDF membrane was used to normalize dystrophin. Normal sample was diluted to 20%. (b) Graph with dystrophin quantification for each muscle in the cranial tibial compartment. The PL and LDE muscles had increased dystrophin restoration in the HDR-CRISPR-Tx muscle compared to saline and GRMD while there were no differences in the HDR-CRISPR-Tx CT muscle. Statistical analysis was performed with Tukey’s multiple comparison’s test * p ≤ 0.05;** p ≤ 0.01;*** p ≤ 0.001. CT = cranial tibial; LDE = long digital extensor; PL = peroneus longus. IF for dystrophin, β-spectrin and DAPI (Fig 6 and S8 and S9 Figs) were performed and quantified. Intensity was analyzed by providing a score of 0 to those fibers without signal, 1 to those fibers with partial signal and 2 to those fibers with high signal. The score was calculated by multiplying their signal (0, 1 or 2) by the number of fibers with such intensity. For the normal muscle 100% of the fibers have a score of 2, so the intensity score is 200%. Centrally nucleated fibers were also quantified. Values were averaged for the two dogs in each treatment group and the results were expressed as intensity score/central nuclei for every 100 muscle fibers. Notably, these data generally did not track with the Western blot results, perhaps reflecting the semi-quantitative nature of IF. B-spectrin was only used as a membrane control, but not normalized to dystrophin expression. Intensity score was evaluated per treatment, with sgRNA A showing differences between CRISPR and saline treated PL, and a decreasing trend in intensity between pre-treatment biopsy and saline CT (Fig 6). SgRNA B only showed significant differences between CRISPR treated LDE versus saline (S8 Fig). No other differences were observed for the HDR-CRISPR treated dogs. TALEN-HDR treated dogs showed an increase in intensity between CT and LDE TALEN treated muscles and their respective saline treated partners. An increase in intensity was also observed in CT and LDE when compared to the pre-treatment biopsied muscle (S9 Fig). Immunostaining results mirrored data obtained in the in vitro studies, with TALEN being the most effective treatment.
Fig. 6. Dystrophin expression was minimally restored in HDR-CRISPR-Tx muscle from sgRNA A. Dystrophin co-stained with C and N-terminus antibodies with Alexa 647 (red), β -spectrin membrane control (green) and DAPI denotes the nuclei (blue). Asterisks denote cells with a value of 2 in intensity score for dystrophin signal in the GRMD non-Tx and Tx samples. Dotted line denotes cells with a value of 1 in intensity score. Scale bar = 50μm. (a) Pre-treatment biopsy sample for Miercoles. (b) HDR-CRISPR injected cranial tibial (CT) Miercoles. (c) HDR-CRISPR injected peroneus longus (PL) Miercoles. (d) HDR-CRISPR injected long digital extensor (LDE) Miercoles. (e) Normal dog muscle. (f) SALINE injected CT Miercoles. (g) SALINE injected PL Miercoles. (h) SALINE injected LDE Miercoles. (i) Pre-treatment biopsy sample for Miercoles. (j) HDR-CRISPR injected LDE Miercoles. (k) Dystrophin intensity quantification for Miercoles and Clove via One-way ANOVA multiple comparisons test, blue circle indicates CRISPR-Tx limb, black triangle indicates Saline-Tx limb, gray square indicates pre-treatment biopsied sample; *p<0.05. (l) Normal dog muscle (m) SALINE injected LDE Miercoles. Dys = dystrophin; p = p. value. HDR-Tx does not modify the amount of necrotic cells in tissue
Muscles were weighed at necropsy and necrotic fibers and centrally nucleated fibers were quantified for every hundred myofibers. Body-weight corrected muscle weight did not differ between treated and control muscles (S10 Fig). The number of central nuclei did not differ between baseline and treated samples (Fig 7). There were differences in the number of necrotic cells (Fig 7). For sgRNA A, the number of necrotic cells were increased in CRISPR CT and saline LDE compared individually to pre-treatment biopsy. Fewer necrotic fibers were seen in the CRISPR versus saline-treated LDE muscles. However, numbers did not differ from the pre-treatment values, possibly because any improvement was countered by natural disease progression. All muscles treated with SgRNA B had increased numbers of necrotic fibers compared to the pre-treatment samples. The same was true for all TALEN treated muscles, with the exception of one CT. The overall increase in necrotic fibers for all treatments when compared to biopsied pre-treatment samples could be due to the natural increase in necrosis and muscle wasting with GRMD disease progression. Values for muscle weight and dystrophin IF signal and between dystrophin IF signal and the number of necrotic fibers did not correlate (S11 Fig).
Fig. 7. Percentage of central nuclei and necrosis from all three HDR treatments. Top: centrally nucleated fibers expressed as a percentage of fibers for every group treatment, sgRNA A, B and TALEN. Bottom: percentage of necrotic fibers for every treatment, sgRNA A, B (all significant versus pre-treatment biopsy) and TALEN. Blue circles denote HDR-injected limb while black triangle denotes saline-injected limb. Pre-treatment biopsy is indicated in grey square. Analysis was performed with One-way ANOVA multiple comparisons test. *p<0.05; **p< 0.01.; p***<0.001; p****<0.0001; CT = cranial tibial; LDE = long digital extensor; PL = peroneus longus. HDR-tx does not improve functional measures in vivo
Force measurements and the degree of eccentric contraction decrement (ECD) were assessed before and after treatment. The mean degree of ECD showed no significant difference (p = 0.057) in the saline injected limbs post-treatment, as well as seen in those treated with CRISPR when compared to pre-treatment. Extension and flexion tibiotarsal tetanic force did not differ between treated and control limbs (S12 Fig). Cranial sartorius (CS) circumference measured during necropsy and compared between HDR-tx and Saline-tx limbs also did not differ (S8 Table) [21].
Discussion
Expanding upon prior work in the mdx mouse and DMD cultured cells [6–8, 10, 17, 33], HDR-mediated gene editing with CRISPR/Cas-9 or TALEN to restore dystrophin expression was employed for the first time in the phenotypically relevant GRMD model of DMD. While up to 25% of editing was observed upon DNA analysis, these results did not track with protein levels, suggesting minimal to no rescue of HDR in treated dogs.
Starting with myoblasts in culture, the efficiency of donor clone insertion varied, with CRISPR sgRNA B being the most effective of its group at 16%, and TALEN at 25%. The other treatments had an efficiency of less than 10% in line with previously published HDR in vivo results from mdx mice [8, 10]. Somewhat unexpectedly, mRNA levels in GRMD myoblasts were higher than those of normal cells. Although dogma suggests that levels of DMD mRNA expression should be downregulated with frameshifting mutations due to nonsense-mediated decay, levels did not differ from wild type dogs in an earlier study [34]. Mdx values may be even higher than normal, especially with relatively 5’ mutations [35]. Importantly, mRNA expression is regulated by other factors such as microRNAs [36] and the presence of negative feedback loops [25]. Therefore, a reduction in transcript does not always correlate with protein expression. DMD mRNA levels in all myoblasts derived after HDR-treatment were lower than those from untreated GRMD cells and all were statistically significant compared to normal values, higher for sgRNA A and sgRNA B and lower for TALEN and sgRNA A&B. Values also differed between treatments, with sgRNA C combined with a donor clone coming closest to normal levels. However, values for neither donor clone nor sgRNA C alone did not differ when compared to GRMD no-Tx levels. At the protein level, GRMD-HDR-CRISPR-Tx myotubes had a modest restoration in dystrophin protein when compared to non-Tx GRMD cells. On the other hand, GRMD-HDR-TALEN-Tx cells did show a significant increase in protein expression. These CRISPR findings are in keeping with previously published data showing high efficiency on genome insertion that was not reflected at the protein level [10]. Consistent with the data for insertion efficiency, sgRNA B and TALEN were the most effective at restoring dystrophin protein. Based on these encouraging data, we performed in vivo studies.
In our standard preclinical studies, GRMD dogs are assessed between the ages of 3 and 6 months, corresponding roughly to 5–10 years in DMD, a period of relatively rapid deterioration in both diseases [23]. For sake of this preliminary in vivo study, we utilized six adult dogs ranging in age from 3 months to 8 years to establish proof-of principle of genetic correction using HDR. Given the late stage of disease for most dogs, phenotypic benefit was not necessarily expected. Our use of plasmids instead of adeno-associated viruses [37] (AAV) may have further limited the efficiency of genetic correction. Perhaps because of these limitations, while exon 7 in the DMD mRNA transcript was confirmed via Sanger sequencing, quantification of this area of the transcript via RT-QPCR did not fully track with the mRNA in vitro nor in vivo protein results. Of particular note, there was variability in the DMD mRNA content of the biopsies when compared to the same normal samples, indicating a potential relationship between transcript and age in the GRMD dog. Interestingly, these differences were not seen in culture, probably because of the presence of other regulators at the tissue level compared to single-cell culture [38]. HDR-TALEN provided the most encouraging results, with one of the treated limbs having decreased levels of mRNA compared to normal in both in vitro and in vivo studies. However, mRNA results did not track with protein. SgRNA A treated dogs showed dystrophin expression on Western blot. It was encouraging that PL CRISPR-Tx values tracked with dystrophin mRNA and Western blot in Miercoles, perhaps due to the small size of the muscle allowing a higher concentration of the injected plasmid. No dystrophin protein was detected in the TALEN treated dogs on Western blot or LC/MS-MS nor with Clove (sgRNA B-Tx), indicating a lack of HDR repair at the protein level.
Levels on Western blot and IF microscopy also did not track together, probably reflecting the respective quantitative versus semi-quantitative nature of these techniques [39]. Western data from the CT of Bubbles showed the highest correction of ~ 16% of normal. Dystrophin was only modestly increased, if at all, on Western analysis in other muscles from her and those of Friendly and Miercoles. Importantly, these modest levels of dystrophin expression are in keeping with the HDR gene-editing results in mdx mice [8, 10]. In another recently published canine CRISPR study, dystrophin expression was as high as 67% when compared to normal levels after AAV intramuscular CT injection using NHEJ [11]. Notably, HDR mediated gene editing is less efficient in post-mitotic cells compared to NHEJ [40, 41]. Previous studies have shown that a ~ 4% increase in dystrophin is necessary to lessen histopathologic lesions [42, 43]. Consistent with this finding, necrotic myofibers were not decreased in Miercoles’ LDE muscle compared to pre-treatment biopsy values. Not surprisingly, given the late stage of disease, there was no difference in force or ECD in treated and control limbs.
Results from both the CRISPR and TALEN treated dogs generally did not correspond to those of the in vitro studies. Miercoles was the only dog in which the sgRNA and protein values tended to track together. Thus, while the treatments appeared safe, improvements are needed in methodology before HDR can be applied to DMD. In future studies, better results might be achieved with a higher dose and a different system of delivery such as the other CRISPR dog study in which 2x1013 vg/kg was delivered intravenously [11], an earlier treatment window as mentioned above, a different type of vector delivery such as AAV [11, 44, 45], or improved techniques of HITI [46] or prime editing [47]. A combination of these improvements could lead to a higher percentage of HDR efficiency at both the DNA and protein levels.
Supporting information
S1 Fig [dys]
Full blots for the treated cells in culture.S2 Fig [dys]
Full blots and membranes for the treated dog muscles.S3 Fig [a]
Off target predicted genes analyzed with PCR.S4 Fig [a]
Dystrophin protein quantification in HDR-Tx cells.S5 Fig [tiff]
Sanger sequencing of DMD mRNA.S6 Fig [a]
Western blot quantification of dystrophin expression from Bubbles, sgRNA B.S7 Fig [grmd]
Dystrophin protein expression after HDR-CRISPR treatment in Friendly.S8 Fig [red]
Dystrophin expression was minimally restored in HDR-CRISPR-Tx muscle from sgRNA B.S9 Fig [red]
Dystrophin expression was partially restored in HDR-TALEN-Tx muscle.S10 Fig [ct]
Muscle weights at necropsy normalized to body weight.S11 Fig [tiff]
Correlations between dystrophin IF signal and muscle weight and necrotic fibers.S12 Fig [ecd]
Force normalized for body weight (N/kg) values from GRMD dogs before and after HDR treatment and eccentric contraction decrements (ECD).S1 Table [docx]
Donor clone plasmid entire sequence.S2 Table [docx]
Primers designed for clone purification and confirmation from bacterial stocks.S3 Table [docx]
Primers designed for nested PCR and gene specific primer to convert the DMD mRNA into cDNA.S4 Table [docx]
Primers designed for QRT-PCR after treatment with HDR.S5 Table [docx]
TOP 10 sgRNA A&B, TOP 8 sgRNA A and TOP 8 sgRNA B predicted off target effects.S6 Table [docx]
Primers designed for off target predicted genes.S7 Table [docx]
Dystrophin mRNA fold change.S8 Table [docx]
Cranial Sartorius circumference variation expressed in millimeters/kg of body weight.
Zdroje
1. Hoffman EP, Brown RH Jr., Kunkel LM. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell. 1987;51(6):919–28. Epub 1987/12/24. doi: 10.1016/0092-8674(87)90579-4 3319190.
2. Klingler W, Jurkat-Rott K, Lehmann-Horn F, Schleip R. The role of fibrosis in Duchenne muscular dystrophy. Acta Myol. 2012;31(3):184–95. Epub 2013/04/27. 23620650; PubMed Central PMCID: PMC3631802.
3. Wang B, Li J, Xiao X. Adeno-associated virus vector carrying human minidystrophin genes effectively ameliorates muscular dystrophy in mdx mouse model. Proc Natl Acad Sci U S A. 2000;97(25):13714–9. Epub 2000/11/30. doi: 10.1073/pnas.240335297 11095710; PubMed Central PMCID: PMC17641.
4. Cirak S, Arechavala-Gomeza V, Guglieri M, Feng L, Torelli S, Anthony K, et al. Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: an open-label, phase 2, dose-escalation study. Lancet. 2011;378(9791):595–605. Epub 2011/07/26. doi: 10.1016/S0140-6736(11)60756-3 21784508; PubMed Central PMCID: PMC3156980.
5. Long C, Amoasii L, Mireault AA, McAnally JR, Li H, Sanchez-Ortiz E, et al. Postnatal genome editing partially restores dystrophin expression in a mouse model of muscular dystrophy. Science. 2016;351(6271):400–3. Epub 2016/01/02. doi: 10.1126/science.aad5725 26721683; PubMed Central PMCID: PMC4760628.
6. Long C, McAnally JR, Shelton JM, Mireault AA, Bassel-Duby R, Olson EN. Prevention of muscular dystrophy in mice by CRISPR/Cas9-mediated editing of germline DNA. Science. 2014;345(6201):1184–8. Epub 2014/08/16. doi: 10.1126/science.1254445 25123483; PubMed Central PMCID: PMC4398027.
7. Li HL, Fujimoto N, Sasakawa N, Shirai S, Ohkame T, Sakuma T, et al. Precise correction of the dystrophin gene in duchenne muscular dystrophy patient induced pluripotent stem cells by TALEN and CRISPR-Cas9. Stem Cell Reports. 2015;4(1):143–54. doi: 10.1016/j.stemcr.2014.10.013 25434822; PubMed Central PMCID: PMC4297888.
8. Bengtsson NE, Hall JK, Odom GL, Phelps MP, Andrus CR, Hawkins RD, et al. Corrigendum: Muscle-specific CRISPR/Cas9 dystrophin gene editing ameliorates pathophysiology in a mouse model for Duchenne muscular dystrophy. Nat Commun. 2017;8 : 16007. Epub 2017/06/24. doi: 10.1038/ncomms16007 28643790; PubMed Central PMCID: PMC5489999.
9. Nelson CE, Hakim CH, Ousterout DG, Thakore PI, Moreb EA, Castellanos Rivera RM, et al. In vivo genome editing improves muscle function in a mouse model of Duchenne muscular dystrophy. Science. 2016;351(6271):403–7. doi: 10.1126/science.aad5143 26721684; PubMed Central PMCID: PMC4883596.
10. Lee Kunwoo, Conboy Michael, Hyo Min Park Fuguo Jiang, Hyun Jin Kim Mark A. Dewitt, et al. Nanoparticle delivery of Cas9 ribonucleoprotein and donor DNA in vivo induces homology-directed DNA repair. Nature Biomedical Engineering. 2017;1(November):889–901. doi: 10.1038/s41551-017-0137-2 29805845
11. Amoasii L, Hildyard JCW, Li H, Sanchez-Ortiz E, Mireault A, Caballero D, et al. Gene editing restores dystrophin expression in a canine model of Duchenne muscular dystrophy. Science. 2018;362(6410):86–91. Epub 2018/09/01. doi: 10.1126/science.aau1549 30166439; PubMed Central PMCID: PMC6205228.
12. Ousterout DG, Perez-Pinera P, Thakore PI, Kabadi AM, Brown MT, Qin X, et al. Reading frame correction by targeted genome editing restores dystrophin expression in cells from Duchenne muscular dystrophy patients. Mol Ther. 2013;21(9):1718–26. Epub 2013/06/05. doi: 10.1038/mt.2013.111 23732986; PubMed Central PMCID: PMC3776627.
13. Tang L, Bondareva A, Gonzalez R, Rodriguez-Sosa JR, Carlson DF, Webster D, et al. TALEN-mediated gene targeting in porcine spermatogonia. Mol Reprod Dev. 2018;85(3):250–61. Epub 2018/02/03. doi: 10.1002/mrd.22961 29393557; PubMed Central PMCID: PMC6370346.
14. Tabebordbar M, Zhu K, Cheng JKW, Chew WL, Widrick JJ, Yan WX, et al. In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Science. 2016;351(6271):407–11. Epub 2016/01/02. doi: 10.1126/science.aad5177 26721686; PubMed Central PMCID: PMC4924477.
15. Yu HH, Zhao H, Qing YB, Pan WR, Jia BY, Zhao HY, et al. Porcine Zygote Injection with Cas9/sgRNA Results in DMD-Modified Pig with Muscle Dystrophy. Int J Mol Sci. 2016;17(10). Epub 2016/10/14. doi: 10.3390/ijms17101668 27735844; PubMed Central PMCID: PMC5085701.
16. Ousterout DG, Kabadi AM, Thakore PI, Majoros WH, Reddy TE, Gersbach CA. Multiplex CRISPR/Cas9-based genome editing for correction of dystrophin mutations that cause Duchenne muscular dystrophy. Nat Commun. 2015;6 : 6244. Epub 2015/02/19. doi: 10.1038/ncomms7244 25692716; PubMed Central PMCID: PMC4335351.
17. Zhang Y, Long C, Li H, McAnally JR, Baskin KK, Shelton JM, et al. CRISPR-Cpf1 correction of muscular dystrophy mutations in human cardiomyocytes and mice. Sci Adv. 2017;3(4):e1602814. Epub 2017/04/26. doi: 10.1126/sciadv.1602814 28439558; PubMed Central PMCID: PMC5389745.
18. He Z, Proudfoot C, Whitelaw CB, Lillico SG. Comparison of CRISPR/Cas9 and TALENs on editing an integrated EGFP gene in the genome of HEK293FT cells. Springerplus. 2016;5(1):814. Epub 2016/07/09. doi: 10.1186/s40064-016-2536-3 27390654; PubMed Central PMCID: PMC4916124.
19. Devkota S. The road less traveled: strategies to enhance the frequency of homology-directed repair (HDR) for increased efficiency of CRISPR/Cas-mediated transgenesis. BMB Rep. 2018;51(9):437–43. Epub 2018/08/15. doi: 10.5483/BMBRep.2018.51.9.187 30103848; PubMed Central PMCID: PMC6177507.
20. Nishiyama J, Mikuni T, Yasuda R. Virus-Mediated Genome Editing via Homology-Directed Repair in Mitotic and Postmitotic Cells in Mammalian Brain. Neuron. 2017;96(4):755–68 e5. Epub 2017/10/24. doi: 10.1016/j.neuron.2017.10.004 29056297; PubMed Central PMCID: PMC5691606.
21. Kornegay JN, Bogan JR, Bogan DJ, Childers MK, Li J, Nghiem P, et al. Canine models of Duchenne muscular dystrophy and their use in therapeutic strategies. Mamm Genome. 2012;23(1–2):85–108. Epub 2012/01/06. doi: 10.1007/s00335-011-9382-y 22218699; PubMed Central PMCID: PMC3911884.
22. Sharp NJ, Kornegay JN, Van Camp SD, Herbstreith MH, Secore SL, Kettle S, et al. An error in dystrophin mRNA processing in golden retriever muscular dystrophy, an animal homologue of Duchenne muscular dystrophy. Genomics. 1992;13(1):115–21. Epub 1992/05/01. doi: 10.1016/0888-7543(92)90210-j 1577476.
23. Kornegay JN. The golden retriever model of Duchenne muscular dystrophy. Skelet Muscle. 2017;7(1):9. Epub 2017/05/21. doi: 10.1186/s13395-017-0124-z 28526070; PubMed Central PMCID: PMC5438519.
24. Mata Lopez S, Hammond JJ, Rigsby MB, Balog-Alvarez CJ, Kornegay JN, Nghiem PP. A novel canine model for Duchenne muscular dystrophy (DMD): single nucleotide deletion in DMD gene exon 20. Skelet Muscle. 2018;8(1):16. Epub 2018/05/31. doi: 10.1186/s13395-018-0162-1 29843823; PubMed Central PMCID: PMC5975675.
25. Schneider SM, Sridhar V, Bettis AK, Heath-Barnett H, Balog-Alvarez CJ, Guo LJ, et al. Glucose Metabolism as a Pre-clinical Biomarker for the Golden Retriever Model of Duchenne Muscular Dystrophy. Mol Imaging Biol. 2018. Epub 2018/03/07. doi: 10.1007/s11307-018-1174-2 29508262.
26. Kornegay JN, Spurney CF, Nghiem PP, Brinkmeyer-Langford CL, Hoffman EP, Nagaraju K. Pharmacologic management of Duchenne muscular dystrophy: target identification and preclinical trials. ILAR J. 2014;55(1):119–49. doi: 10.1093/ilar/ilu011 24936034; PubMed Central PMCID: PMC4158345.
27. Li Y, Pan H, Huard J. Isolating stem cells from soft musculoskeletal tissues. J Vis Exp. 2010;(41). Epub 2010/07/21. doi: 10.3791/2011 20644509; PubMed Central PMCID: PMC3156067.
28. Pawlikowski B, Lee L, Zuo J, Kramer RH. Analysis of human muscle stem cells reveals a differentiation-resistant progenitor cell population expressing Pax7 capable of self-renewal. Dev Dyn. 2009;238(1):138–49. Epub 2008/12/20. doi: 10.1002/dvdy.21833 19097049; PubMed Central PMCID: PMC2799339.
29. Jensen ON, Wilm M, Shevchenko A, Mann M. Sample preparation methods for mass spectrometric peptide mapping directly from 2-DE gels. Methods Mol Biol. 1999;112 : 513–30. Epub 1999/02/23. doi: 10.1385/1-59259-584-7 : 513 10027274.
30. Bartlett RJ, Winand NJ, Secore SL, Singer JT, Fletcher S, Wilton S, et al. Mutation segregation and rapid carrier detection of X-linked muscular dystrophy in dogs. Am J Vet Res. 1996;57(5):650–4. Epub 1996/05/01. 8723876.
31. Bae S, Park J, Kim JS. Cas-OFFinder: a fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics. 2014;30(10):1473–5. Epub 2014/01/28. doi: 10.1093/bioinformatics/btu048 24463181; PubMed Central PMCID: PMC4016707.
32. Doyle EL, Booher NJ, Standage DS, Voytas DF, Brendel VP, Vandyk JK, et al. TAL Effector-Nucleotide Targeter (TALE-NT) 2.0: tools for TAL effector design and target prediction. Nucleic Acids Res. 2012;40(Web Server issue):W117–22. Epub 2012/06/14. doi: 10.1093/nar/gks608 22693217; PubMed Central PMCID: PMC3394250.
33. Doetschman T, Georgieva T. Gene Editing With CRISPR/Cas9 RNA-Directed Nuclease. Circ Res. 2017;120(5):876–94. Epub 2017/03/04. doi: 10.1161/CIRCRESAHA.116.309727 28254804.
34. Cotten SW, Kornegay JN, Bogan DJ, Wadosky KM, Patterson C, Willis MS. Genetic myostatin decrease in the golden retriever muscular dystrophy model does not significantly affect the ubiquitin proteasome system despite enhancing the severity of disease. Am J Transl Res. 2013;6(1):43–53. Epub 2013/12/19. 24349620; PubMed Central PMCID: PMC3853423.
35. Spitali P, van den Bergen JC, Verhaart IE, Wokke B, Janson AA, van den Eijnde R, et al. DMD transcript imbalance determines dystrophin levels. FASEB J. 2013;27(12):4909–16. Epub 2013/08/27. doi: 10.1096/fj.13-232025 23975932.
36. Cannell IG, Kong YW, Bushell M. How do microRNAs regulate gene expression? Biochem Soc Trans. 2008;36(Pt 6):1224–31. Epub 2008/11/22. doi: 10.1042/BST0361224 19021530.
37. Lukashev AN, Zamyatnin AA Jr. Viral Vectors for Gene Therapy: Current State and Clinical Perspectives. Biochemistry (Mosc). 2016;81(7):700–8. Epub 2016/07/28. doi: 10.1134/S0006297916070063 27449616.
38. Miki Y, Ono K, Hata S, Suzuki T, Kumamoto H, Sasano H. The advantages of co-culture over mono cell culture in simulating in vivo environment. J Steroid Biochem Mol Biol. 2012;131(3–5):68–75. Epub 2012/01/24. doi: 10.1016/j.jsbmb.2011.12.004 22265957.
39. FDA. Peripheral and Central Nervous System Drugs Advisory Committee Meeting: FDA; 2016. https://www.fda.gov/downloads/AdvisoryCommittees/CommitteesMeetingMaterials/Drugs/PeripheralandCentralNervousSystemDrugsAdvisoryCommittee/UCM497063.pdf].
40. Mao Z, Bozzella M, Seluanov A, Gorbunova V. Comparison of nonhomologous end joining and homologous recombination in human cells. DNA Repair (Amst). 2008;7(10):1765–71. Epub 2008/08/05. doi: 10.1016/j.dnarep.2008.06.018 18675941; PubMed Central PMCID: PMC2695993.
41. Li G, Zhang X, Zhong C, Mo J, Quan R, Yang J, et al. Small molecules enhance CRISPR/Cas9-mediated homology-directed genome editing in primary cells. Sci Rep. 2017;7(1):8943. Epub 2017/08/23. doi: 10.1038/s41598-017-09306-x 28827551; PubMed Central PMCID: PMC5566437.
42. Li D, Yue Y, Duan D. Marginal level dystrophin expression improves clinical outcome in a strain of dystrophin/utrophin double knockout mice. PLoS One. 2010;5(12):e15286. Epub 2010/12/29. doi: 10.1371/journal.pone.0015286 21187970; PubMed Central PMCID: PMC3004926.
43. van Putten M, Hulsker M, Young C, Nadarajah VD, Heemskerk H, van der Weerd L, et al. Low dystrophin levels increase survival and improve muscle pathology and function in dystrophin/utrophin double-knockout mice. FASEB J. 2013;27(6):2484–95. Epub 2013/03/06. doi: 10.1096/fj.12-224170 23460734; PubMed Central PMCID: PMC3659351.
44. Song Y, Morales L, Malik AS, Mead AF, Greer CD, Mitchell MA, et al. Non-immunogenic utrophin gene therapy for the treatment of muscular dystrophy animal models. Nat Med. 2019. Epub 2019/10/09. doi: 10.1038/s41591-019-0594-0 31591596.
45. Nghiem PP, Kornegay JN. Gene therapies in canine models for Duchenne muscular dystrophy. Hum Genet. 2019;138(5):483–9. Epub 2019/02/09. doi: 10.1007/s00439-019-01976-z 30734120.
46. Suzuki K, Tsunekawa Y, Hernandez-Benitez R, Wu J, Zhu J, Kim EJ, et al. In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. 2016;540(7631):144–9. Epub 2016/11/17. doi: 10.1038/nature20565 27851729; PubMed Central PMCID: PMC5331785.
47. Anzalone AV, Randolph PB, Davis JR, Sousa AA, Koblan LW, Levy JM, et al. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature. 2019. Epub 2019/10/22. doi: 10.1038/s41586-019-1711-4 31634902.
Článek Disparate effects of antibiotic-induced microbiome change and enhanced fitness in Daphnia magnaČlánek Phanerochaete chrysosporium strain B-22, a nematophagous fungus parasitizing Meloidogyne incognitaČlánek Do atmospheric events explain the arrival of an invasive ladybird (Harmonia axyridis) in the UK?Článek Growth behavior and glyphosate resistance level in 10 populations of Echinochloa colona in AustraliaČlánek Effects of Transcranial Direct Current Stimulation on GABA and Glx in Children: A pilot studyČlánek Early conservation benefits of a de facto marine protected area at San Clemente Island, CaliforniaČlánek Evaluating risk prediction models for adults with heart failure: A systematic literature reviewČlánek Patient perceived value of teleophthalmology in an urban, low income US population with diabetesČlánek A study to better understand under-utilization of laboratory tests for antenatal care in SenegalČlánek Monitoring the ‘diabetes epidemic’: A framing analysis of United Kingdom print news 1993-2013Článek Trophic ecology of Mexican Pacific harbor seal colonies using carbon and nitrogen stable isotopesČlánek Models of protein production along the cell cycle: An investigation of possible sources of noiseČlánek Fecal transplant prevents gut dysbiosis and anxiety-like behaviour after spinal cord injury in ratsČlánek Phylogeographic analyses point to long-term survival on the spot in micro-endemic Lycian salamandersČlánek Genlisea hawkingii (Lentibulariaceae), a new species from Serra da Canastra, Minas Gerais, BrazilČlánek Modelling the impact of migrants on the success of the HIV care and treatment program in BotswanaČlánek Does squatting need attention?—A dual-task study on cognitive resources in resistance exerciseČlánek Design and evaluation of a laboratory-based wheelchair castor testing protocol using community dataČlánek Role of ecology in shaping external nasal morphology in bats and implications for olfactory trackingČlánek Allergic inflammation is initiated by IL-33–dependent crosstalk between mast cells and basophilsČlánek Combined fiscal policies to promote healthier diets: Effects on purchases and consumer welfareČlánek Influence of light on the infection of Aureococcus anophagefferens CCMP 1984 by a “giant virus”Článek Manual dexterity of mice during food-handling involves the thumb and a set of fast basic movementsČlánek Quantum isomer searchČlánek Effects of Allium hookeri on gut microbiome related to growth performance in young broiler chickensČlánek Age and altitude of residence determine anemia prevalence in Peruvian 6 to 35 months old childrenČlánek A network analysis revealed the essential and common downstream proteins related to inguinal herniaČlánek Low risk pregnancies after a cesarean section: Determinants of trial of labor and its failureČlánek Identification and characterization of miRNAs involved in cold acclimation of zebrafish ZF4 cellsČlánek Research on motion planning for an indoor spray arm based on an improved potential field methodČlánek Eye-gaze information input based on pupillary response to visual stimulus with luminance modulationČlánek Disruption in daily eating-fasting and activity-rest cycles in Indian adolescents attending schoolČlánek The earliest farming communities north of the Carpathians: The settlement at Gwoździec site 2Článek Eligibility for hepatitis B antiviral therapy among adults in the general population in ZambiaČlánek Characterization of the visceral and neuronal phenotype of 4L/PS-NA mice modeling Gaucher diseaseČlánek Increased inflammation and endothelial markers in patients with late severe post-thrombotic syndromeČlánek Management of veterinary anaesthesia in small animals: A survey of current practice in QuebecČlánek Umbilical cord separation time, predictors and healing complications in newborns with dry careČlánek Analysis of attitudinal components towards statistics among students from different academic degreesČlánek Forecasting stock prices with long-short term memory neural network based on attention mechanismČlánek Enzyme response of activated sludge to a mixture of emerging contaminants in continuous exposureČlánek Quantitative PCR provides a simple and accessible method for quantitative microbiota profilingČlánek Comparison of Monocyte Distribution Width (MDW) and Procalcitonin for early recognition of sepsisČlánek Transcriptome analysis of Actinidia chinensis in response to Botryosphaeria dothidea infectionČlánek Niche modeling reveals life history shifts in birds at La Brea over the last twenty millenniaČlánek Distributed flux balance analysis simulations of serial biomass fermentation by two organismsČlánek Head impulse compensatory saccades: Visual dependence is most evident in bilateral vestibular lossČlánek Sofosbuvir-based regimen for genotype 2 HCV infected patients in Taiwan: A real world experienceČlánek The virulence domain of Shigella IcsA contains a subregion with specific host cell adhesion functionČlánek Short treatment with antalarmin alters adrenal gland receptors in the rat model of endometriosisČlánek Self-esteem and other risk factors for depressive symptoms among adolescents in United Arab EmiratesČlánek Influence of flow on phosphorus-dynamics and particle size in agricultural drainage ditch sedimentsČlánek An information-based approach to handle various types of uncertainty in fuzzy bodies of evidenceČlánek Novel method to measure temporal windows based on eye movements during viewing of the Necker cubeČlánek The impact of rehabilitation frequency on the risk of stroke in patients with rheumatoid arthritisČlánek Vascularization and biocompatibility of poly(ε-caprolactone) fiber mats for rotator cuff tear repairČlánek Disease-specific out-of-pocket healthcare expenditure in urban Bangladesh: A Bayesian analysisČlánek Reassortment and adaptive mutations of an emerging avian influenza virus H7N4 subtype in ChinaČlánek Occupational gender segregation and economic growth in U.S. local labor markets, 1980 through 2010Článek Accuracy of intraocular lens power calculation formulas using a swept-source optical biometerČlánek Characterization of black patina from the Tiber River embankments using Next-Generation SequencingČlánek Impact of long-term storage and freeze-thawing on eight circulating microRNAs in plasma samplesČlánek Obesity, smoking habits, and serum phosphate levels predicts mortality after life-style interventionČlánek Allele specific expression of Dof genes responding to hormones and abiotic stresses in sugarcaneČlánek Structure-function analyses of candidate small molecule RPN13 inhibitors with antitumor propertiesČlánek Multiple fragmented habitat-patch use in an urban breeding passerine, the Short-toed TreecreeperČlánek And the nominees are: Using design-awards datasets to build computational aesthetic evaluation modelČlánek Predictive factors of first dosage intravenous immunoglobulin-related adverse effects in childrenČlánek Effects of rejection intensity and rejection sensitivity on social approach behavior in womenČlánek The implementation of community-based diabetes and hypertension management care program in IndonesiaČlánek Optimization of cytotoxic activity of Nocardia sp culture broths using a design of experimentsČlánek Investigating Italian disinformation spreading on Twitter in the context of 2019 European electionsČlánek Modelling zero-truncated overdispersed antenatal health care count data of women in BangladeshČlánek Prevalence of antiphospholipid antibodies in Behçet's disease: A systematic review and meta-analysisČlánek Genetic characterization of Bacillus anthracis strains circulating in Italy from 1972 to 2018Článek Adverse reproductive effects of S100A9 on bovine sperm and early embryonic development in vitroČlánek CNP mediated selective toxicity on melanoma cells is accompanied by mitochondrial dysfunctionČlánek Correction: Mutation spectrums of TSC1 and TSC2 in Chinese women with lymphangioleiomyomatosis (LAM)Článek Regional versus local wind speed and direction at a narrow beach with a high and steep foreduneČlánek Computational analysis of functional single nucleotide polymorphisms associated with SLC26A4 geneČlánek MLST-based genetic relatedness of Campylobacter jejuni isolated from chickens and humans in PolandČlánek pyKNEEr: An image analysis workflow for open and reproducible research on femoral knee cartilageČlánek Optimization of tissue sampling for Borrelia burgdorferi in white-footed mice (Peromyscus leucopus)Článek Mothers’ oral health literacy and children’s oral health status in Pikine, Senegal: A pilot studyČlánek Redefining transcriptional regulation of the APOE gene and its association with Alzheimer’s diseaseČlánek Common mental illness among epilepsy patients in Bahir Dar city, Ethiopia: A cross-sectional studyČlánek Influence of inflammasome NLRP3, and IL1B and IL2 gene polymorphisms in periodontitis susceptibilityČlánek Factors for starting biosimilar TNF inhibitors in patients with rheumatic diseases in the real worldČlánek Revisits, readmissions, and outcomes for pediatric traumatic brain injury in California, 2005-2014Článek Use of magnetic resonance imaging to determine laterality of meniscal size in healthy volunteersČlánek Young women’s reproductive health conversations: Roles of maternal figures and clinical practicesČlánek Dominant negative effects by inactive Spa47 mutants inhibit T3SS function and Shigella virulenceČlánek ICOS-deficient and ICOS YF mutant mice fail to control Toxoplasma gondii infection of the brain
Článek vyšel v časopisePLOS One
Nejčtenější tento týden
2020 Číslo 1- AUDIO: (Jak) je možné prodloužit si život?
- Psilocybin je v Česku od 1. ledna 2026 schválený. Co to znamená v praxi?
- Koordinátoři onkologické péče zkrátí pacientům cestu systémem. Jak to bude fungovat v praxi?
- Alergie na antibiotika u žen s infekcemi močových cest − poznatky z průřezové studie z USA
- 4× stručně ke zpřesnění diagnostiky civilizačních chorob – „jednohubky“ z klinického výzkumu 2026/5
-
Všechny články tohoto čísla
- ETAPOD: A forecast model for prediction of black pod disease outbreak in Nigeria
- Disparate effects of antibiotic-induced microbiome change and enhanced fitness in Daphnia magna
- Deliver on Your Own: Disrespectful Maternity Care in rural Kenya
- Quantification of microaerobic growth of Geobacter sulfurreducens
- Number of days required to estimate physical activity constructs objectively measured in different age groups: Findings from three Brazilian (Pelotas) population-based birth cohorts
- Identifying site- and stimulation-specific TMS-evoked EEG potentials using a quantitative cosine similarity metric
- Design and assessment of TRAP-CSP fusion antigens as effective malaria vaccines
- Best compromise nutritional menus for childhood obesity
- Phanerochaete chrysosporium strain B-22, a nematophagous fungus parasitizing Meloidogyne incognita
- Non-disclosure of tuberculosis diagnosis by patients to their household members in south western Uganda
- Patch testing in Lao medical students
- A competence-regulated toxin-antitoxin system in Haemophilus influenzae
- Bund removal to re-establish tidal flow, remove aquatic weeds and restore coastal wetland services—North Queensland, Australia
- Exploring the mechanism of olfactory recognition in the initial stage by modeling the emission spectrum of electron transfer
- Risk of complications among diabetics self-reporting oral health status in Canada: A population-based cohort study
- Family Health Days program contributions in vaccination of unreached and under-immunized children during routine vaccinations in Uganda
- Calcium dobesilate reduces VEGF signaling by interfering with heparan sulfate binding site and protects from vascular complications in diabetic mice
- Predicting factors for long-term survival in patients with out-of-hospital cardiac arrest – A propensity score-matched analysis
- HIV infection does not alter interferon α/β receptor 2 expression on mucosal immune cells
- The impact of body posture on intrinsic brain activity: The role of beta power at rest
- Retraction: DJ-1 Modulates α-Synuclein Aggregation State in a Cellular Model of Oxidative Stress: Relevance for Parkinson's Disease and Involvement of HSP70
- Practical considerations in the use of a porcine model (Sus scrofa domesticus) to assess prevention of postoperative peritubal adhesions
- Do atmospheric events explain the arrival of an invasive ladybird (Harmonia axyridis) in the UK?
- Transcriptional Differences in Peanut (Arachis hypogaea L.) Seeds at the Freshly Harvested, After-ripening and Newly Germinated Seed Stages: Insights into the Regulatory Networks of Seed Dormancy Release and Germination
- First adaptation of quinoa in the Bhutanese mountain agriculture systems
- Identifying maintenance hosts for infection with Dichelobacter nodosus in free-ranging wild ruminants in Switzerland: A prevalence study
- Model order reduction for left ventricular mechanics via congruency training
- The use of mixed collagen-Matrigel matrices of increasing complexity recapitulates the biphasic role of cell adhesion in cancer cell migration: ECM sensing, remodeling and forces at the leading edge of cancer invasion
- Hyponatraemia reversibly affects human myometrial contractility. An in vitro pilot study
- Production, purification and evaluation of biodegradation potential of PHB depolymerase of Stenotrophomonas sp. RZS7
- The impact of a wireless audio system on communication in robotic-assisted laparoscopic surgery: A prospective controlled trial
- Towards a bottom-up understanding of antimicrobial use and resistance on the farm: A knowledge, attitudes, and practices survey across livestock systems in five African countries
- Geographical origin determines responses to salinity of Mediterranean caddisflies
- Non-redundant roles in sister chromatid cohesion of the DNA helicase DDX11 and the SMC3 acetyl transferases ESCO1 and ESCO2
- Seroprevalence of viral and vector-borne bacterial pathogens in domestic dogs (Canis familiaris) in northern Botswana
- Global reach of ageism on older persons’ health: A systematic review
- Musical expertise generalizes to superior temporal scaling in a Morse code tapping task
- Cross-cultural adaptation and psychometric evaluation of the Yoruba version of Oswestry disability index
- Growth behavior and glyphosate resistance level in 10 populations of Echinochloa colona in Australia
- Analysis of the lineage of Phytophthora infestans isolates using mating type assay, traditional markers, and next generation sequencing technologies
- Post-transcriptional regulation of Rad51c by miR-222 contributes cellular transformation
- Targeting chondroitinase ABC to axons enhances the ability of chondroitinase to promote neurite outgrowth and sprouting
- First eight residues of apolipoprotein A-I mediate the C-terminus control of helical bundle unfolding and its lipidation
- Repeated noninvasive stimulation of the ventromedial prefrontal cortex reveals cumulative amplification of pleasant compared to unpleasant scene processing: A single subject pilot study
- Can scientists fill the science journalism void? Online public engagement with science stories authored by scientists
- Retention and predictors of attrition among patients who started antiretroviral therapy in Zimbabwe’s national antiretroviral therapy programme between 2012 and 2015
- Prognostics for pain in osteoarthritis: Do clinical measures predict pain after total joint replacement?
- Infants without health insurance: Racial/ethnic and rural/urban disparities in infant households’ insurance coverage
- HY5 is not integral to light mediated stomatal development in Arabidopsis
- Effects of Transcranial Direct Current Stimulation on GABA and Glx in Children: A pilot study
- Hypertension testing and treatment in Uganda and Kenya through the SEARCH study: An implementation fidelity and outcome evaluation
- Whole genome sequence analysis reveals the broad distribution of the RtxA type 1 secretion system and four novel putative type 1 secretion systems throughout the Legionella genus
- Evaluation of rice wild relatives as a source of traits for adaptation to iron toxicity and enhanced grain quality
- The Malaysian Workplace Bullying Index (MWBI): A new measure of workplace bullying in Eastern countries
- Brief communication: Long-term absence of Langerhans cells alters the gene expression profile of keratinocytes and dendritic epidermal T cells
- APOBEC3B reporter myeloma cell lines identify DNA damage response pathways leading to APOBEC3B expression
- Morphological diversity within a core collection of subterranean clover (Trifolium subterraneum L.): Lessons in pasture adaptation from the wild
- Feasibility of real-time in vivo 89Zr-DFO-labeled CAR T-cell trafficking using PET imaging
- Repository-based plasmid design
- A LAMP at the end of the tunnel: A rapid, field deployable assay for the kauri dieback pathogen, Phytophthora agathidicida
- A new method of recording from the giant fiber of Drosophila melanogaster shows that the strength of its auditory inputs remains constant with age
- Early conservation benefits of a de facto marine protected area at San Clemente Island, California
- Evaluating risk prediction models for adults with heart failure: A systematic literature review
- Age, period and cohort analysis of age-specific maternal mortality trend in Ethiopia: A secondary analysis
- Aberrant cervical innate immunity predicts onset of dysbiosis and sexually transmitted infections in women of reproductive age
- Performance of Qure.ai automatic classifiers against a large annotated database of patients with diverse forms of tuberculosis
- Closed circuit xenon delivery for 72h in neonatal piglets following hypoxic insult using an ambient pressure automated control system: Development, technical evaluation and pulmonary effects
- Safe mobility, socioeconomic inequalities, and aging: A 12-year multilevel interrupted time-series analysis of road traffic death rates in a Latin American country
- THAP11F80L cobalamin disorder-associated mutation reveals normal and pathogenic THAP11 functions in gene expression and cell proliferation
- Lesion of striatal patches disrupts habitual behaviors and increases behavioral variability
- A clinical method for estimating the modulus of elasticity of the human cornea in vivo
- Gamma gap thresholds and HIV, hepatitis C, and monoclonal gammopathy
- Infective endocarditis post-transcatheter aortic valve implantation (TAVI), microbiological profile and clinical outcomes: A systematic review
- Potentiation of curing by a broad-host-range self-transmissible vector for displacing resistance plasmids to tackle AMR
- An acceleration in hypertension-related mortality for middle-aged and older Americans, 1999-2016: An observational study
- Two common disease-associated TYK2 variants impact exon splicing and TYK2 dosage
- Patient perceived value of teleophthalmology in an urban, low income US population with diabetes
- Real-world cost-effectiveness of rivaroxaban compared with vitamin K antagonists in the context of stroke prevention in atrial fibrillation in France
- Spatial risk assessment of global change impacts on Swedish seagrass ecosystems
- The effects of low-carbohydrate diets on cardiovascular risk factors: A meta-analysis
- Computational analysis of functional single nucleotide polymorphisms associated with SLC26A4 gene
- Evidence in support of chromosomal sex influencing plasma based metabolome vs APOE genotype influencing brain metabolome profile in humanized APOE male and female mice
- Accelerated sparsity based reconstruction of compressively sensed multichannel EEG signals
- A multicenter case control study of association of vitamin D with breast cancer among women in Karachi, Pakistan
- Microvesicles from Lactobacillus reuteri (DSM-17938) completely reproduce modulation of gut motility by bacteria in mice
- Chemical profiling of Curatella americana Linn leaves by UPLC-HRMS and its wound healing activity in mice
- “Yellow” laccase from Sclerotinia sclerotiorum is a blue laccase that enhances its substrate affinity by forming a reversible tyrosyl-product adduct
- Dense carbon-nanotube coating scaffolds stimulate osteogenic differentiation of mesenchymal stem cells
- Gamma Knife radiosurgery for vestibular schwannomas: Evaluation of planning using the sphericity degree of the target volume
- Variants in ADIPOQ gene are linked to adiponectin levels and lung function in young males independent of obesity
- Purification and molecular characterization of phospholipase, antigen 5 and hyaluronidases from the venom of the Asian hornet (Vespa velutina)
- Clinical state tracking in serious mental illness through computational analysis of speech
- Why are animal source foods rarely consumed by 6-23 months old children in rural communities of Northern Ethiopia? A qualitative study
- A study to better understand under-utilization of laboratory tests for antenatal care in Senegal
- Monitoring the ‘diabetes epidemic’: A framing analysis of United Kingdom print news 1993-2013
- Heart rate variability helps to distinguish the intensity of menopausal symptoms: A prospective, observational and transversal study
- Physicians’ perspectives regarding non-medical switching of prescription medications: Results of an internet e-survey
- Trophic ecology of Mexican Pacific harbor seal colonies using carbon and nitrogen stable isotopes
- Effectiveness of information technology–enabled ‘SMART Eating’ health promotion intervention: A cluster randomized controlled trial
- Cauda Equina Syndrome Core Outcome Set (CESCOS): An international patient and healthcare professional consensus for research studies
- Incidence and prediction of intraoperative and postoperative cardiac arrest requiring cardiopulmonary resuscitation and 30-day mortality in non-cardiac surgical patients
- Microscopic distance from tumor invasion front to serosa might be a useful predictive factor for peritoneal recurrence after curative resection of T3-gastric cancer
- A new species of Macrocypraea (Gastropoda, Cypraeidae) from Trindade Island, Brazil, including phenotypic differentiation from remaining congeneric species
- The evolving topology of the Lightning Network: Centralization, efficiency, robustness, synchronization, and anonymity
- Avoid jumping to conclusions under uncertainty in Obsessive Compulsive Disorder
- Tanopicobia gen. nov., a new genus of quill mites, its phylogenetic placement in the subfamily Picobiinae (Acariformes: Syringophilidae) and picobiine relationships with avian hosts
- Large-scale spatial variation of chronic stress signals in moose
- Complex situations: Economic insecurity, mental health, and substance use among pregnant women who consider – but do not have – abortions
- Well-being and entrepreneurship: Using establishment size to identify treatment effects and transmission mechanisms
- Models of protein production along the cell cycle: An investigation of possible sources of noise
- Protein-protein interactions underlying the behavioral and psychological symptoms of dementia (BPSD) and Alzheimer’s disease
- Assessing the feasibility of a life history calendar to measure HIV risk and health in older South Africans
- Prevalence of anaemia and low intake of dietary nutrients in pregnant women living in rural and urban areas in the Ashanti region of Ghana
- Enhancing performance of subject-specific models via subject-independent information for SSVEP-based BCIs
- Perceptions of and interest in HIV pre-exposure prophylaxis use among adolescent girls and young women in Lilongwe, Malawi
- Long term conjugated linoleic acid supplementation modestly improved growth performance but induced testicular tissue apoptosis and reduced sperm quality in male rabbit
- A new approach to the temporal significance of house orientations in European Early Neolithic settlements
- Meta-analysis of the radiological and clinical features of Usual Interstitial Pneumonia (UIP) and Nonspecific Interstitial Pneumonia (NSIP)
- Extreme mortality and reproductive failure of common murres resulting from the northeast Pacific marine heatwave of 2014-2016
- Persistence of chikungunya ECSA genotype and local outbreak in an upper medium class neighborhood in Northeast Brazil
- Fecal transplant prevents gut dysbiosis and anxiety-like behaviour after spinal cord injury in rats
- In vivo elongation of thin filaments results in heart failure
- High resolution respirometry to assess function of mitochondria in native homogenates of human heart muscle
- Disparity in depressive symptoms between heterosexual and sexual minority men in China: The role of social support
- Effect of classroom intervention on student food selection and plate waste: Evidence from a randomized control trial
- Cytomegalovirus-specific CD8+ T-cell responses are associated with arterial blood pressure in people living with HIV
- In-depth hepatoprotective mechanistic study of Phyllanthus niruri: In vitro and in vivo studies and its chemical characterization
- Content shared on social media for national cancer survivors day 2018
- Cost-effectiveness of alectinib compared to crizotinib for the treatment of first-line ALK+ advanced non-small-cell lung cancer in France
- Mating strategy is determinant of adenovirus prevalence in European bats
- Preventing HIV and HSV-2 through knowledge and attitudes: A replication study of a multi-component community-based intervention in Zimbabwe
- MLST-based genetic relatedness of Campylobacter jejuni isolated from chickens and humans in Poland
- Unraveling the polychromy and antiquity of the Pachacamac Idol, Pacific coast, Peru
- Randomized clinical trial analyzing maintenance of peripheral venous catheters in an internal medicine unit: Heparin vs. saline
- Hypertension prevalence but not control varies across the spectrum of risk in patients with atrial fibrillation: A RE-LY atrial fibrillation registry sub-study
- Valuing natural habitats for enhancing coastal resilience: Wetlands reduce property damage from storm surge and sea level rise
- Universal coverage but unmet need: National and regional estimates of attrition across the diabetes care continuum in Thailand
- Patient-related factors may influence nursing perception of sleep in the Intensive Care Unit
- A systematic review and meta-analysis of acute kidney injury in the intensive care units of developed and developing countries
- Phylogeographic analyses point to long-term survival on the spot in micro-endemic Lycian salamanders
- A randomized trial of a behavioral intervention to decrease hospital length of stay by decreasing bedrest
- Genlisea hawkingii (Lentibulariaceae), a new species from Serra da Canastra, Minas Gerais, Brazil
- Structural variation and its potential impact on genome instability: Novel discoveries in the EGFR landscape by long-read sequencing
- Assessment of forest cover and carbon stock changes in sub-tropical pine forest of Azad Jammu & Kashmir (AJK), Pakistan using multi-temporal Landsat satellite data and field inventory
- Color image segmentation using adaptive hierarchical-histogram thresholding
- The association between nonalcoholic fatty liver disease and esophageal, stomach, or colorectal cancer: National population-based cohort study
- Effects in spite of tough constraints - A theory of change based investigation of contextual and implementation factors affecting the results of a performance based financing scheme extended to malnutrition in Burundi
- Comparison of motif-based and whole-unique-sequence-based analyses of phage display library datasets generated by biopanning of anti-Borrelia burgdorferi immune sera
- Identification of the cleavage sites leading to the shed forms of human and mouse anti-aging and cognition-enhancing protein Klotho
- Research performance and age explain less than half of the gender pay gap in New Zealand universities
- Do bumblebees have signatures? Demonstrating the existence of a speed-curvature power law in Bombus terrestris locomotion patterns
- A primary healthcare information intervention for communicating cardiovascular risk to patients with poorly controlled hypertension: The Education and Coronary Risk Evaluation (Educore) study—A pragmatic, cluster-randomized trial
- “I did not know it was a medical condition”: Predictors, severity and help seeking behaviors of women with female sexual dysfunction in the Volta region of Ghana
- The role of services content for manufacturing competitiveness: A network analysis
- Mortality and demographic recovery in early post-black death epidemics: Role of recent emigrants in medieval Dijon
- Modelling the impact of migrants on the success of the HIV care and treatment program in Botswana
- Does squatting need attention?—A dual-task study on cognitive resources in resistance exercise
- A human mission to Mars: Predicting the bone mineral density loss of astronauts
- The role of demographic history and selection in shaping genetic diversity of the Galápagos penguin (Spheniscus mendiculus)
- Attitudes towards animal study registries and their characteristics: An online survey of three cohorts of animal researchers
- Risk perception and behavioral change during epidemics: Comparing models of individual and collective learning
- Drug-target interaction prediction using Multi Graph Regularized Nuclear Norm Minimization
- A preliminary study of resting brain metabolism in treatment-resistant depression before and after treatment with olanzapine-fluoxetine combination
- Use of serum KL-6 level for detecting patients with restrictive allograft syndrome after lung transplantation
- Gait asymmetry in glucocerebrosidase mutation carriers with Parkinson’s disease
- Radioiodine therapy and Graves’ disease – Myths and reality
- pyKNEEr: An image analysis workflow for open and reproducible research on femoral knee cartilage
- Creatinine versus cystatin C for renal function-based mortality prediction in an elderly cohort: The Northern Manhattan Study
- Risk factors for third-generation cephalosporin resistant Enterobacteriaceae in gestational urine cultures: A retrospective cohort study based on centralized electronic health records
- Population-based estimates of humoral autoimmunity from the U.S. National Health and Nutrition Examination Surveys, 1960–2014
- Residential neighbourhood greenspace is associated with reduced risk of cardiovascular disease: A prospective cohort study
- Circulating CTRP9 correlates with the prevention of aortic calcification in renal allograft recipients
- Potential socioeconomic impacts from ocean acidification and climate change effects on Atlantic Canadian fisheries
- Prevention and control of cholera with household and community water, sanitation and hygiene (WASH) interventions: A scoping review of current international guidelines
- Kinematic analysis of motor learning in upper limb body-powered bypass prosthesis training
- The treeness of the tree of historical trees of life
- Female finches prefer courtship signals indicating male vigor and neuromuscular ability
- The effect of spatial position and age within an egg-clutch on embryonic development and key metabolic enzymes in two clownfish species, Amphiprion ocellaris and Amphiprion frenatus
- Egg donors’ motivations, experiences, and opinions: A survey of egg donors in South Africa
- Polymer-free sirolimus-eluting stent use in Europe and Asia: Ethnic differences in demographics and clinical outcomes
- How “simple” methodological decisions affect interpretation of population structure based on reduced representation library DNA sequencing: A case study using the lake whitefish
- The impact of translated reminder letters and phone calls on mammography screening booking rates: Two randomised controlled trials
- Application of a genetic algorithm to the keyboard layout problem
- Design and evaluation of a laboratory-based wheelchair castor testing protocol using community data
- Relationship between diabetic macular edema and choroidal layer thickness
- Evaluation of the predictive ability of ultrasound-based assessment of breast cancer using BI-RADS natural language reporting against commercial transcriptome-based tests
- A Comprehensive Data Gathering Network Architecture in Large-Scale Visual Sensor Networks
- Recovery of health-related quality of life after burn injuries: An individual participant data meta-analysis
- Modeling aggressive market order placements with Hawkes factor models
- Higher prevalence of splenic artery aneurysms in hereditary hemorrhagic telangiectasia: Vascular implications and risk factors
- Measuring the diffusion of innovations with paragraph vector topic models
- Role of ecology in shaping external nasal morphology in bats and implications for olfactory tracking
- Neandertals on the beach: Use of marine resources at Grotta dei Moscerini (Latium, Italy)
- Allergic inflammation is initiated by IL-33–dependent crosstalk between mast cells and basophils
- High expression of olfactomedin-4 is correlated with chemoresistance and poor prognosis in pancreatic cancer
- Wattpad as a resource for literary studies. Quantitative and qualitative examples of the importance of digital social reading and readers’ comments in the margins
- Constructing and influencing perceived authenticity in science communication: Experimenting with narrative
- Development and validation of a prognostic model predicting symptomatic hemorrhagic transformation in acute ischemic stroke at scale in the OHDSI network
- Immune recovery markers in a double blind clinical trial comparing dolutegravir and raltegravir based regimens as initial therapy (SPRING-2)
- A non-canonical role for p27Kip1 in restricting proliferation of corneal endothelial cells during development
- Combined fiscal policies to promote healthier diets: Effects on purchases and consumer welfare
- Estimating the impact of drug use on US mortality, 1999-2016
- Complex patterns of cell growth in the placenta in normal pregnancy and as adaptations to maternal diet restriction
- Tofu intake is inversely associated with risk of breast cancer: A meta-analysis of observational studies
- Digging the diversity of Iberian bait worms Marphysa (Annelida, Eunicidae)
- Influence of light on the infection of Aureococcus anophagefferens CCMP 1984 by a “giant virus”
- MESSAR: Automated recommendation of metabolite substructures from tandem mass spectra
- Temporal ordering of input modulates connectivity formation in a developmental neuronal network model of the cortex
- Healthy lifestyle index and its association with hypertension among community adults in Sri Lanka: A cross-sectional study
- Manual dexterity of mice during food-handling involves the thumb and a set of fast basic movements
- Research on an evolutionary game model and simulation of a cluster innovation network based on fairness preference
- Reconstructing Krassilovia mongolica supports recognition of a new and unusual group of Mesozoic conifers
- Selection of memory clinic patients for CSF biomarker assessment can be restricted to a quarter of cases by using computerized decision support, without compromising diagnostic accuracy
- From organ to cell: Multi-level telomere length assessment in patients with idiopathic pulmonary fibrosis
- Training interval in cardiopulmonary resuscitation
- Quantum isomer search
- Ultrastructure of light-activated axons following optogenetic stimulation to produce late-phase long-term potentiation
- Optimization of tissue sampling for Borrelia burgdorferi in white-footed mice (Peromyscus leucopus)
- How do critical care staff respond to organisational challenge? A qualitative exploration into personality types and cognitive processing in critical care
- Symmetric core-cohesive blockmodel in preschool children’s interaction networks
- Effects of supplemental creatine and guanidinoacetic acid on spatial memory and the brain of weaned Yucatan miniature pigs
- Predicting antibacterial activity from snake venom proteomes
- Community-Based Health Planning and Services Plus programme in Ghana: A qualitative study with stakeholders in two Systems Learning Districts on improving the implementation of primary health care
- An investigation of transportation practices in an Ontario swine system using descriptive network analysis
- Comparison of gridded precipitation datasets for rainfall-runoff and inundation modeling in the Mekong River Basin
- Functional interactions in patients with hemianopia: A graph theory-based connectivity study of resting fMRI signal
- PCR for the detection of pathogens in neonatal early onset sepsis
- Mercury and selenium concentrations in fishes of the Upper Colorado River Basin, southwestern United States: A retrospective assessment
- The effects of dual-task cognitive interference on gait and turning in Huntington’s disease
- Effects of Allium hookeri on gut microbiome related to growth performance in young broiler chickens
- Novel imaging biomarkers for mapping the impact of mild mitochondrial uncoupling in the outer retina in vivo
- Hyperkalemia treatment modalities: A descriptive observational study focused on medication and healthcare resource utilization
- Age and altitude of residence determine anemia prevalence in Peruvian 6 to 35 months old children
- Web service QoS prediction using improved software source code metrics
- Long term impact of PositiveLinks: Clinic-deployed mobile technology to improve engagement with HIV care
- Comparison of post-transplantation diabetes mellitus incidence and risk factors between kidney and liver transplantation patients
- Mothers’ oral health literacy and children’s oral health status in Pikine, Senegal: A pilot study
- A definition-by-example approach and visual language for activity patterns in engineering disciplines
- A network analysis revealed the essential and common downstream proteins related to inguinal hernia
- Use of conventional cardiac troponin assay for diagnosis of non-ST-elevation myocardial infarction: ‘The Ottawa Troponin Pathway’
- Low risk pregnancies after a cesarean section: Determinants of trial of labor and its failure
- Exploratory analysis of the potential for advanced diagnostic testing to reduce healthcare expenditures of patients hospitalized with meningitis or encephalitis
- Airway epithelial specific deletion of Jun-N-terminal kinase 1 attenuates pulmonary fibrosis in two independent mouse models
- Identification and characterization of miRNAs involved in cold acclimation of zebrafish ZF4 cells
- Research on motion planning for an indoor spray arm based on an improved potential field method
- Camera-traps are a cost-effective method for surveying terrestrial squamates: A comparison with artificial refuges and pitfall traps
- Detailed analysis of the transverse arch of hallux valgus feet with and without pain using weightbearing ultrasound imaging and precise force sensors
- The role of survivin in the progression of pancreatic ductal adenocarcinoma (PDAC) and a novel survivin-targeted therapeutic for PDAC
- Filling the human resource gap through public-private partnership: Can private, community-based skilled birth attendants improve maternal health service utilization and health outcomes in a remote region of Bangladesh?
- HIV antiretroviral drugs, dolutegravir, maraviroc and ritonavir-boosted atazanavir use different pathways to affect inflammation, senescence and insulin sensitivity in human coronary endothelial cells
- Still standing: Recent patterns of post-fire conifer refugia in ponderosa pine-dominated forests of the Colorado Front Range
- Surrogate R-spondins for tissue-specific potentiation of Wnt Signaling
- Biogeographic study of human gut-associated crAssphage suggests impacts from industrialization and recent expansion
- Apolipoprotein-AI mimetic peptides D-4F and L-5F decrease hepatic inflammation and increase insulin sensitivity in C57BL/6 mice
- Treating patients with driving phobia by virtual reality exposure therapy – a pilot study
- The impact of race relations on NFL attendance: An econometric analysis
- The potential impact of the Affordable Care Act and Medicaid expansion on reducing colorectal cancer screening disparities in African American males
- Efficient processing of raster and vector data
- Rewilding with large herbivores: Positive direct and delayed effects of carrion on plant and arthropod communities
- Early life experience and alterations of group composition shape the social grooming networks of former pet and entertainment chimpanzees (Pan troglodytes)
- Muscarinic modulation of M and h currents in gerbil spherical bushy cells
- Therapeutic hypothermia after out of hospital cardiac arrest improve 1-year survival rate for selective patients
- Carotid plaques and neurological impairment in patients with acute cerebral infarction
- Deep learning based image reconstruction algorithm for limited-angle translational computed tomography
- Subterranean Deuteraphorura Absolon, 1901, (Hexapoda, Collembola) of the Western Carpathians — Troglomorphy at the northern distributional limit in Europe
- Fragmentation and inefficiencies in US equity markets: Evidence from the Dow 30
- Association between coffee drinking and telomere length in the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial
- Hyperbaric oxygen preconditioning and the role of NADPH oxidase inhibition in postischemic acute kidney injury induced in spontaneously hypertensive rats
- Rad51 paralogs and the risk of unselected breast cancer: A case-control study
- Aqueous ethanol extract of Libidibia ferrea (Mart. Ex Tul) L.P. Queiroz (juca) exhibits antioxidant and migration-inhibiting activity in human gastric adenocarcinoma (ACP02) cells
- Diagnostic differences in respiratory breathing patterns and work of breathing indices in children with Duchenne muscular dystrophy
- The role of narrative in collaborative reasoning and intelligence analysis: A case study
- Proportions of CD4 test results indicating advanced HIV disease remain consistently high at primary health care facilities across four high HIV burden countries
- Modelling of amino acid turnover in the horse during training and racing: A basis for developing a novel supplementation strategy
- Single-modal and multi-modal false arrhythmia alarm reduction using attention-based convolutional and recurrent neural networks
- Eye-gaze information input based on pupillary response to visual stimulus with luminance modulation
- Predictive value of comb-push ultrasound shear elastography for the differentiation of reactive and metastatic axillary lymph nodes: A preliminary investigation
- Type 1 diabetes is associated with an increased risk of venous thromboembolism: A retrospective population-based cohort study
- Trends of litter decomposition and soil organic matter stocks across forested swamp environments of the southeastern US
- Post mortem evaluation of inflammation, oxidative stress, and PPARγ activation in a nonhuman primate model of cardiac sympathetic neurodegeneration
- Were ancient foxes far more carnivorous than recent ones?—Carnassial morphological evidence
- Disruption in daily eating-fasting and activity-rest cycles in Indian adolescents attending school
- Plasma proteome profiling of freshwater and seawater life stages of rainbow trout (Oncorhynchus mykiss)
- Association between baseline abundance of Peptoniphilus, a Gram-positive anaerobic coccus, and wound healing outcomes of DFUs
- The earliest farming communities north of the Carpathians: The settlement at Gwoździec site 2
- Trends of the prevalence and incidence of hypertrophic cardiomyopathy in Korea: A nationwide population-based cohort study
- Percent amplitude of fluctuation: A simple measure for resting-state fMRI signal at single voxel level
- Antimicrobial activity of Asteraceae species against bacterial pathogens isolated from postmenopausal women
- Designing information provision to serve as a reminder of altruistic benefits: A case study of the risks of air pollution caused by industrialization
- Are changes in depressive symptoms, general health and residential area socio-economic status associated with trajectories of waist circumference and body mass index?
- Extracellular vesicles of U937 macrophage cell line infected with DENV-2 induce activation in endothelial cells EA.hy926
- FlexGraph: Flexible partitioning and storage for scalable graph mining
- Post-weaning infant-to-mother bonding in nutritionally independent female mice
- A little good is good enough: Ethical consumption, cheap excuses, and moral self-licensing
- Link-centric analysis of variation by demographics in mobile phone communication patterns
- Multimodal hand gesture recognition using single IMU and acoustic measurements at wrist
- Variance based weighting of multisensory head rotation signals for verticality perception
- Eligibility for hepatitis B antiviral therapy among adults in the general population in Zambia
- Tobacco smoking and health-related quality of life among university students: Mediating effect of depression
- Drivers of the opioid crisis: An appraisal of financial conflicts of interest in clinical practice guideline panels at the peak of opioid prescribing
- Nutritional inadequacies in commercial vegan foods for dogs and cats
- LTA1 and dmLT enterotoxin-based proteins activate antigen-presenting cells independent of PKA and despite distinct cell entry mechanisms
- The Shapley value for a fair division of group discounts for coordinating cooling loads
- Comparison and evaluation of the morphology of crowns generated by biogeneric design technique with CEREC chairside system
- Assessing risk factors and impact of cyberbullying victimization among university students in Myanmar: A cross-sectional study
- Incidence of hospital-acquired pressure ulcers in patients with "minimal risk" according to the "Norton-MI" scale
- Intra-host symbiont diversity in eastern Pacific cold seep tubeworms identified by the 16S-V6 region, but undetected by the 16S-V4 region
- Lipoprotein(a) plasma levels are not associated with survival after acute coronary syndromes: An observational cohort study
- Use of Nanotrap particles for the capture and enrichment of Zika, chikungunya and dengue viruses in urine
- Pancreatic secretory trypsin inhibitor reduces multi-organ injury caused by gut ischemia/reperfusion in mice
- The effect of diet on the gastrointestinal microbiome of juvenile rehabilitating green turtles (Chelonia mydas)
- Biochemical characterization of Ty1 retrotransposon protease
- Lateral pressure equalisation as a principle for designing support surfaces to prevent deep tissue pressure ulcers
- Immunomodulatory function of the cystic fibrosis modifier gene BPIFA1
- The validation of the Beijing version of the Montreal Cognitive Assessment in Chinese patients undergoing hemodialysis
- All of gene expression (AOE): An integrated index for public gene expression databases
- Characterization of the visceral and neuronal phenotype of 4L/PS-NA mice modeling Gaucher disease
- Inflammasome expression is higher in ovarian tumors than in normal ovary
- HCV genotype profile in Brazil of mono-infected and HIV co-infected individuals: A survey representative of an entire country
- Engaging with change: Information and communication technology professionals’ perspectives on change at the mid-point in the UK/EU Brexit process
- Adherence to iron-folic acid supplement and associated factors among antenatal care attending pregnant mothers in governmental health institutions of Adwa town, Tigray, Ethiopia: Cross-sectional study
- Flower, seed, and fruit development in three Tunisian species of Polygonum: Implications for their taxonomy and evolution of distyly in Polygonaceae
- Development of a risk score for prediction of poor treatment outcomes among patients with multidrug-resistant tuberculosis
- Preclinical evaluation of AT-527, a novel guanosine nucleotide prodrug with potent, pan-genotypic activity against hepatitis C virus
- Aqueous extract from Mangifera indica Linn. (Anacardiaceae) leaves exerts long-term hypoglycemic effect, increases insulin sensitivity and plasma insulin levels on diabetic Wistar rats
- Marine seafood production via intense exploitation and cultivation in China: Costs, benefits, and risks
- Signatures of medical student applicants and academic success
- Discovery of Jogalong virus, a novel hepacivirus identified in a Culex annulirostris (Skuse) mosquito from the Kimberley region of Western Australia
- The effects of extended photoperiod and warmth on hair growth in ponies and horses at different times of year
- Modeling the effect of prolonged ethanol exposure on global gene expression and chromatin accessibility in normal 3D colon organoids
- Clinical, cytogenetic and molecular genetic characterization of a tandem fusion translocation in a male Holstein cattle with congenital hypospadias and a ventricular septal defect
- Severity of misophonia symptoms is associated with worse cognitive control when exposed to misophonia trigger sounds
- Detection of Torque Teno Virus (TTV) and TTV-Like Minivirus in patients with presumed infectious endophthalmitis in India
- CD4 rate of increase is preferred to CD4 threshold for predicting outcomes among virologically suppressed HIV-infected adults on antiretroviral therapy
- The evolution of secondary flow phenomena and their effect on primary shock conditions in shock tubes: Experimentation and numerical model
- Estimating the basic reproduction number of a pathogen in a single host when only a single founder successfully infects
- What drugs modify the risk of iatrogenic impulse-control disorders in Parkinson’s disease? A preliminary pharmacoepidemiologic study
- Evaluating emotional distress and health-related quality of life in patients with heart failure and their family caregivers: Testing dyadic dynamics using the Actor-Partner Interdependence Model
- Community- and trophic-level responses of soil nematodes to removal of a non-native tree at different stages of invasion
- Association of ECG parameters with late gadolinium enhancement and outcome in patients with clinical suspicion of acute or subacute myocarditis referred for CMR imaging
- Sonographic measurement of normal common bile duct diameter and associated factors at the University of Gondar comprehensive specialized hospital and selected private imaging center in Gondar town, North West Ethiopia
- Catchment-scale export of antibiotic resistance genes and bacteria from an agricultural watershed in central Iowa
- Impact of multi-drug resistant bacteria on economic and clinical outcomes of healthcare-associated infections in adults: Systematic review and meta-analysis
- Characterization of a universal screening approach for congenital CMV infection based on a highly-sensitive, quantitative, multiplex real-time PCR assay
- Proof-of-concept for a non-invasive, portable, and wireless device for cardiovascular monitoring in pediatric patients
- On PTV definition for glioblastoma based on fiber tracking of diffusion tensor imaging data
- Multiregional origins of the domesticated tetraploid wheats
- Racism against Totonaco women in Veracruz: Intercultural competences for health professionals are necessary
- Increased inflammation and endothelial markers in patients with late severe post-thrombotic syndrome
- Genes associated with body weight gain and feed intake identified by meta-analysis of the mesenteric fat from crossbred beef steers
- Intraoperative computed tomography imaging for dose calculation in intraoperative electron radiation therapy: Initial clinical observations
- Multiple paedomorphic lineages of soft-substrate burrowing invertebrates: parallels in the origin of Xenocratena and Xenoturbella
- Human lung epithelial BEAS-2B cells exhibit characteristics of mesenchymal stem cells
- Simple non-mydriatic retinal photography is feasible and demonstrates retinal microvascular dilation in Chronic Obstructive Pulmonary Disease (COPD)
- Evaluating poverty alleviation strategies in a developing country
- RNAmountAlign: Efficient software for local, global, semiglobal pairwise and multiple RNA sequence/structure alignment
- Maternal depressive symptoms and children’s cognitive development: Does early childcare and child’s sex matter?
- Pan-cancer analysis of somatic mutations and epigenetic alterations in insulated neighbourhood boundaries
- Evaluation of a bioengineered ACL matrix’s osteointegration with BMP-2 supplementation
- Psychosocial profiles of physical activity fluctuation in office employees: A latent profile analysis
- Prevalence and characteristics of Livestock-Associated Methicillin-Resistant Staphylococcus aureus (LA-MRSA) isolated from chicken meat in the province of Quebec, Canada
- HIV treatment response among female sex workers participating in a treatment as prevention demonstration project in Cotonou, Benin
- Soluble AXL as a marker of disease progression and survival in melanoma
- Using machine learning methods to determine a typology of patients with HIV-HCV infection to be treated with antivirals
- Quantifying tourism booms and the increasing footprint in the Arctic with social media data
- Gender differences influence over insomnia in Korean population: A cross-sectional study
- Impact of scion/rootstock reciprocal effects on metabolomics of fruit juice and phloem sap in grafted Citrus reticulata
- Adapting cognitive diagnosis computerized adaptive testing item selection rules to traditional item response theory
- Usability assessment of seven HIV self-test devices conducted with lay-users in Johannesburg, South Africa
- Autumn shifts in cold tolerance metabolites in overwintering adult mountain pine beetles
- Management of veterinary anaesthesia in small animals: A survey of current practice in Quebec
- Genetic structure of the European hedgehog (Erinaceus europaeus) in Denmark
- Molecular karyotyping of Siberian wild rye (Elymus sibiricus L.) with oligonucleotide fluorescence in situ hybridization (FISH) probes
- Umbilical cord separation time, predictors and healing complications in newborns with dry care
- The strain distribution in the lumbar anterior longitudinal ligament is affected by the loading condition and bony features: An in vitro full-field analysis
- Marine resource congestion in China: Identifying, measuring, and assessing its impact on sustainable development of the marine economy
- Analysis of attitudinal components towards statistics among students from different academic degrees
- Effects of fatigue induced by repeated-sprint on kicking accuracy and velocity in female soccer players
- A pre-clinical validation plan to evaluate analytical sensitivities of molecular diagnostics such as BD MAX MDR-TB, Xpert MTB/Rif Ultra and FluoroType MTB
- Leadership for success in transforming medical abortion policy in Canada
- Clinical correlates associated with the long-term response of bipolar disorder patients to lithium, valproate or lamotrigine: A retrospective study
- Determinants of change in long-acting or permanent contraceptives use in Ethiopia; A multivariate decomposition analysis of data from the Ethiopian demographic and health survey
- Forecasting stock prices with long-short term memory neural network based on attention mechanism
- On the genus Crossaster (Echinodermata: Asteroidea) and its distribution
- Intracellular and in vivo evaluation of imidazo[2,1-b]thiazole-5-carboxamide anti-tuberculosis compounds
- Serum amyloid P component promotes formation of distinct aggregated lysozyme morphologies and reduces toxicity in Drosophila flies expressing F57I lysozyme
- Optogenetically induced cellular habituation in non-neuronal cells
- An integrated vitamin E-coated polymer hybrid nanoplatform: A lucrative option for an enhanced in vitro macrophage retention for an anti-hepatitis B therapeutic prospect
- The effect of strontium and silicon substituted hydroxyapatite electrochemical coatings on bone ingrowth and osseointegration of selective laser sintered porous metal implants
- Modeling the Theory of Planned Behaviour to predict adherence to preventive dental visits in preschool children
- Molecular prevalence of Bartonella, Babesia, and hemotropic Mycoplasma species in dogs with hemangiosarcoma from across the United States
- Color discrimination and gas chromatography-mass spectrometry fingerprint based on chemometrics analysis for the quality evaluation of Schizonepetae Spica
- Comparisons of recurrence-free survival and overall survival between microwave versus radiofrequency ablation treatment for hepatocellular carcinoma: A multiple centers retrospective cohort study with propensity score matching
- Transcriptome-wide identification of novel circular RNAs in soybean in response to low-phosphorus stress
- Oral misoprostol, low dose vaginal misoprostol, and vaginal dinoprostone for labor induction: Randomized controlled trial
- The association between dietary patterns before and in early pregnancy and the risk of gestational diabetes mellitus (GDM): Data from the Malaysian SECOST cohort
- Gene expression noise in a complex artificial toxin expression system
- Dynamic Extreme Aneuploidy (DEA) in the vegetable pathogen Phytophthora capsici and the potential for rapid asexual evolution
- Assertive, trainable and older dogs are perceived as more dominant in multi-dog households
- Prediction of Uropathogens by Flow Cytometry and Dip-stick Test Results of Urine Through Multivariable Logistic Regression Analysis
- Accelerated brain aging towards transcriptional inversion in a zebrafish model of the K115fs mutation of human PSEN2
- Copper to Tuscany – Coals to Newcastle? The dynamics of metalwork exchange in early Italy
- The Brazilian TP53 mutation (R337H) and sarcomas
- Interleukin 6 is increased in preclinical HNSCC models of acquired cetuximab resistance, but is not required for maintenance of resistance
- Detection of amitraz resistance and reduced treatment efficacy in the Varroa Mite, Varroa destructor, within commercial beekeeping operations
- Impact of viral disease hypophagia on pig jejunal function and integrity
- Enzyme response of activated sludge to a mixture of emerging contaminants in continuous exposure
- Molecular evidence for horizontal transmission of chelonid alphaherpesvirus 5 at green turtle (Chelonia mydas) foraging grounds in Queensland, Australia
- Technology anxiety and resistance to change behavioral study of a wearable cardiac warming system using an extended TAM for older adults
- Evaluation and validation of 2D biomechanical models of the knee for radiograph-based preoperative planning in total knee arthroplasty
- Soil-Transmitted Helminth infections reduction in Bhutan: A report of 29 years of deworming
- Age-related differences in the temporal dynamics of spectral power during memory encoding
- cagA gene EPIYA motif genetic characterization from Colombian Helicobacter pylori isolates: Standardization of a molecular test for rapid clinical laboratory detection
- Mugharat an-Nachcharini: A specialized sheep-hunting camp reveals high-altitude habitats in the earliest Neolithic of the Central Levant
- Spectral characteristics of urine from patients with end-stage kidney disease analyzed using Raman Chemometric Urinalysis (Rametrix)
- Clinicians’ communication with patients receiving a MCI diagnosis: The ABIDE project
- Quantitative PCR provides a simple and accessible method for quantitative microbiota profiling
- Fast quantitative time lapse displacement imaging of endothelial cell invasion
- Two novel mutations in MSX1 causing oligodontia
- 7,200 years old constructions and mudbrick technology: The evidence from Tel Tsaf, Jordan Valley, Israel
- Tuberculosis recurrences and predictive factors in a vulnerable population in Catalonia
- Dome-shaped macula in children and adolescents
- Barriers in the access, diagnosis and treatment completion for tuberculosis patients in central and western Nepal: A qualitative study among patients, community members and health care workers
- Evaluation of KRAS, NRAS and BRAF mutations detection in plasma using an automated system for patients with metastatic colorectal cancer
- Targeted transcriptomic study of the implication of central metabolic pathways in mannosylerythritol lipids biosynthesis in Pseudozyma antarctica T-34
- Preliminary evidences of the presence of extracellular DNA single stranded forms in soil
- A comparison of quality of life between patients treated with different dialysis modalities in Taiwan
- The effectiveness of substance use interventions for homeless and vulnerably housed persons: A systematic review of systematic reviews on supervised consumption facilities, managed alcohol programs, and pharmacological agents for opioid use disorder
- Spatiotemporal characteristics and driving forces of construction land expansion in Yangtze River economic belt, China
- Comparison of Monocyte Distribution Width (MDW) and Procalcitonin for early recognition of sepsis
- Morphological association between the muscles and bones in the craniofacial region
- Transcriptome analysis of Actinidia chinensis in response to Botryosphaeria dothidea infection
- Evaluating two decision aids for Australian men supporting informed decisions about prostate cancer screening: A randomised controlled trial
- Serum galectins as potential biomarkers of inflammatory bowel diseases
- Linguistic Z-number weighted averaging operators and their application to portfolio selection problem
- Comparative study on skin protection activity of polyphenol-rich extract and polysaccharide-rich extract from Sargassum vachellianum
- Real-world data about emotional stress, disability and need for social care in a German IBD patient cohort
- The regenerative compatibility: A synergy between healthy ecosystems, environmental attitudes, and restorative experiences
- Fusion of augmented reality imaging with the endoscopic view for endonasal skull base surgery; a novel application for surgical navigation based on intraoperative cone beam computed tomography and optical tracking
- Functional characterization of NK cells in Mexican pediatric patients with acute lymphoblastic leukemia: Report from the Mexican Interinstitutional Group for the Identification of the Causes of Childhood Leukemia
- Radiomics signature for prediction of lateral lymph node metastasis in conventional papillary thyroid carcinoma
- Antenatal depression and its association with adverse birth outcomes in low and middle-income countries: A systematic review and meta-analysis
- Perceptions of risk and influences of choice in pregnant women with obesity. An evidence synthesis of qualitative research
- The role of refugee and migrant migration status on medication adherence: Mediation through illness perceptions
- Job stress and emotional exhaustion at work in Spanish workers: Does unhealthy work affect the decision to drive?
- Correction: Amphibians on the hotspot: Molecular biology and conservation in the South American Atlantic Rainforest
- Sexual risk classes among youth experiencing homelessness: Relation to childhood adversities, current mental symptoms, substance use, and HIV testing
- Time for change is now: Experiences of participants in a community-based approach for iron and folic acid supplementation in a rural county in Kenya, a qualitative study
- Non-invasive genetic monitoring for the threatened valley elderberry longhorn beetle
- Statistical learning for turboshaft helicopter accidents using logistic regression
- Vegetation change over seven years in the largest protected Pacific Northwest Bunchgrass Prairie remnant
- The effect of various metal-salts on the sedimentation of soil in a water-based suspension
- Using electronic health record system triggers to target delivery of a patient-centered intervention to improve venous thromboembolism prevention for hospitalized patients: Is there a differential effect by race?
- Effects of CK2β subunit down-regulation on Akt signalling in HK-2 renal cells
- Novel broad-spectrum activity-based probes to profile malarial cysteine proteases
- Health-related quality of life in cancer patients treated with immune checkpoint inhibitors: A systematic review on reporting of methods in randomized controlled trials
- Environmental tobacco smoke (ETS) and hyperlipidemia modified by perceived work stress
- Association between opioid analgesic therapy and initiation of buprenorphine management: An analysis of prescription drug monitoring program data
- Effect of a community-based approach of iron and folic acid supplementation on compliance by pregnant women in Kiambu County, Kenya: A quasi-experimental study
- Radiocarbon dating of two old African baobabs from India
- Improvement project in higher education institutions: A BPEP-based model
- An updated evaluation of serum sHER2, CA15.3, and CEA levels as biomarkers for the response of patients with metastatic breast cancer to trastuzumab-based therapies
- Genome-wide association study of metabolic syndrome in Korean populations
- The diagnostic accuracy of liver fibrosis in non-viral liver diseases using acoustic radiation force impulse elastography: A systematic review and meta-analysis
- Drug therapy problems and treatment satisfaction among ambulatory patients with epilepsy in a specialized hospital in Ethiopia
- Short- & long-term effects of monetary and non-monetary incentives to cooperate in public good games: An experiment
- Niche modeling reveals life history shifts in birds at La Brea over the last twenty millennia
- Morphological consequences of artificial cranial deformation: Modularity and integration
- Distributed flux balance analysis simulations of serial biomass fermentation by two organisms
- Plasma kynurenines and prognosis in patients with heart failure
- Occurrence and distribution of anthropogenic persistent organic pollutants in coastal sediments and mud shrimps from the wetland of central Taiwan
- Intensified visual clutter induces increased sympathetic signalling, poorer postural control, and faster torsional eye movements during visual rotation
- Restoration of cortical symmetry and binaural function: Cortical auditory evoked responses in adult cochlear implant users with single sided deafness
- A smartphone-enabled wireless and batteryless implantable blood flow sensor for remote monitoring of prosthetic heart valve function
- Gut microbiota composition alterations are associated with the onset of diabetes in kidney transplant recipients
- Shock index and TIMI risk index as valuable prognostic tools in patients with acute coronary syndrome complicated by cardiogenic shock
- Merit overrules theory of mind when young children share resources with others
- Economic burden of maternal morbidity – A systematic review of cost-of-illness studies
- Comparison of balance changes after inspiratory muscle or Otago exercise training
- Correction: Escherichia coli and Salmonella spp. isolated from Australian meat chickens remain susceptible to critically important antimicrobial agents
- Metabolic analysis of amino acids and vitamin B6 pathways in lymphoma survivors with cancer related chronic fatigue
- Cell-free DNA donor fraction analysis in pediatric and adult heart transplant patients by multiplexed allele-specific quantitative PCR: Validation of a rapid and highly sensitive clinical test for stratification of rejection probability
- Immunopathogenesis of canine chronic ulcerative stomatitis
- Correction: Quantification of speech and synchrony in the conversation of adults with autism spectrum disorder
- Efficacy and safety of ultrasonic circular cyclocoagulation with second-generation probe in glaucoma: A retrospective study
- Generalizing findings from a randomized controlled trial to a real-world study of the iLookOut, an online education program to improve early childhood care and education providers’ knowledge and attitudes about reporting child maltreatment
- Self-selection of food ingredients and agricultural by-products by the house cricket, Acheta domesticus (Orthoptera: Gryllidae): A holistic approach to develop optimized diets
- Machine learning detection of Atrial Fibrillation using wearable technology
- Comparative proteomic analysis of different stages of breast cancer tissues using ultra high performance liquid chromatography tandem mass spectrometer
- A cross-sectional study of psychopathy and khat abuse among prisoners in the correctional institution in Jimma, Ethiopia
- Head impulse compensatory saccades: Visual dependence is most evident in bilateral vestibular loss
- Complementarity of empirical and process-based approaches to modelling mosquito population dynamics with Aedes albopictus as an example—Application to the development of an operational mapping tool of vector populations
- Pepsin promotes laryngopharyngeal neoplasia by modulating signaling pathways to induce cell proliferation
- When and what to test for: A cost-effectiveness analysis of febrile illness test-and-treat strategies in the era of responsible antibiotic use
- Comparison of effects and safety in providing controlled hypotension during surgery between dexmedetomidine and magnesium sulphate: A meta-analysis of randomized controlled trials
- The gene encoding the ketogenic enzyme HMGCS2 displays a unique expression during gonad development in mice
- Seroepidemiological study of rubella in Vojvodina, Serbia: 24 years after the introduction of the MMR vaccine in the national immunization programme
- Efficacy of a mitochondrion-targeting agent for reducing the level of urinary protein in rats with puromycin aminonucleoside-induced minimal-change nephrotic syndrome
- Association of endothelial nitric oxide synthase (NOS3) gene polymorphisms with primary open-angle glaucoma in a Saudi cohort
- Antitrust analysis with upward pricing pressure and cost efficiencies
- Machine learning models for identifying preterm infants at risk of cerebral hemorrhage
- Natural selection contributes to food web stability
- Pyramiding QTLs controlling tolerance against drought, salinity, and submergence in rice through marker assisted breeding
- Diversity and plant growth-promoting functions of diazotrophic/N-scavenging bacteria isolated from the soils and rhizospheres of two species of Solanum
- Sustainability effects of motor control stabilisation exercises on pain and function in chronic nonspecific low back pain patients: A systematic review with meta-analysis and meta-regression
- Sofosbuvir-based regimen for genotype 2 HCV infected patients in Taiwan: A real world experience
- The virulence domain of Shigella IcsA contains a subregion with specific host cell adhesion function
- Sequencing artifacts derived from a library preparation method using enzymatic fragmentation
- Analysis of the Rdr1 gene family in different Rosaceae genomes reveals an origin of an R-gene cluster after the split of Rubeae within the Rosoideae subfamily
- Concomitant phytonutrient and transcriptome analysis of mature fruit and leaf tissues of tomato (Solanum lycopersicum L. cv. Oregon Spring) grown using organic and conventional fertilizer
- Quantitative analysis of adsorption and desorption of volatile organic compounds on reusable zeolite filters using gas chromatography
- Comparing bioinformatic pipelines for microbial 16S rRNA amplicon sequencing
- TMEM98 is a negative regulator of FRAT mediated Wnt/ß-catenin signalling
- Modeling migration patterns in the USA under sea level rise
- Quo vadis Pantanal? Expected precipitation extremes and drought dynamics from changing sea surface temperature
- Cloud-computing and machine learning in support of country-level land cover and ecosystem extent mapping in Liberia and Gabon
- An exploratory study on the quality of patient screening and counseling for hypertension management in Tanzania
- Relation of fibroblast growth factor receptor 2 expression to hepatocellular carcinoma recurrence after liver resection
- The Brief Measure of Emotional Preoperative Stress (B-MEPS) as a new predictive tool for postoperative pain: A prospective observational cohort study
- The impact of diabetes mellitus medication on the incidence of endogenous endophthalmitis
- Correction: Chl1 DNA helicase and Scc2 function in chromosome condensation through cohesin deposition
- Clinical and pathological features of thrombotic microangiopathy influencing long-term kidney transplant outcomes
- Multidisciplinary investigation of two Egyptian child mummies curated at the University of Tartu Art Museum, Estonia (Late/Graeco-Roman Periods)
- Occupational exposure to particulate matter from air pollution in the outdoor workplaces in Almaty during the cold season
- Morphological adjustment in free-living Steinernema feltiae infective juveniles to increasing concentration of Nemafric-BL phytonematicide
- Murine Surf4 is essential for early embryonic development
- Using mHealth to improve health care delivery in India: A qualitative examination of the perspectives of community health workers and beneficiaries
- Algorithmic handwriting analysis of the Samaria inscriptions illuminates bureaucratic apparatus in biblical Israel
- Key necroptotic proteins are required for Smac mimetic-mediated sensitization of cholangiocarcinoma cells to TNF-α and chemotherapeutic gemcitabine-induced necroptosis
- Concurrent lipidomics and proteomics on malignant plasma cells from multiple myeloma patients: Probing the lipid metabolome
- Short treatment with antalarmin alters adrenal gland receptors in the rat model of endometriosis
- Is it really always only the others who are to blame? GP’s view on medical overuse. A questionnaire study
- Serum visfatin and vaspin levels in hepatocellular carcinoma (HCC)
- Retraction: SDR9C7 Promotes Lymph Node Metastases in Patients with Esophageal Squamous Cell Carcinoma
- iTRAQ proteomics reveals the regulatory response to Magnaporthe oryzae in durable resistant vs. susceptible rice genotypes
- A smartphone-based test for the assessment of attention deficits in delirium: A case-control diagnostic test accuracy study in older hospitalised patients
- Association between tuberculosis and depression on negative outcomes of tuberculosis treatment: A systematic review and meta-analysis
- Incidence and predictors of loss to follow up among adult HIV patients on antiretroviral therapy in University of Gondar Comprehensive Specialized Hospital: A competing risk regression modeling
- Point-of-care diagnostic (POCD) method for detecting Bursaphelenchus xylophilus in pinewood using recombinase polymerase amplification (RPA) with the portable optical isothermal device (POID)
- Bioluminescent imaging of Arabidopsis thaliana using an enhanced Nano-lantern luminescence reporter system
- Biosynthetic pathway of indole-3-acetic acid in ectomycorrhizal fungi collected from northern Thailand
- Clinical implications of elevated serum interleukin-6 in IgG4-related disease
- Downscaling NLDAS-2 daily maximum air temperatures using MODIS land surface temperatures
- Sex-specific and opposite modulatory aspects revealed by PPI network and pathway analysis of ischemic stroke in humans
- Plasma Trimethylamine-N-oxide and impaired glucose regulation: Results from The Oral Infections, Glucose Intolerance and Insulin Resistance Study (ORIGINS)
- Self-esteem and other risk factors for depressive symptoms among adolescents in United Arab Emirates
- Control of the microsporidian parasite Nosema ceranae in honey bees (Apis mellifera) using nutraceutical and immuno-stimulatory compounds
- The effect of storage conditions on microbial communities in stool
- Role of donor genotype in RT-QuIC seeding activity of chronic wasting disease prions using human and bank vole substrates
- Influence of flow on phosphorus-dynamics and particle size in agricultural drainage ditch sediments
- A prospective, randomized, double-blind trial to compare body weight-adjusted and fixed doses of palonosetron for preventing postoperative nausea and vomiting in obese female patients
- Application of computerized 3D-CT texture analysis of pancreas for the assessment of patients with diabetes
- Predictive validation and forecasts of short-term changes in healthcare expenditure associated with changes in smoking behavior in the United States
- An information-based approach to handle various types of uncertainty in fuzzy bodies of evidence
- Oral magnesium supplementation for leg cramps in pregnancy—An observational controlled trial
- Health care professionals’ knowledge of commonly used sedative, analgesic and neuromuscular drugs: A single center (Rambam Health Care Campus), prospective, observational survey
- Campylobacter portucalensis sp. nov., a new species of Campylobacter isolated from the preputial mucosa of bulls
- OGG1 deficiency alters the intestinal microbiome and increases intestinal inflammation in a mouse model
- Transgenic interleukin 11 expression causes cross-tissue fibro-inflammation and an inflammatory bowel phenotype in mice
- Novel method to measure temporal windows based on eye movements during viewing of the Necker cube
- Whole blood transcriptomic analysis of beef cattle at arrival identifies potential predictive molecules and mechanisms that indicate animals that naturally resist bovine respiratory disease
- Effects of smoke flavoring using different wood chips and barbecuing on the formation of polycyclic aromatic hydrocarbons and heterocyclic aromatic amines in salmon fillets
- Sleep quality and sex modify the relationships between trait energy and fatigue on state energy and fatigue
- The role of peer, parental, and school norms in predicting adolescents’ attitudes and behaviours of majority and different minority ethnic groups in Croatia
- Filtered beauty in Oslo and Tokyo: A spatial frequency analysis of facial attractiveness
- The impact of rehabilitation frequency on the risk of stroke in patients with rheumatoid arthritis
- Availability, prices and affordability of selected antibiotics and medicines against non-communicable diseases in western Cameroon and northeast DR Congo
- The effect of mutations derived from mouse-adapted H3N2 seasonal influenza A virus to pathogenicity and host adaptation
- Detection of posttraumatic pneumothorax using electrical impedance tomography—An observer-blinded study in pigs with blunt chest trauma
- Educators’ perceptions of organisational readiness for implementation of a pre-adolescent transdisciplinary school health intervention for inter-generational outcomes
- Beyond the heterodimer model for mineralocorticoid and glucocorticoid receptor interactions in nuclei and at DNA
- The effects of sport expertise and shot results on basketball players’ action anticipation
- Framework and algorithms for identifying honest blocks in blockchain
- Efficacy and safety of anti-viral therapy for Hepatitis B virus-associated glomerulonephritis: A meta-analysis
- Selective transmission of some HIV-1 subtype C variants might depend on Envelope stimulating dendritic cells to secrete IL-10
- Noise reduction and quantification of fiber orientations in greyscale images
- Exploring the impact of terminology differences in blood and organ donor decision making
- Ontogenetic similarities between giraffe and sauropod neck osteological mobility
- Load transfer mechanism and critical length of anchorage zone for anchor bolt
- Income inequalities in stroke incidence and mortality: Trends in stroke-free and stroke-affected life years based on German health insurance data
- Community’s perception, experiences and health seeking behavior towards newborn illnesses in Debre Libanos District, North Shoa, Oromia, Ethiopia: Qualitative study
- Platelet indices significantly correlate with liver fibrosis in HCV-infected patients
- Reanalysis of the Bridge et al. study of suicide following release of 13 Reasons Why
- Validation of the easyscreen flavivirus dengue alphavirus detection kit based on 3base amplification technology and its application to the 2016/17 Vanuatu dengue outbreak
- The nitrate content of fresh and cooked vegetables and their health-related risks
- Bioreactor for mobilization of mesenchymal stem/stromal cells into scaffolds under mechanical stimulation: Preliminary results
- Serotonin transporter dependent modulation of food-seeking behavior
- Implicit task switching in Parkinson’s disease is preserved when on medication
- Root treatment with oxathiapiprolin, benthiavalicarb or their mixture provides prolonged systemic protection against oomycete foliar pathogens
- Real-world effectiveness and safety of ranibizumab for the treatment of myopic choroidal neovascularization: Results from the LUMINOUS study
- Non-gradient and genotype-dependent patterns of RSV gene expression
- Multiplex real-time PCR for the detection of Clavibacter michiganensis subsp. michiganensis, Pseudomonas syringae pv. tomato and pathogenic Xanthomonas species on tomato plants
- The 24-hour urinary cortisol in post-traumatic stress disorder: A meta-analysis
- Parasites modulate the gut-microbiome in insects: A proof-of-concept study
- The dynamics of shapes of vesicle membranes with time dependent spontaneous curvature
- Vascularization and biocompatibility of poly(ε-caprolactone) fiber mats for rotator cuff tear repair
- The shield of self-compassion: A buffer against disordered eating risk from physical appearance perfectionism
- Disease-specific out-of-pocket healthcare expenditure in urban Bangladesh: A Bayesian analysis
- Advanced biofilm analysis in streams receiving organic deicer runoff
- Upregulation of long non-coding RNA ROR1-AS1 promotes cell growth and migration in bladder cancer by regulation of miR-504
- Method development and validation for rapid identification of epigallocatechin gallate using ultra-high performance liquid chromatography
- Neonatal sepsis in Iran: A systematic review and meta-analysis on national prevalence and causative pathogens
- Drug-eluting versus bare-metal stents for first myocardial infarction in patients with atrial fibrillation: A nationwide population-based cohort study
- Same-day antiretroviral therapy initiation for HIV-infected adults in South Africa: Analysis of routine data
- Health-related quality of life among patients with type 2 diabetes mellitus in Eastern Province, Saudi Arabia: A cross-sectional study
- Photocatalytic biocidal effect of copper doped TiO2 nanotube coated surfaces under laminar flow, illuminated with UVA light on Legionella pneumophila
- The interoceptive hippocampus: Mouse brain endocrine receptor expression highlights a dentate gyrus (DG)–cornu ammonis (CA) challenge–sufficiency axis
- Educational attainment and HIV testing and counselling service utilisation during antenatal care in Ghana: Analysis of Demographic and Health Surveys
- Dissection of flag leaf metabolic shifts and their relationship with those occurring simultaneously in developing seed by application of non-targeted metabolomics
- Centromeres of Cucumis melo L. comprise Cmcent and two novel repeats, CmSat162 and CmSat189
- Acute high-intensity and moderate-intensity interval exercise do not change corticospinal excitability in low fit, young adults
- “I like the way I am, but I feel like I could get a little bit bigger”: Perceptions of body image among adolescents and youth living with HIV in Durban, South Africa
- Nanoparticle-based ‘turn-on’ scattering and post-sample fluorescence for ultrasensitive detection of water pollution in wider window
- The relationship of moral sensitivity and patient safety attitudes with nursing students’ perceptions of disclosure of patient safety incidents: A cross-sectional study
- Insights into the strategy of micro-environmental adaptation: Transcriptomic analysis of two alvinocaridid shrimps at a hydrothermal vent
- Thirty-day readmission after medical-surgical hospitalization for people who experience imprisonment in Ontario, Canada: A retrospective cohort study
- The effect of long-term brine discharge from desalination plants on benthic foraminifera
- Hyper-spectral response and estimation model of soil degradation in Kenli County, the Yellow River Delta
- Prescribing trends of glaucoma drugs in six major cities of China from 2013 to 2017
- Significant changes in synovial fluid microRNAs after high tibial osteotomy in medial compartmental knee osteoarthritis: Identification of potential prognostic biomarkers
- Reassortment and adaptive mutations of an emerging avian influenza virus H7N4 subtype in China
- Ischemia and reperfusion injury in superficial inferior epigastric artery-based vascularized lymph node flaps
- High failure rates of protease inhibitor-based antiretroviral treatment in rural Tanzania – A prospective cohort study
- Switchable resolution in soft x-ray tomography of single cells
- Mitochondrial DNA variations and mitochondrial dysfunction in Fanconi anemia
- Extended-spectrum beta-lactamase (ESBL)-producing and non-ESBL-producing Escherichia coli isolates causing bacteremia in the Netherlands (2014 – 2016) differ in clonal distribution, antimicrobial resistance gene and virulence gene content
- Molecular characterization of blaKHM-1 encoding plasmid in an Enterobacter hormaechei subsp. hoffmannii isolate from blood culture
- PR3 levels are impaired in plasma and PBMCs from Arabs with cardiovascular diseases
- Sex differences in self-regulation in early, middle and late adolescence: A large-scale cross-sectional study
- Interaction between elevated temperature and different types of Na-salicylate treatment in Brachypodium dystachion
- A highway crash risk assessment method based on traffic safety state division
- A brain connectivity characterization of children with different levels of mathematical achievement based on graph metrics
- Quantifying the level of difficulty to treat major depressive disorder with antidepressants: Treatment Resistance to Antidepressants Evaluation Scale
- Occupational gender segregation and economic growth in U.S. local labor markets, 1980 through 2010
- The association of telomere length and telomerase activity with adverse outcomes in older patients with non-ST-elevation acute coronary syndrome
- Construction of a high-density genetic map and fine mapping of a candidate gene locus for a novel branched-spike mutant in barley
- Alterations of aqueous humor Aβ levels in Aβ-infused and transgenic mouse models of Alzheimer disease
- Parameters impacting the live birth rate per transfer after frozen single euploid blastocyst transfer
- Deep2Full: Evaluating strategies for selecting the minimal mutational experiments for optimal computational predictions of deep mutational scan outcomes
- Economic compensation interventions to increase uptake of voluntary medical male circumcision for HIV prevention: A systematic review and meta-analysis
- Distinctive effect of anesthetics on the effect of limb remote ischemic postconditioning following ischemic stroke
- Natural hybridization between Phyllagathis and Sporoxeia species produces a hybrid without reproductive organs
- Preliminary evaluation of a novel nine-biomarker profile for the prediction of autism spectrum disorder
- The impact of peer attachment on prosocial behavior, emotional difficulties and conduct problems in adolescence: The mediating role of empathy
- Spatial and climatic variables independently drive elevational gradients in ant species richness in the Eastern Himalaya
- What is the qualitative evidence concerning the risks, diagnosis, management and consequences of gastrointestinal infections in the community in the United Kingdom? A systematic review and meta-ethnography
- Naringenin protects AlCl3/D-galactose induced neurotoxicity in rat model of AD via attenuation of acetylcholinesterase levels and inhibition of oxidative stress
- Key barriers and enablers associated with uptake and continuation of oral pre-exposure prophylaxis (PrEP) in the public sector in Zimbabwe: Qualitative perspectives of general population clients at high risk for HIV
- Characterizing the University of California’s tenure-track teaching position from the faculty and administrator perspectives
- Restoration of Mal overcomes the defects of apoptosis in lung cancer cells
- Patient preferences for maintenance therapy in Crohn’s disease: A discrete-choice experiment
- Diagnostic performance of serum interferon gamma, matrix metalloproteinases, and periostin measurements for pulmonary tuberculosis in Japanese patients with pneumonia
- Hesperidin improves insulin resistance via down-regulation of inflammatory responses: Biochemical analysis and in silico validation
- Accuracy of intraocular lens power calculation formulas using a swept-source optical biometer
- Characterization of black patina from the Tiber River embankments using Next-Generation Sequencing
- Comparison of blood lactate and perceived exertion responses in two matched time-under-tension protocols
- Fibrin hydrogels are safe, degradable scaffolds for sub-retinal implantation
- Post-translational modifications of Drosophila melanogaster HOX protein, Sex combs reduced
- Problem gambling, associations with comorbid health conditions, substance use, and behavioural addictions: Opportunities for pathways to treatment
- Liganded T3 receptor β2 inhibits the positive feedback autoregulation of the gene for GATA2, a transcription factor critical for thyrotropin production
- Characterization of METTL16 as a cytoplasmic RNA binding protein
- Impact of long-term storage and freeze-thawing on eight circulating microRNAs in plasma samples
- Nanosheet wrapping-assisted coverslip-free imaging for looking deeper into a tissue at high resolution
- Assessment of dynamic cerebral autoregulation in humans: Is reproducibility dependent on blood pressure variability?
- Early diagnosis of sepsis in emergency departments, time to treatment, and association with mortality: An observational study
- Validity of cerebrovascular ICD-9-CM codes in healthcare administrative databases. The Umbria Data-Value Project
- Tuberculoid leprosy: An in vivo microvascular evaluation of cutaneous lesions
- Neuromuscular blockers in the acute respiratory distress syndrome: A meta-analysis
- Identification of putative Type-I sex pheromone biosynthesis-related genes expressed in the female pheromone gland of Streltzoviella insularis
- Redefining transcriptional regulation of the APOE gene and its association with Alzheimer’s disease
- Disease-relevant mutations alter amino acid co-evolution networks in the second nucleotide binding domain of CFTR
- A bushel of viruses: Identification of seventeen novel putative viruses by RNA-seq in six apple trees
- Torque teno virus viral load is related to age, CMV infection and HLA type but not to Alzheimer's disease
- The variability of bacterial communities in both the endosphere and ectosphere of different niches in Chinese chives (Allium tuberosum)
- Tripartite factors leading to molecular divergence between human and murine smooth muscle
- Characterization of dermal skin innervation in fibromyalgia syndrome
- A neonatal nonhuman primate model of gestational Zika virus infection with evidence of microencephaly, seizures and cardiomyopathy
- A scoping review of importation and predictive models related to vector-borne diseases, pathogens, reservoirs, or vectors (1999–2016)
- Assessment of climate change impact on the malaria vector Anopheles hyrcanus, West Nile disease, and incidence of melanoma in the Vojvodina Province (Serbia) using data from a regional climate model
- Associations of cigarette smoking and burden of thoracic aortic calcification in asymptomatic individuals: A dose-response relationship
- Healthcare utilization of Mexican-American Medicare beneficiaries with and without Alzheimer’s disease and related dementias
- Evaluation of questionnaire as an instrument to measure the level of nutritional and weight gain knowledge in pregnant women in Poland. A pilot study
- TranCEP: Predicting the substrate class of transmembrane transport proteins using compositional, evolutionary, and positional information
- Non-Invasive Functional-Brain-Imaging with an OPM-based Magnetoencephalography System
- Expression of acyl-CoA-binding protein 5 from Rhodnius prolixus and its inhibition by RNA interference
- Transforming assessment of speech in children with cleft palate via online crowdsourcing
- High prevalence of off-label and unlicensed paediatric prescribing in a hospital in Indonesia during the period Aug.—Oct. 2014
- General practice management of rotator cuff related shoulder pain: A reliance on ultrasound and injection guided care
- Estimating the population size of female sex workers and transgender women in Sri Lanka
- Can helmet decrease mortality of craniocerebral trauma patients in a motorcycle accident?: A propensity score matching
- Obesity, smoking habits, and serum phosphate levels predicts mortality after life-style intervention
- Treatment of children under 4 years of age with medulloblastoma and ependymoma in the HIT2000/HIT-REZ 2005 trials: Neuropsychological outcome 5 years after treatment
- Can a semi-quantitative method replace the current quantitative method for the annual screening of microalbuminuria in patients with diabetes? Diagnostic accuracy and cost-saving analysis considering the potential health burden
- A two-arm parallel double-blind randomised controlled pilot trial of the efficacy of Omega-3 polyunsaturated fatty acids for the treatment of women with endometriosis-associated pain (PurFECT1)
- Association of benzodiazepines, opioids and tricyclic antidepressants use and falls in trauma patients: Conditional effect of age
- Burden and risk factors of cutaneous leishmaniasis in a peri-urban settlement in Kenya, 2016
- Predicting strike susceptibility and collision patterns of the common buzzard at wind turbine structures in the federal state of Brandenburg, Germany
- Embryonic thermal manipulation has short and long-term effects on the development and the physiology of the Japanese quail
- High-order radiomics features based on T2 FLAIR MRI predict multiple glioma immunohistochemical features: A more precise and personalized gliomas management
- Human-raptor conflict in rural settlements of Colombia
- Regional adaptations and parallel mutations in Feline panleukopenia virus strains from China revealed by nearly-full length genome analysis
- Long-term ecological research in southern Brazil grasslands: Effects of grazing exclusion and deferred grazing on plant and arthropod communities
- Assessment of peritoneal microbial features and tumor marker levels as potential diagnostic tools for ovarian cancer
- Survival analysis of 230 patients with unresectable hepatocellular carcinoma treated with bland transarterial embolization
- Adverse drug reaction reporting practice and associated factors among medical doctors in government hospitals in Addis Ababa, Ethiopia
- TaWAK6 encoding wall-associated kinase is involved in wheat resistance to leaf rust similar to adult plant resistance
- Deficiency syndromes in top predators associated with large-scale changes in the Baltic Sea ecosystem
- The inhibitor of apoptosis proteins antagonist Debio 1143 promotes the PD-1 blockade-mediated HIV load reduction in blood and tissues of humanized mice
- Allele specific expression of Dof genes responding to hormones and abiotic stresses in sugarcane
- Perceived relative social status and cognitive load influence acceptance of unfair offers in the Ultimatum Game
- Quantitative evaluation of choriocapillaris using optical coherence tomography and optical coherence tomography angiography in patients with central serous chorioretinopathy after half-dose photodynamic therapy
- Structure-function analyses of candidate small molecule RPN13 inhibitors with antitumor properties
- Extracting lung function measurements to enhance phenotyping of chronic obstructive pulmonary disease (COPD) in an electronic health record using automated tools
- Multiple fragmented habitat-patch use in an urban breeding passerine, the Short-toed Treecreeper
- Histological and immunohistochemical characterization of the porcine ocular surface
- Household environmental tobacco smoke exposure in healthy young children in Hong Kong: Prevalence and risk factors
- Wind energy development and wildlife conservation in Lithuania: A mapping tool for conflict assessment
- Characteristics and prognosis of primary treatment-naïve oral cavity squamous cell carcinoma in Norway, a descriptive retrospective study
- Effect of epoch length on intensity classification and on accuracy of measurement under controlled conditions on treadmill: Towards a better understanding of accelerometer measurement
- Peer distribution of HIV self-test kits to men who have sex with men to identify undiagnosed HIV infection in Uganda: A pilot study
- Error rates of human reviewers during abstract screening in systematic reviews
- Faecal analyses and alimentary tracers reveal the foraging ecology of two sympatric bats
- Urethral realignment with maximal urethral length and bladder neck preservation in robot-assisted radical prostatectomy: Urinary continence recovery
- Error metrics determination in functionally approximated circuits using SAT solvers
- Spatial movement pattern recognition in soccer based on relative player movements
- A novel visual ranking system based on arterial spin labeling perfusion imaging for evaluating perfusion disturbance in patients with ischemic stroke
- Prospective Validation of the Laboratory Risk Indicator for Necrotizing Fasciitis (LRINEC) Score for Necrotizing Fasciitis of the Extremities
- The importance of transporters and cell polarization for the evaluation of human stem cell-derived hepatic cells
- Incidence, trends, and outcomes of infection sites among hospitalizations of sepsis: A nationwide study
- Morphological and functional characteristics of mitral annular calcification and their relationship to stroke
- And the nominees are: Using design-awards datasets to build computational aesthetic evaluation model
- Service delivery interventions to increase uptake of voluntary medical male circumcision for HIV prevention: A systematic review
- Multidimensional Scales of Perceived Self-Efficacy (MSPSE): Measurement invariance across Italian and Colombian adolescents
- Diversity of Mycobacteriaceae from aquatic environment at the São Paulo Zoological Park Foundation in Brazil
- A graph-based algorithm for RNA-seq data normalization
- Parents’ underestimation of their child’s weight status. Moderating factors and change over time: A cross-sectional study
- Pharmacokinetics, absolute bioavailability and tolerability of ketamine after intranasal administration to dexmedetomidine sedated dogs
- Spatial variation in fertilizer prices in Sub-Saharan Africa
- Knowledge, beliefs, and concerns about bone health from a systematic review and metasynthesis of qualitative studies
- Successful isolation of Treponema pallidum strains from patients’ cryopreserved ulcer exudate using the rabbit model
- Effects of size and elasticity on the relation between flow velocity and wall shear stress in side-wall aneurysms: A lattice Boltzmann-based computer simulation study
- Pupil response to noxious corneal stimulation
- Incidence, risk factors and healthcare costs of central line-associated nosocomial bloodstream infections in hematologic and oncologic patients
- The impact of computed radiography and teleradiology on patients’ diagnosis and treatment in Mweso, the Democratic Republic of Congo
- Differential effects of synthetic psychoactive cathinones and amphetamine stimulants on the gut microbiome in mice
- Hepatitis B and C virus infection among HIV patients within the public and private healthcare systems in Chile: A cross-sectional serosurvey
- Increased episodes of aspiration on videofluoroscopic swallow study in children with nasogastric tube placement
- Obstructive sleep apnea and hypopnea syndrome in patients admitted in a tertiary hospital in Cameroon: Prevalence and associated factors
- Association of single nucleotide polymorphisms with dyslipidemia in antiretroviral exposed HIV patients in a Ghanaian population: A case-control study
- Sonic Hedgehog upregulation does not enhance the survival and engraftment of stem cell-derived cardiomyocytes in infarcted hearts
- The pharmacokinetic parameters and the effect of a single and repeated doses of memantine on gastric myoelectric activity in experimental pigs
- Blind method for discovering number of clusters in multidimensional datasets by regression on linkage hierarchies generated from random data
- Predictive factors of first dosage intravenous immunoglobulin-related adverse effects in children
- Description and characterization of the artisanal elasmobranch fishery on Guatemala’s Caribbean coast
- Individual and community level determinants of short birth interval in Ethiopia: A multilevel analysis
- Effects of rejection intensity and rejection sensitivity on social approach behavior in women
- The impact of IoT security labelling on consumer product choice and willingness to pay
- The development and validation of a measurement instrument to investigate determinants of health care utilisation for low back pain in Ethiopia
- Validity of the French version of the Autonomy Preference Index and its adaptation for patients with advanced cancer
- The epidemiological characteristics and spatio-temporal analysis of childhood hand, foot and mouth disease in Korea, 2011-2017
- Exponential random graph model parameter estimation for very large directed networks
- The implementation of community-based diabetes and hypertension management care program in Indonesia
- Effect of temperature variation on hospital admissions and outcomes in dogs with myxomatous mitral valve disease and new onset pulmonary edema
- The development of the Police Practices Scale: Understanding policing approaches towards street-based female sex workers in a U.S. City
- A capability approach to assess aquaculture sustainability standard compliance
- Pre-collecting lymphatic vessels form detours following obstruction of lymphatic flow and function as collecting lymphatic vessels
- Construct validity and reliability of the Talent Development Environment Questionnaire in Caribbean youth track and field athletes
- Optimization of cytotoxic activity of Nocardia sp culture broths using a design of experiments
- Tissue-resident macrophages can be generated de novo in adult human skin from resident progenitor cells during substance P-mediated neurogenic inflammation ex vivo
- Microbiota in foods from Inuit traditional hunting
- Investigating Italian disinformation spreading on Twitter in the context of 2019 European elections
- In vivo expression of peptidylarginine deiminase in Drosophila melanogaster
- Modelling zero-truncated overdispersed antenatal health care count data of women in Bangladesh
- Detection and density of breeding marsh birds in Iowa wetlands
- A lineage-specific rapid diagnostic test (Chagas Sero K-SeT) identifies Brazilian Trypanosoma cruzi II/V/VI reservoir hosts among diverse mammalian orders
- Aromatase deficiency in hematopoietic cells improves glucose tolerance in male mice through skeletal muscle-specific effects
- If host is refractory, insistent parasite goes berserk: Trypanosomatid Blastocrithidia raabei in the dock bug Coreus marginatus
- Antimicrobial resistance patterns and molecular resistance markers of Campylobacter jejuni isolates from human diarrheal cases
- Protective role of brain derived neurotrophic factor (BDNF) in obstructive sleep apnea syndrome (OSAS) patients
- An IL-18-centered inflammatory network as a biomarker for cerebral white matter injury
- Prevalence of antiphospholipid antibodies in Behçet's disease: A systematic review and meta-analysis
- Chemical analysis of snus products from the United States and northern Europe
- Effect of prednisolone on glyoxalase 1 in an inbred mouse model of aristolochic acid nephropathy using a proteomics method with fluorogenic derivatization-liquid chromatography-tandem mass spectrometry
- Impact of early-onset persistent stunting on cognitive development at 5 years of age: Results from a multi-country cohort study
- Aggregation of CAT tails blocks their degradation and causes proteotoxicity in S. cerevisiae
- Expression of concern: Compensatory increase of transglutaminase 2 is responsible for resistance to mTOR inhibitor treatment
- Common mental illness among epilepsy patients in Bahir Dar city, Ethiopia: A cross-sectional study
- Staging dementia based on caregiver reported patient symptoms: Implications from a latent class analysis
- Health-related quality of life and its determinants among ambulatory patients with epilepsy at Ambo General Hospital, Ethiopia: Using WHOQOL-BREF
- In silico analysis and high-risk pathogenic phenotype predictions of non-synonymous single nucleotide polymorphisms in human Crystallin beta A4 gene associated with congenital cataract
- Fungal diversity in canopy soil of silver beech, Nothofagus menziesii (Nothofagaceae)
- Referral decisions and its predictors related to orthopaedic care. A retrospective study in a novel primary care setting
- Readiness to prescribe: Using educational design to untie the Gordian Knot
- Influence of gelation on the retention of purple cactus pear extract in microencapsulated double emulsions
- Factors related to met needs for rehabilitation 6 years after stroke
- Association of cataract and sun exposure in geographically diverse populations of India: The CASE study. First Report of the ICMR-EYE SEE Study Group
- Investigation of injury severity in urban expressway crashes: A case study from Beijing
- Clinical outcomes of incident peritoneal dialysis patients coming from kidney transplantation program: A case-control study
- Evaluation of the factors influencing the housing safety awareness of residents in Shanghai
- Morphometric study of the diaphragmatic surface of the liver in the human fetus
- Food insecurity and dietary diversity among lactating mothers in the urban municipality in the mountains of Nepal
- Genetic characterization of Bacillus anthracis strains circulating in Italy from 1972 to 2018
- Promising antifungal activity of new oxadiazole against Candida krusei
- An atlas of personality, emotion and behaviour
- Long-term effects of intracranial islet grafting on cognitive functioning in a rat metabolic model of sporadic Alzheimer's disease-like dementia
- Compartmentalized profiling of amniotic fluid cytokines in women with preterm labor
- Comparison of the myometrial transcriptome from singleton and twin pregnancies by RNA-Seq
- Adverse reproductive effects of S100A9 on bovine sperm and early embryonic development in vitro
- Functional dynamics of bacterial species in the mouse gut microbiome revealed by metagenomic and metatranscriptomic analyses
- Astrocyte senescence promotes glutamate toxicity in cortical neurons
- Primary ciliary dyskinesia and psychological well-being in adolescence
- Dipeptidyl peptidase-4 is increased in the abdominal aortic aneurysm vessel wall and is associated with aneurysm disease processes
- Primary care physician knowledge, attitudes, and diagnostic testing practices for norovirus and acute gastroenteritis
- Microfluidic-prepared DOTAP nanoparticles induce strong T-cell responses in mice
- Intraocular scattering as a predictor of driving performance in older adults with cataracts
- Reduced bone mineral density among HIV infected patients on anti-retroviral therapy in Blantyre, Malawi: Prevalence and associated factors
- Correction: Extraversion personality, perceived health and activity participation among community-dwelling aging adults in Hong Kong
- A rainwater control optimization design approach for airports based on a self-organizing feature map neural network model
- Influence of inflammasome NLRP3, and IL1B and IL2 gene polymorphisms in periodontitis susceptibility
- 18F-FDG-PET/MRI in the diagnostic work-up of limbic encephalitis
- The socioeconomic impact of orthopaedic trauma: A systematic review and meta-analysis
- Treatment patterns among patients with moderate-to-severe ulcerative colitis in the United States and Europe
- City to city learning and knowledge exchange for climate resilience in southern Africa
- Nuclear translocation of Atox1 potentiates activin A-induced cell migration and colony formation in colon cancer
- Activity-dependent switches between dynamic regimes of extracellular matrix expression
- Molecular sequencing and morphological identification reveal similar patterns in native bee communities across public and private grasslands of eastern North Dakota
- A mathematical model for assessing the effectiveness of controlling relapse in Plasmodium vivax malaria endemic in the Republic of Korea
- Cryo-focused ion beam preparation of perovskite based solar cells for atom probe tomography
- Physiological and transcriptomic responses of Lanzhou Lily (Lilium davidii, var. unicolor) to cold stress
- Unusual genome expansion and transcription suppression in ectomycorrhizal Tricholoma matsutake by insertions of transposable elements
- Estimating associations between antidepressant use and incident mild cognitive impairment in older adults with depression
- The use of telephone communication between nurse navigators and their patients
- CNP mediated selective toxicity on melanoma cells is accompanied by mitochondrial dysfunction
- HIV RNA measurement in dried blood spots of HIV-infected patients in Thailand using Abbott m2000 system
- Retraction: Oncogenic Fibulin-5 Promotes Nasopharyngeal Carcinoma Cell Metastasis through the FLJ10540/AKT Pathway and Correlates with Poor Prognosis
- Ultra-rapid cooling of ibex sperm by spheres method does not induce a vitreous extracellular state and increases the membrane damages
- Some animals are more equal than others: Validation of a new scale to measure how attitudes to animals depend on species and human purpose of use
- Observation and quantification of the morphological effect of trypan blue rupturing dead or dying cells
- The visual perception of emotion from masks
- Hexavalent chromium removal and total chromium biosorption from aqueous solution by Quercus crassipes acorn shell in a continuous up-flow fixed-bed column: Influencing parameters, kinetics, and mechanism
- The predictive value of anthropometric indices for cardiometabolic risk factors in Chinese children and adolescents: A national multicenter school-based study
- Lean back and wait for the alarm? Testing an automated alarm system for nosocomial outbreaks to provide support for infection control professionals
- Regional disparities in health care resources in traditional Chinese medicine county hospitals in China
- Analysis on hydraulic characteristics of improved sandy soil with soft rock
- Development and use of a scale to assess gender differences in appraisal of mistreatment during childbirth among Ethiopian midwifery students
- Factors for starting biosimilar TNF inhibitors in patients with rheumatic diseases in the real world
- Correction: Force field generalization and the internal representation of motor learning
- Prevalence and foetomaternal effects of iron deficiency anaemia among pregnant women in Lagos, Nigeria
- Socioeconomic risk factors for fatal opioid overdoses in the United States: Findings from the Mortality Disparities in American Communities Study (MDAC)
- Microbiome signatures in neonatal central line associated bloodstream infections
- Interventions for incarcerated adults with opioid use disorder in the United States: A systematic review with a focus on social determinants of health
- Opening gap width influences distal tibial rotation below the osteotomy site following open wedge high tibial osteotomy
- The impact of lowbush blueberry (Vaccinium angustifolium Ait.) and cranberry (Vaccinium macrocarpon Ait.) pollination on honey bee (Apis mellifera L.) colony health status
- Surveys of knowledge and awareness of antibiotic use and antimicrobial resistance in general population: A systematic review
- Managerial capacity among district health managers and its association with district performance: A comparative descriptive study of six districts in the Eastern Region of Ghana
- Knee joint distraction in regular care for treatment of knee osteoarthritis: A comparison with clinical trial data
- Reconstruction of a regulated two-cell metabolic model to study biohydrogen production in a diazotrophic cyanobacterium Anabaena variabilis ATCC 29413
- Cochlear dysfunction is associated with styrene exposure in humans
- Intra-individual variation of particles in exhaled air and of the contents of Surfactant protein A and albumin
- Revisits, readmissions, and outcomes for pediatric traumatic brain injury in California, 2005-2014
- Enhanced handover mechanism using mobility prediction in wireless networks
- Association between regular exercise and asthma control among adults: The population-based Northern Finnish Asthma Study
- Pharyngeal microbiome alterations during Neisseria gonorrhoeae infection
- Assessment of the clinical utility of four NGS panels in myeloid malignancies. Suggestions for NGS panel choice or design
- Assessment of time management practice and associated factors among primary hospitals employees in north Gondar, northwest Ethiopia
- Genetic diversity and population structure of feral rapeseed (Brassica napus L.) in Japan
- Are the current gRNA ranking prediction algorithms useful for genome editing in plants?
- Difference between physical therapist estimation and psychological patient-reported outcome measures in patients with low back pain
- Heterogeneity in the distribution of 159 drug-response related SNPs in world populations and their genetic relatedness
- Metabolic and lipidomic profiling of steatotic human livers during ex situ normothermic machine perfusion guides resuscitation strategies
- Investigating cumulative effects of pre-performance routine interventions in beach volleyball serving
- Dispensing of antibiotics without prescription and associated factors in drug retail outlets of Eritrea: A simulated client method
- MicroRNA expression and DNA methylation profiles do not distinguish between primary and recurrent well-differentiated liposarcoma
- Assessment of acyl-CoA cholesterol acyltransferase (ACAT-1) role in ovarian cancer progression—An in vitro study
- Cytoplasmic factories, virus assembly, and DNA replication kinetics collectively constrain the formation of poxvirus recombinants
- The wavelet power spectrum of perfusion weighted MRI correlates with tumor vascularity in biopsy-proven glioblastoma samples
- Agreement between cardiovascular disease risk assessment tools: An application to the United Arab Emirates population
- Constructing HLM to examine multi-level poverty-contributing factors of farmer households: Why and how?
- Patterns of symptoms possibly indicative of cancer and associated help-seeking behaviour in a large sample of United Kingdom residents—The USEFUL study
- An automated alarm system for food safety by using electronic invoices
- Neural effects of acute stress on appetite: A magnetoencephalography study
- Use of magnetic resonance imaging to determine laterality of meniscal size in healthy volunteers
- Co-prevalence of extracranial carotid aneurysms differs between European intracranial aneurysm cohorts
- Thermal biology of two tropical lizards from the Ecuadorian Andes and their vulnerability to climate change
- When weight is an encumbrance; avoidance of stairs by different demographic groups
- Non-mycosis fungoides cutaneous lymphomas in a referral center in Taiwan: A retrospective case series and literature review
- From the host's point of view: Effects of variation in burying beetle brood care and brood size on the interaction with parasitic mites
- Kernel-based Gaussian process for anomaly detection in sparse gamma-ray data
- Unmet care needs of children with ADHD
- Accelerometer-assessed outdoor physical activity is associated with meteorological conditions among older adults: Cross-sectional results from the OUTDOOR ACTIVE study
- Identification of Korean cancer survivors’ unmet needs and desired psychosocial assistance: A focus group study
- Evaluation of inactivated Bordetella pertussis as a delivery system for the immunization of mice with Pneumococcal Surface Antigen A
- The role of moral reasoning & personality in explaining lyrical preferences
- Would you like to participate in this trial? The practice of informed consent in intrapartum research in the last 30 years
- Correction: Mutation spectrums of TSC1 and TSC2 in Chinese women with lymphangioleiomyomatosis (LAM)
- Forward lunge before and after anterior cruciate ligament reconstruction: Faster movement but unchanged knee joint biomechanics
- Challenges associated with homologous directed repair using CRISPR-Cas9 and TALEN to edit the DMD genetic mutation in canine Duchenne muscular dystrophy
- Integrated targeted serum metabolomic profile and its association with gender, age, disease severity, and pattern identification in acne
- A prospective case-control study on miRNA circulating levels in subjects born small for gestational age (SGA) evaluated from childhood into young adulthood
- Polymer-fiber-coupled field-effect sensors for label-free deep brain recordings
- Global depth perception alters local timing sensitivity
- How to detect a polytrauma patient at risk of complications: A validation and database analysis of four published scales
- Module for SWC neuron morphology file validation and correction enabled for high throughput batch processing
- Reduced gray matter volume and cortical thickness associated with traffic-related air pollution in a longitudinally studied pediatric cohort
- Recombinant human soluble thrombomodulin is associated with attenuation of sepsis-induced renal impairment by inhibition of extracellular histone release
- Human and climatic drivers affect spatial fishing patterns in a multiple-use marine protected area: The Galapagos Marine Reserve
- Correction: Leisure-time physical activity and sports in the Brazilian population: A social disparity analysis
- Application of the mixture item response theory model to the Self-Administered Food Security Survey Module for Children
- Numerical simulation of atmospheric CO2 concentration and flux over the Korean Peninsula using WRF-VPRM model during Korus-AQ 2016 campaign
- Feline irradiated diet-induced demyelination; a model of the neuropathology of sub-acute combined degeneration?
- Improved multi-parametric prediction of tissue outcome in acute ischemic stroke patients using spatial features
- Genome-wide association and epistatic interactions of flowering time in soybean cultivar
- Correction: Association between workplace bullying and burnout, professional quality of life, and turnover intention among clinical nurses
- Correction: Estimation of membrane bending modulus of stiffness tuned human red blood cells from micropore filtration studies
- Correction: Limited indirect effects of an infant pneumococcal vaccination program in an aging population
- Correction: Targeting of the Plzf Gene in the Rat by Transcription Activator-Like Effector Nuclease Results in Caudal Regression Syndrome in Spontaneously Hypertensive Rats
- Fieldwork-based determination of design priorities for point-of-use drinking water quality sensors for use in resource-limited environments
- Young women’s reproductive health conversations: Roles of maternal figures and clinical practices
- Correction: Differential recordings of local field potential: A genuine tool to quantify functional connectivity
- Survival of medial versus lateral unicompartmental knee arthroplasty: A meta-analysis
- Novel MscL agonists that allow multiple antibiotics cytoplasmic access activate the channel through a common binding site
- Is it time to stop sweeping data cleaning under the carpet? A novel algorithm for outlier management in growth data
- Changes in oak (Quercus robur) photosynthesis after winter moth (Operophtera brumata) herbivory are not explained by changes in chemical or structural leaf traits
- Mutual interaction between motor cortex activation and pain in fibromyalgia: EEG-fNIRS study
- Evaluation of liposomal ciprofloxacin formulations in a murine model of anthrax
- Analysis of cholesterol in mouse brain by HPLC with UV detection
- Sugar, amino acid and inorganic ion profiling of the honeydew from different hemipteran species feeding on Abies alba and Picea abies
- Exploring prior diseases associated with incident late-onset Alzheimer’s disease dementia
- Hypertension prevalence in patients attending tertiary pain management services, a registry-based Australian cohort study
- SRL pathogenicity island contributes to the metabolism of D-aspartate via an aspartate racemase in Shigella flexneri YSH6000
- Correction: Comprehensive genome-wide analysis of the pear (Pyrus bretschneideri) laccase gene (PbLAC) family and functional identification of PbLAC1 involved in lignin biosynthesis
- Epilepsy in a melanocyte-lineage mTOR hyperactivation mouse model: A novel epilepsy model
- Water consumption and prevalence of irritable bowel syndrome among adults
- Mixed evidence for the relationship between periodontitis and Alzheimer’s disease: A bidirectional Mendelian randomization study
- Correction: Health conditions associated with overweight in climacteric women
- Correction: Determining Glomerular Filtration Rate in Homozygous Sickle Cell Disease: Utility of Serum Creatinine Based Estimating Equations
- Modelling the number of antenatal care visits in Bangladesh to determine the risk factors for reduced antenatal care attendance
- Correction: Cumulative viral load as a predictor of CD4+ T-cell response to antiretroviral therapy using Bayesian statistical models
- Dominant negative effects by inactive Spa47 mutants inhibit T3SS function and Shigella virulence
- ICOS-deficient and ICOS YF mutant mice fail to control Toxoplasma gondii infection of the brain
- Diel patterns in swimming behavior of a vertically migrating deepwater shark, the bluntnose sixgill (Hexanchus griseus)
- Life history of northern Gulf of Mexico Warsaw grouper Hyporthodus nigritus inferred from otolith radiocarbon analysis
- Physiology education for intensive care medicine residents: A 15-minute interactive peer-led flipped classroom session
- Strengthening capacity for natural sciences research: A qualitative assessment to identify good practices, capacity gaps and investment priorities in African research institutions
- Systematic scoping review of the concept of ‘genetic identity’ and its relevance for germline modification
- Height of overburden fracture based on key strata theory in longwall face
- Laboratory strains of Bacillus anthracis lose their ability to rapidly grow and sporulate compared to wildlife outbreak strains
- Improvement of classification performance of Parkinson’s disease using shape features for machine learning on dopamine transporter single photon emission computed tomography
- Comparative pharmacokinetics and pharmacodynamics of the advanced Retinol-Binding Protein 4 antagonist in dog and cynomolgus monkey
- Correction: A handy method to remove bacterial contamination from fungal cultures
- Correction: Effect of statin on life prognosis in Japanese patients undergoing hemodialysis
- Retraction: Outer Membrane Protein A (OmpA) of Shigella flexneri 2a Induces TLR2-Mediated Activation of B Cells: Involvement of Protein Tyrosine Kinase, ERK and NF-κB
- Retraction: Biofabrication of streptomycin-conjugated calcium phosphate nanoparticles using red ginseng extract and investigation of their antibacterial potential
- Receiver operating characteristic curve analysis of clinical signs for screening of convergence insufficiency in young adults
- Correction: Drivers of deforestation in the basin of the Usumacinta River: Inference on process from pattern analysis using generalised additive models
- Efficacy of fertilizing method for different potash sources in cotton (Gossypium hirsutum L.) nutrition under arid climatic conditions
- Podocyte autophagy is associated with foot process effacement and proteinuria in patients with minimal change nephrotic syndrome
- Effect of Lactobacillus acidophilus D2/CSL (CECT 4529) supplementation in drinking water on chicken crop and caeca microbiome
- Retraction: MiR-30a-5p Antisense Oligonucleotide Suppresses Glioma Cell Growth by Targeting SEPT7
- Correction: Dynamics of plasma micronutrient concentrations and their correlation with serum proteins and thyroid hormones in patients with paracoccidioidomycosis
- Impact of lower limb osteoarthritis on health-related quality of life: A cross-sectional study to estimate the expressed loss of utility in the Spanish population
- Correction: Prevalence of damaged and missing teeth among women in the southern plains of Nepal: Findings of a simplified assessment tool
- Correction: Tissue-Specific Expressed Antibody Variable Gene Repertoires
- Retraction: Immunoglobulin G Expression in Lung Cancer and Its Effects on Metastasis
- Correction: Causal knowledge promotes behavioral self-regulation: An example using climate change dynamics
- Retraction: Use of Granulocyte Colony-Stimulating Factor for the Treatment of Thin Endometrium in Experimental Rats
- Correction: Dynamic mechanical and nanofibrous topological combinatory cues designed for periodontal ligament engineering
- Correction: Evaluating the foundations that help avert antimicrobial resistance: Performance of essential water sanitation and hygiene functions in hospitals and requirements for action in Kenya
- From seed to flour: Sowing sustainability in the use of cantaloupe melon residue (Cucumis melo L. var. reticulatus)
- Core Scientific Dataset Model: A lightweight and portable model and file format for multi-dimensional scientific data
- Accounting for measurement error to assess the effect of air pollution on omic signals
- Leucine zipper transcription factor-like 1 binds adaptor protein complex-1 and 2 and participates in trafficking of transferrin receptor 1
- Barriers for tuberculosis case finding in Southwest Ethiopia: A qualitative study
- Genetic predisposition to celiac disease in Kazakhstan: Potential impact on the clinical practice in Central Asia
- A lower psoas muscle volume was associated with a higher rate of recurrence in male clear cell renal cell carcinoma
- Two angles of overqualification-the deviant behavior and creative performance: The role of career and survival job
- Cost-utility analysis of de-escalating biological disease-modifying anti-rheumatic drugs in patients with rheumatoid arthritis
- Efficient estimation of stereo thresholds: What slope should be assumed for the psychometric function?
- Learning efficient haptic shape exploration with a rigid tactile sensor array
- Effects of dietary supplementation with a microalga (Schizochytrium sp.) on the hemato-immunological, and intestinal histological parameters and gut microbiota of Nile tilapia in net cages
- Regional versus local wind speed and direction at a narrow beach with a high and steep foredune
- Fragmented QRS complex in patients with systemic lupus erythematosus at the time of diagnosis and its relationship with disease activity
- Severe thiamine deficiency in eastern Baltic cod (Gadus morhua)
- Transfer entropy as a variable selection methodology of cryptocurrencies in the framework of a high dimensional predictive model
- Psychometric validation of Czech version of the Sport Motivation Scale
- Correction: Multiple innate antibacterial immune defense elements are correlated in diverse ungulate species
- Recognition of personality disorder and anxiety disorder comorbidity in patients treated for depression in secondary psychiatric care
- Correction: Strategies for achieving high sequencing accuracy for low diversity samples and avoiding sample bleeding using illumina platform
- PLOS One
- Archiv čísel
- Aktuální číslo
- Informace o časopisu
Nejčtenější v tomto čísle- Severity of misophonia symptoms is associated with worse cognitive control when exposed to misophonia trigger sounds
- Chemical analysis of snus products from the United States and northern Europe
- Calcium dobesilate reduces VEGF signaling by interfering with heparan sulfate binding site and protects from vascular complications in diabetic mice
- Effect of Lactobacillus acidophilus D2/CSL (CECT 4529) supplementation in drinking water on chicken crop and caeca microbiome
Kurzy
Zvyšte si kvalifikaci online z pohodlí domova
Autoři: prof. MUDr. Vladimír Palička, CSc., Dr.h.c., doc. MUDr. Václav Vyskočil, Ph.D., MUDr. Petr Kasalický, CSc., MUDr. Jan Rosa, Ing. Pavel Havlík, Ing. Jan Adam, Hana Hejnová, DiS., Jana Křenková
Autoři: MUDr. Irena Krčmová, CSc.
Autoři: MDDr. Eleonóra Ivančová, PhD., MHA
Autoři: prof. MUDr. Eva Kubala Havrdová, DrSc.
Všechny kurzyPřihlášení#ADS_BOTTOM_SCRIPTS#Zapomenuté hesloZadejte e-mailovou adresu, se kterou jste vytvářel(a) účet, budou Vám na ni zaslány informace k nastavení nového hesla.
- Vzdělávání